Fishing target system Suluu spindle and construction and application thereof

Abstract

The invention provides a fishing target system Suluu ingot as well as construction and application thereof, which are used for overcoming the defects and deficiencies in the existing medicine research and development technology. In a drug discovery process, determination of an action target of a small molecule drug is crucial, but the prior art has the problems of low efficiency, high cost and limited accuracy in the aspect of target protein recognition. The problems are solved by designing a Suluu ingot structure. According to the Solugo system, through chemical synthesis and bioengineering means, the accuracy and reliability of target capture are improved, the target of a small molecule drug can be efficiently and accurately recognized in a complex biological system, and the effectiveness of the Solugo system is verified through a series of experiments. The new system can more efficiently and accurately identify the target protein of small molecules, and provides a reliable basis for design and optimization of drugs.

Description

Technical Field

[0001] This invention belongs to the fields of biomedicine and medicinal chemistry, specifically, it relates to a fishing target system, Sulfuric acid, and its construction and application. Background Technology

[0002] Drug discovery is the initial stage of drug development, primarily involving the identification and development of new drugs. Successful drug discovery lays the foundation for subsequent research and development and significantly impacts the development process and eventual clinical application of new drugs. Small molecule drugs have always been a research hotspot in new drug development. However, because small molecule drugs typically participate in complex biological processes and interact directly or indirectly with multiple proteins, their development faces significant challenges. In this process, identifying the target of small molecule drugs—that is, recognizing the target proteins they directly bind to—becomes a crucial step. Accurate target identification is fundamental to drug design; only by clearly defining the target can drugs be effectively designed and optimized, thereby improving their efficacy and safety.

[0003] Prior art 1: Application No. 202410552303.8, titled "A Rapid Fishing Method for Active Components of Traditional Chinese Medicine Based on Multiple Target Proteins", Publication No. CN118501283A. Prior art 2: Application No. 201680026339.6, titled "Preparation Method of Exogenous Bodies Containing Target Proteins and Method for Delivering Target Proteins to Cytoplasm Using Exogenous Bodies Prepared by the Preparation Method", Publication No. CN107980045A. Prior art provides two types of solutions for target identification: one is to synthesize tagged small molecule probes to capture target proteins from total proteins using the tags; the other is to utilize the property that small molecule binding causes changes in the stability of target proteins, and screen for target proteins through proteomics. However, these methods usually require a large number of experiments, are time-consuming and costly, and have limited reliability and accuracy of results.

[0004] The main problems faced by existing technologies include: First, screening methods based on stability changes often result in low proteome coverage, making it easy to miss important targets; second, the small molecule-target protein complex needs to be washed during the experiment, but since small molecules bind to target proteins through non-covalent bonds, strict washing conditions may lead to the dissociation of target proteins, while lax washing will introduce a large number of contaminating proteins, further affecting the reliability of the results; finally, although some methods use photoaffinity reactions to imbue small molecule probes with photosensitive groups, which then covalently bind to the side chains of target proteins under laser irradiation, the efficiency of successfully capturing target proteins is not high due to the low reaction specificity.

[0005] Therefore, existing technologies have failed to achieve efficient and accurate target protein identification, which poses a significant challenge to subsequent drug design and optimization. In view of this, the present invention is proposed. Summary of the Invention

[0006] In view of the problems mentioned above and / or existing technologies, the present invention is proposed. The object of the present invention is to provide a fishing target system (Suluding) and its construction and application, so as to overcome the above-mentioned shortcomings and deficiencies of the prior art.

[0007] Compared with existing technologies, this technical solution mainly solves the following technical problems: 1. How to effectively detect proteins that weakly interact with small molecules; 2. How to avoid non-specific reactions; 3. How to improve the success rate of the target reaction and improve the reliability and accuracy of the results.

[0008] As a first aspect of the present invention, a fishing target system, characterized in that: the fishing target system, as shown in structural formula I, has the following features: Figure 2 (As shown) Formula I.

[0009] The synthetic TrLUTI molecule is synthesized by activating the small molecule to be studied and attaching it to a three-terminal linker with a chlorine atom on one end and an azide atom on the other end.

[0010] As a second aspect of the present invention, a method for constructing a fishing target system using a slug-shaped electrode is provided, characterized in that the synthetic route for constructing the fishing target system using the slug-shaped electrode is as follows: Figure 1 As shown.

[0011] Step 1: Synthesize the three-headed thulidine molecule and determine the synthetic route based on the molecular structure; after activating the small molecule to be studied, synthesize it onto a three-headed linker with a chlorine atom on one end and an azide atom on the other end, which is thulidine (TrLUTI).

[0012] Step 2: Small molecule binding to target protein: Mix TrLUTI with a solution containing the target protein so that the small molecule can effectively bind to the target protein.

[0013] Step 3: Ubiquitinate the target protein using E3 ubiquitin ligase: Covalently bind the E3 ubiquitin ligase to sulidine via a fusion protein to modify the target protein with alkyne-containing ubiquitin, which can be obtained by non-natural amino acid localization insertion technology.

[0014] Step 4: Utilize the click chemistry between azide and alkyne to covalently link small molecules with target proteins via ubiquitin.

[0015] Step 5: Use high-salt, high-surfactant washing to remove impurity proteins and further identify the target protein.

[0016] Furthermore, after the reaction in step two is completed, a high-salt, high-surfactant solution is added to remove impurities that are not bound to small molecules by washing.

[0017] Then, using appropriate methods, such as mass spectrometry and immunoblotting, the target proteins that are covalently linked to the small molecules are further identified.

[0018] This includes: 2.1 Construction of pET11a / Ubi-tRNA recombinant plasmid; 2.2 Construction of pRSFDuet-1 / PylRS recombinant plasmid; 2.3 Construction of pET11a / BioUb-tRNA recombinant plasmid.

[0019] Chemical synthesis and identification of non-natural amino acid serine / threonine kinase (Plk).

[0020] 3.1 Dissolve 3.1 g Boc-lys-OH in 30 ml of 1 M NaOH and 30 ml of THF, and heat to 0°C on ice.

[0021] 3.2 Add 980 µl of propargyl chloroformate dropwise and stir overnight at room temperature.

[0022] 3.3 On the second day, the solution was placed in an ice bath at 0°C, 150 ml of cold ether was added, and the mixture was poured into a separatory funnel for extraction. After standing and separating the layers, the lower layer was collected and poured into a new separatory funnel.

[0023] 3.4 Add 150ml of 1M ice-cold HCl. After a white precipitate appears, add 150ml of cold ethyl acetate for extraction. Let stand for 15 minutes and collect the upper ethyl acetate layer. Pour the lower layer back into the separatory funnel.

[0024] 3.5 Add 150 ml of ethyl acetate again for extraction, and collect the upper ethyl acetate layer.

[0025] 3.6 Add 10-20 g of anhydrous magnesium sulfate to the ethyl acetate layer and stir at room temperature for 1-2 hours.

[0026] 3.7 Filter to remove magnesium sulfate, collect the liquid, and rotary evaporate to obtain a yellow viscous intermediate product.

[0027] 3.8 Add 26 ml of DCM to dissolve the product, then add dropwise and stir at room temperature for 1 hour.

[0028] 3.9 Perform rotary evaporation again, and dissolve the remaining product in 200 ml of diethyl ether.

[0029] 3.10 Collect the white precipitate, and after drying, obtain the final product, the non-natural amino acid serine / threonine kinase (Plk).

[0030] 3.11 The synthesized non-natural amino acid serine / threonine kinase (Plk) was detected by mass spectrometry and nuclear magnetic resonance (HNMR). The mass spectrometry results show (see...) Figure 16 , Figure 17 The two main peaks are 457 and 1141, both of which are target peaks; the results of the 1H NMR spectrum detection show (see...) Figure 18 These test results confirmed that the synthesis of Plk was correct.

[0031] As a third aspect of the present invention, an application of a fishing target system for Sulfuric acid is characterized by: its application in metabolic research, small molecule drug development, pharmacology and toxicology.

[0032] The application of the fishing target system, Sulde, led to the discovery of target proteins of lead compounds and proteins such as enzymes bound to small molecule metabolites.

[0033] The technical solution mainly adopts the following technical means.

[0034] 1. A novel fishing target system, TrLUTI, was constructed. Its core is a three-ended molecule called TrLUTI. One end consists of a small molecule to be targeted, another end is covalently linked to an E3 ubiquitin ligase, and the third end is an azide. This design allows the small molecule to effectively bind to the target protein, and through the action of the E3 ubiquitin ligase, a special alkyne-containing ubiquitin is modified onto the target protein.

[0035] 2. By utilizing the click chemistry between azide and the alkyne group carried by ubiquitin, small molecules are covalently linked to target proteins via ubiquitin. This linkage method firmly connects small molecules to target proteins, effectively eliminating experimental noise and improving the reliability and accuracy of results.

[0036] 3. After the ligation is completed, impurity proteins are removed by washing with high salt and high surfactant, and the target protein is further identified. This method can effectively achieve efficient identification and enrichment of drug target proteins, thus providing an innovative approach for drug target discovery.

[0037] 4. Apply the above-mentioned technical means to the fields of metabolic research, small molecule drug development, pharmacology and toxicology, etc., to solve key problems such as discovering lead compound target proteins and discovering proteins such as enzymes bound by small molecule metabolites.

[0038] The beneficial effects of the present invention.

[0039] 1. High Efficiency and Accuracy: This invention is based on a novel target-fishing system—TrLUTI—which can efficiently and accurately identify and enrich the targets of small molecule drugs. This method can detect not only strongly interacting proteins but also weakly interacting proteins, thus improving the accuracy of target identification.

[0040] 2. Comprehensive reflection of small molecule-protein interaction: This invention uses E3 ubiquitin ligase to modify a special ubiquitin containing alkyne onto the target protein, causing a click chemical reaction between the azide and the alkyne, thereby covalently linking the small molecule to the target protein through ubiquitin. This method can comprehensively reflect the interaction between small molecules and proteins, which is of great significance for understanding the operation of biological systems.

[0041] 3. Elimination of experimental noise: After the connection is formed, the present invention can use high salt and high surfactant washing to remove impurities and proteins, effectively eliminating experimental noise and improving the reliability of the results.

[0042] 4. Simplified experimental procedure: The fishing target system of this invention is a three-headed molecule, one end of which is a small molecule developed by the invention, another end is covalently linked to an E3 ubiquitin ligase, and the third end is an azide. Because it can efficiently remove impurities and proteins, it significantly simplifies the workload of subsequent target verification and reduces time and economic costs.

[0043] 5. Wide range of applications: The design and application of this invention provide an innovative method for the discovery of drug targets. It is applicable not only to the study of small molecule drugs, but also to the study of the mechanisms of other small molecules, such as metabolism and toxicology. Attached Figure Description

[0044] To more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings used in the embodiments will be briefly described below. The description of the drawings is limited to certain embodiments of the present invention.

[0045] Figure 1 This invention provides the chemical synthesis route for Sulfuric acid.

[0046] Figure 2 This is the chemical structure diagram of Sulfuric acid provided by the present invention.

[0047] Figure 3 This is the HPLC of Sulfuric acid provided by the present invention.

[0048] Figure 4 This is the mass spectrometry of Sulfuric acid provided by the present invention.

[0049] Figure 5 This is the NMR hydrogen spectrum of Sulfuric acid provided by this invention.

[0050] Figure 6This is the NMR carbon spectrum of Sulfuric acid provided by the present invention.

[0051] Figure 7 This is an agarose gel electrophoresis image of the recombinant plasmids pET11a / Ubi-tRNA, pRSFDuet-1 / PylRS, and pET11a / BioUb-tRNA constructed in this invention.

[0052] After transformation with the recombinant plasmid, the target fragment was identified by bacterial polymerase chain reaction (PCR). From left to right, the fragments are ubiquitin (667 bp) and tRNA. Pyl (369 bp) and PylRS (1375 bp).

[0053] Figure 8 This is a synthetic route diagram of the non-natural amino acid serine / threonine kinase (Plk) synthesized in this invention.

[0054] Figure 9 This is the mass spectrometry of the non-natural amino acid serine / threonine kinase (Plk) synthesized in this invention.

[0055] Figure 10 This is an NMR spectrum of the non-natural amino acid serine / threonine kinase (Plk) synthesized in this invention.

[0056] Figure 11 The expression of BioUb was detected by SDS-PAGE.

[0057] Figure 12 The method involves SDS-PAGE detection of BioUbK48TAG purification and enrichment.

[0058] Figure 13 This is a UbK48TAG MALDI-TOF mass spectrum peak diagram.

[0059] Figure 14 These are the results of UbK48TAG mass spectrometry sequencing coverage.

[0060] Figure 15 This invention constructs a method for overexpressing the target protein FKBP12. F36V A schematic diagram of the E3 ubiquitin ligase Parkin plasmid.

[0061] Figure 16 It is an overexpression of the target protein FKBP12 F36V The fluorescence image and Western blot analysis of HEK293T cells.

[0062] Figure 16 Left side image of FKBP12-293T cell detection; Figure 16The right side shows a Western blot image, where lane C represents uninfected HEK293T cells and lane F represents infected HEK293T cells.

[0063] Figure 17 These are fluorescence images and Western blot results of HEK293T cells overexpressing the target protein E3 ubiquitin ligase Parkin.

[0064] Figure 17 Left side HT7-Parkin-293T cell detection. Figure 17 The right side shows a Western blot image, where lane C represents uninfected HEK293T cells and lane F represents infected HEK293T cells.

[0065] Figure 18 This is a flow cytometry result of the positive rate of mGreen-FKBP12 and HT7–Parkin-mChreey in HEK293T cells. The top left image shows the flow cytometry results of uninfected normal HEK293T cells detected in the FITC fluorescence channel; the top right image shows the flow cytometry results of uninfected normal HEK293T cells detected in the ECD fluorescence channel; the bottom left image shows the flow cytometry results of mGreen-labeled FKBP12-293T cells detected in the FITC fluorescence channel; and the bottom right image shows the flow cytometry results of mCherry-labeled HT7-Parkin-293T cells detected in the ECD fluorescence channel.

[0066] Figure 19 This is a Western blot image of the protein detection using TrLUTI molecular target assay. The top image shows TrLUTI incubated with crude cell protein extract for 1.5 hours; the bottom image shows TrLUTI incubated with crude cell protein extract for 4 hours. Detailed Implementation

[0067] The present invention will be further described below with reference to specific embodiments. It should be understood that the following embodiments are for illustrative purposes only and are not intended to limit the scope of the invention.

[0068] The construction of a fishing target system, Suluding, includes the following steps: Step 1: Synthesize the three-headed thulidine molecule and determine the synthetic route based on the molecular structure; for example: after activating the small molecule to be studied, synthesize it onto a three-headed linker with a chlorine atom on one end and an azide on the other end, that is, thulidine (TrLUTI).

[0069] Step 2: Small molecule binding to target protein: Mix TrLUTI with a solution containing the target protein so that the small molecule can effectively bind to the target protein.

[0070] Step 3: Ubiquitinate the target protein using E3 ubiquitin ligase: The ubiquitin ligase is covalently linked to sulidine via a fusion protein, and ubiquitin with alkyne is modified onto the target protein. This ubiquitin can be obtained by non-natural amino acid localization insertion technology.

[0071] Step 4: Utilize the click chemistry reaction between azide and alkyne to covalently link small molecules with target proteins via ubiquitin; Step 5: Remove contaminating proteins by washing with a high-salt, high-surfactant solution, and further identify the target protein. Specifically, after the reaction in Step 2 is complete, a high-salt, high-surfactant solution is added, and unbound contaminating proteins are removed by washing.

[0072] Then, using appropriate methods, such as mass spectrometry and immunoblotting, the target proteins that are covalently linked to the small molecules are further identified.

[0073] Experimental methods in the following examples that do not specify specific conditions are generally performed under conventional conditions.

[0074] In the following embodiments of the present invention, the His-Ubiquitin K48TAG sequence, biotin-binding peptide sequence, PylRS sequence, tRNAPyl sequence, mNeonGreenFKBP12, HalotagParkin, IRES-Puro, and Cherry sequences were synthesized by Genscript Biotech Ltd. and cloned into the pUC57 vector.

[0075] Specifically, the His-Ubiquitin K48TAG sequence is shown in SEQ ID NO.1: 5'-CATATGAGAGGATCT CACCATCACCATCACCAT ACGGATCCGATGCAGATTTTTGTTAAAACCCTGACCGGTAAAACCATTACCCTGGAAGTTGAACCGAGCGATACCATTGAAAATGTGAAAGCCAAAATTCAGGATAAAGAAGGTATTCCTCCGGATCAGCAGCGTCTGATTTTTGCAGGT TAG CAGCTGGAAGATGGTCGTACCCTGAGCGATTATAATATTCAGAAAGAAAGCACCCTGCATCTGGTTCTGCGTCTGCGTGGTGGGTAATAA-3'.

[0076] The italicized part is the N-terminal 6×His tag, used for protein purification. The underlined TAG originally was the 48th lysine residue, which was mutated to TAG to insert non-natural amino acids.

[0077] Specifically, the sequence of the biotin-binding peptide is shown in SEQ ID NO.2: 5'-GCTGGGAAAGCAGGAGAGGTGAGATACCCGCTCCGCTGGCGGGCACCGTCAGCAAAATCCTGGTGAAGGAGGGTGATACCGTGAAGGCGGGTCAGACCGTTTTGGTGCTGGAAGCAATGAAAATGGAAACTGAGATCAACGCGCCGACGGACGGCAAAGTTGAAAAGGTGTTGGTTAAGGAGCGTGACGCCGTTCAGGGCGGTCAAGGCCTGATTAAAATTGGT-3'.

[0078] Specifically, the PylRS sequence is shown in SEQ ID NO.3:

[0079] Specifically, the tRNAPyl sequence is shown in SEQ ID NO.4: 5'-GCTTCTTTGAGCGAACGATCAAAAATAAGTGGCGCCCCATCAAAAAAATATTCTCAACATAAAAAAACTTTGTGTAATACTTGTAACGCTGAATTC GGAAACCTGATCATGTAGATCGAATGGACTCTAAATCCGTTCAGCC GGGTTAGATTCCCGGGGTTTCCGCCA CTGCAGATCCTTAGCGAAAGCTAAGGATTTTTTTTA-3'.

[0080] The italicized portion is the tRNAPyl sequence, the first part is the lpp promoter sequence, and the second part is the rrnB terminator sequence.

[0081] Specifically, mNeonGreenFKBP12 F36V The sequence is as shown in SEQ ID NO.5:

[0082] Specifically, the HalotagParkin sequence is shown in SEQ ID NO.6:

[0083] Specifically, the IRES-Puro sequence is shown in SEQ ID NO.7:

[0084] Specifically, the mCherry sequence is shown in SEQ ID NO.8: 5'--3'.

[0085] In the following embodiments of the present invention, the competent Escherichia coli E. coli BL21(DE3) and DH5α used were purchased from Tiangen Biotech (Beijing) Co., Ltd.

[0086] In the following embodiments of the present invention, the HEK293T cells (human embryonic kidney cells) used were purchased from the National Experimental Cell Resource Sharing Platform and are stored in our laboratory.

[0087] In the following embodiments of the present invention, the prokaryotic expression plasmids pET11a(+) and pRSFDuet-1 were purchased from Beijing BioFeng Co., Ltd.; plasmids pHR-SFFV-KRAB-dCas9-P2A-mCherry (#60954), pSPAX2 (#12260), pMD2.G (#12259), and pWPI-IRES-Puro-ACE2-TMPRSS2 (#154987) were purchased from the Addgene platform, and pHTC-HaloTagCMV-neo was purchased from Promega.

[0088] In the following embodiments of the present invention, the EasyGeno rapid recombinant cloning kit, rapid plasmid mini-extraction kit, universal DNA purification and recovery kit, and endotoxin-free plasmid large-scale extraction kit were all purchased from Beijing Tiangen Biotech Co., Ltd.; the BCA protein concentration assay kit, ampicillin, kanamycin, IPTG, SDS, PMSF, and DTT were all purchased from Beijing Solarbio Biotechnology Co., Ltd.; PremixTag, DNA Marker, and general restriction endonucleases were all purchased from Beijing Baori Biotechnology Co., Ltd.; Triton X-100, acrylamide, methylenebisacrylamide, ammonium persulfate, dimethyl sulfoxide, HEPES, and NP40 were all purchased from Beijing Coolplay Technology Co., Ltd.; glycine was purchased from Dalian Meilun Biotechnology Co., Ltd.; glycerol and tetrahydrofuran were purchased from Fuchen Chemical Reagent Co., Ltd.; Tris was purchased from Guangzhou Saiguo Biotechnology Co., Ltd.; and anhydrous ether and sucrose were purchased from Sinopharm Chemical Reagent Co., Ltd. Limited Company; Na2EDTA·2H2O, Boc-Lys-OH, trifluoroacetic acid, and TEMED were all purchased from Shanghai Maclean Biotechnology Co., Ltd.; Ni-NTA pre-packed gravity column was purchased from Shanghai Sangon Biotech Co., Ltd.; propargyl chloroformate was purchased from Shanghai Yulan Biotechnology Co., Ltd.; newborn calf serum was purchased from Shanghai Sijiqing Company; imidazole was purchased from Tianjin Bodi Chemical Co., Ltd.; MgCl2 was purchased from Tianjin Damao Chemical Reagent Factory; ethyl acetate was purchased from Tianjin Fengchuan Chemical Reagent Technology Co., Ltd.; NaCl and dichloromethane were purchased from Tianjin Kemao Chemical Reagent Co., Ltd.; anhydrous magnesium sulfate and sodium hydroxide were purchased from Tianjin Yongsheng Chemical Reagent Co., Ltd.; FKBP12 primary antibody was purchased from Wuhan Aibotek Biotechnology Co., Ltd.; Halotag primary antibody was purchased from Prometheus (Beijing) Biotechnology Co., Ltd.; skim milk powder was purchased from Guangzhou Saiguo Biotechnology Co., Ltd.; agar powder and agarose were purchased from Lanjieke Technology Co., Ltd. DULBECCO modified EAGLE medium (DMEM) high-glucose medium, 0.25% trypsin, M-PER™ Mammalian Protein Extraction Reagent, tryptone, and yeast extract were purchased from Thermo Fisher Scientific; polybrene, polyetherimide (PEI), chloroquine, and THPTA were purchased from Sigma-Aldrich; MulI, NotI, EagI, and NruI restriction endonucleases were all purchased from NEB (Beijing) Co., Ltd.; IRDye 800CW was purchased from LI-COR (USA); MG132, GSK2643943A, and ATP were all purchased from MedChemexpress (USA); and CuI was purchased from Shanghai Maclean Biotechnology Co., Ltd.

[0089] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention. Unless otherwise specified, the experimental methods used in the embodiments are all conventional methods; the materials and reagents used are all commercially available.

[0090] Example 1: Synthesis of Sulphide.

[0091] This embodiment provides the synthetic route for sulpiride, implemented by Bono Pharmaceuticals. Figure 1 Chemical synthesis route of Sulfuric acid.

[0092] Molecular structure and post-synthesis detection results are as follows Figure 2 As shown, the molecular molecule of Sulfuric acid was detected by HPLC, mass spectrometry, NMR hydrogen spectrum and NMR carbon spectrum.

[0093] Figures 2-6 Chemical structure and identification of sulfadiazine.

[0094] Figure 2 This is the chemical structure diagram of Sulfuric acid provided by the present invention.

[0095] Figure 3 This is the HPLC of Sulfuric acid provided by the present invention.

[0096] Figure 4 This is the mass spectrometry of Sulfuric acid provided by the present invention.

[0097] Figure 5 This is the NMR hydrogen spectrum of Sulfuric acid provided by this invention.

[0098] Figure 6 This is the NMR carbon spectrum of Sulfuric acid provided by the present invention.

[0099] Note: A. Chemical structure of TrLUTI; B. Detection of TrLUTI molecules by HPLC, mass spectrometry, NMR 1H and NMR 1C spectrometry.

[0100] Example 2: Construction of recombinant plasmids pET11a / Ub-tRNA, pRSFDuet-1 / PylRS, and pET11a / BioUb-tRNA.

[0101] This embodiment provides a method for constructing recombinant plasmids. This method utilizes the PylRS / tRNAPyl molecule pair, which specifically recognizes Plk, to precisely insert the non-natural amino acid serine / threonine kinase (Plk) into the 48th lysine residue of ubiquitin. Simultaneously, the Ub sequence is pre-cloned into the DNA sequence of the biotin-binding peptide to obtain a ubiquitin protein with an alkyne side chain. The specific steps are as follows.

[0102] 2.1 Construction of pET11a / Ubi-tRNA recombinant plasmid.

[0103] 2.1.1 Plasmids containing His-UbiquitinK48TAG, PylRS, and tRNAPyl sequences were introduced into DH5α cells via heat shock transformation. After culturing, the plasmids were extracted. For specific operating procedures, please refer to the instructions of the rapid plasmid mini-prep kit.

[0104] 2.1.2 The sequences of Ubiquitin, tRNAPyl, and PylRS were amplified by polymerase chain reaction (PCR). Two copies of PylRS were cloned from different restriction sites in the pRSFDuet-1 plasmid. The PCR amplification of PylRS was performed twice. The PCR primers, reaction conditions, and PCR reaction system are shown in Tables 1 and 2. The PCR products were separated by electrophoresis, gel excision, purification, and concentration detection. The specific purification procedures were followed according to the instructions of the general DNA purification and recovery kit.

[0105]

[0106]

[0107] 2.1.3 The pET11a plasmid was digested with enzymes. The enzyme digestion reaction system is shown in Table 3. The enzyme digestion products were separated by electrophoresis, and the linearized plasmid fragments were purified.

[0108]

[0109] 2.1.4 The purified DNA fragments were recombined using a seamless cloning method. Specific operational steps were described in the EasyGeno kit instructions. The recombinant plasmid ligation system is shown in Table 4. The recombinant plasmid was transformed into DH5α, and single colonies were picked for polymerase chain reaction (PCR) identification and sequencing. The PCR primers are shown in Table 5.

[0110]

[0111]

[0112] 2.1.5 Identify and sequence the plasmid of the correct strain, denoted as pET11a / Ubi, and store at -20℃.

[0113] 2.1.6 The plasmid pET11a / Ubi was digested with EagI and NruI, and the digestion products were separated by electrophoresis to purify the linearized plasmid fragment.

[0114] 2.1.7 The pET11a / Ub vector fragment was recombined with the tRNAPyl fragment, following the same procedure as above. The recombinant plasmid was denoted as pET11a / Ubi-tRNA. If ubiquitin ligation was successful, a 667 bp band could be detected; if tRNA ligation was successful, a 369 bp band could be detected. Identification was performed by polymerase chain reaction (PCR) (see [link to PCR]). Figure 7 The pET11a / Ubi-tRNA could detect a 667 bp band and a 369 bp band.

[0115] 2.2 Construction of pRSFDuet-1 / PylRS recombinant plasmid.

[0116] The pRSFDuet-1 / PylRS plasmid was constructed using the method described above. Two copies of PylRS were cloned into the pRSFDuet-1 vector. The first PylRS fragment was cloned into the NcoI and SacI sites, and the second fragment was cloned into the NdeI and XhoI sites. If the PylRS ligation was successful, a 1375 bp band could be detected. Identification was performed by polymerase chain reaction (PCR) (see...). Figure 7 pRSFDuet-1 / PylRS can detect a 1375 bp band.

[0117] Figure 7 Agarose gel electrophoresis images of pET11a / Ub-tRNA and pRSFDuet-1 / PylRS recombinant plasmids.

[0118] Note: After transformation with the recombinant plasmid, the target fragment was identified by bacterial polymerase chain reaction (PCR). From left to right, the fragments are ubiquitin (667 bp) and tRNA. Pyl (369 bp) and PylRS (1375 bp).

[0119] 2.3 Construction of pET11a / BioUb-tRNA recombinant plasmid Based on the constructed pET11a / Ub-tRNA plasmid, a biotin-binding peptide DNA sequence was cloned before the Ub sequence to obtain the pET11a / BioUb-tRNA plasmid. Cloning method.

[0120] Example 3: Chemical synthesis and identification of non-natural amino acid serine / threonine kinase (Plk).

[0121] This embodiment provides a method for the chemical synthesis of a non-natural amino acid serine / threonine kinase (Plk). The specific operation is as follows.

[0122] 3.1 Dissolve 3.1 g Boc-lys-OH in 30 mL of 1M NaOH and 30 mL of THF, and heat to 0°C on ice.

[0123] 3.2 Add 980 µl of propargyl chloroformate dropwise and stir overnight at room temperature.

[0124] 3.3 On the second day, the solution was placed in an ice bath at 0°C, 150 mL of cold ether was added, and the mixture was poured into a separatory funnel for extraction. After standing and separating the layers, the lower layer was collected and poured into a new separatory funnel.

[0125] 3.4 Add 150 mL of 1M ice-cold HCl. After a white precipitate appears, add 150 mL of cold ethyl acetate for extraction. After standing for 15 minutes, collect the upper ethyl acetate layer and pour the lower layer back into the separatory funnel.

[0126] 3.5 Add 150 mL of ethyl acetate again for extraction, and collect the upper ethyl acetate layer.

[0127] 3.6 Add 10-20 g of anhydrous magnesium sulfate to the ethyl acetate layer and stir at room temperature for 1-2 hours.

[0128] 3.7 Filter to remove magnesium sulfate, collect the liquid, and rotary evaporate to obtain a yellow viscous intermediate product.

[0129] 3.8 Add 26 mL of DCM to dissolve the product, then add 26 mL of TFA dropwise and stir at room temperature for 1 hour.

[0130] 3.9 Perform rotary evaporation again, and dissolve the remaining product in 200 mL of diethyl ether.

[0131] 3.10 Collect the white precipitate, and after drying, obtain the final product, the non-natural amino acid serine / threonine kinase (Plk).

[0132] 3.11 The synthesized non-natural amino acid serine / threonine kinase (Plk) was detected by mass spectrometry and nuclear magnetic resonance (HNMR). The mass spectrometry results show (see...) Figure 9 The two main peaks are 457 and 1141, both of which are target peaks; the results of the 1H NMR spectrum detection show (see...) Figure 10 These test results confirmed that the synthesis of Plk was correct.

[0133] Figures 8-10 Plk synthesis route diagram, mass spectrometry and nuclear magnetic resonance detection diagram.

[0134] Figure 8 This is a synthetic route diagram of the non-natural amino acid serine / threonine kinase (Plk) synthesized in this invention.

[0135] Figure 9 This is the mass spectrometry of the non-natural amino acid serine / threonine kinase (Plk) synthesized in this invention.

[0136] Figure 10 This is an NMR spectrum of the non-natural amino acid serine / threonine kinase (Plk) synthesized in this invention.

[0137] Example 4: Expression and identification of bifunctional ubiquitin proteins with inserted non-natural amino acids.

[0138] This embodiment provides a method for obtaining ubiquitin proteins with alkyne side chains. These ubiquitin proteins can be purified by biotin or obtained through a click chemistry reaction involving the K48 alkyne. The preparation method further expresses a bifunctional ubiquitin protein with inserted non-natural amino acids, based on the recombinant plasmid described in Example 1 and the non-natural amino acid serine / threonine kinase (Plk) described in Example 2. The specific steps are as follows.

[0139] 4.1 Transform 100 ng of recombinant plasmids pET11a / BioUb-tRNA and pRSFDuet-1 / PylRS into competent Escherichia coli BL21(DE3). Spread the transformed bacterial culture onto LB agar plates containing ampicillin and kanamycin, and incubate overnight at 37°C. The next day, pick single colonies and inoculate them into 5 mL of LB liquid medium, incubating for 8 hours at 37°C and 180 rpm. Then, inoculate this seed culture into 1 L of LB medium and continue culturing. When the OD600 of the bacterial culture reaches 0.3-0.4, add a non-natural amino acid serine / threonine kinase (Plk) to a final concentration of 5 mM, and continue culturing until the OD600 reaches 0.7-0.8. Then, add IPTG to a final concentration of 1 mM and incubate at 37°C and 180 rpm for 8-12 hours.

[0140] 4.2 Pour the bacterial culture into a collection tube, centrifuge at 5000 rpm and 4°C for 20 minutes, discard the supernatant, and collect the bacterial pellet. Resuspend the pellet in 50 mL of lysis buffer, add PMSF to a final concentration of 1 mM, and incubate on ice for 30 minutes. Disrupt the pellet using an ultrasonic homogenizer at 30% operating intensity, sonicating for 2 seconds followed by a 4-second pause, maintaining an ice bath throughout the process. Then transfer the lysis buffer to a centrifuge tube, centrifuge at 23000 g and 4°C for 25 minutes, and collect the supernatant.

[0141] 4.3 Pour the supernatant into a pre-packed Ni-NTA gravity column and collect the target protein using elution buffers of different concentrations of imidazole. Finally, collect each elution buffer, detect the protein using SDS-PAGE gel electrophoresis, and analyze the positive bands stained with Coomassie Brilliant Blue using MALDI-TOF mass spectrometry.

[0142] 4.4 Results of SDS-PAGE gel electrophoresis (see [link]) Figure 11 , Figure 12The target protein band was detected in N50 elution buffer. Molecular weight determination of the sample solution was performed (see [link to sample solution]). Figure 13 The target protein had a molecular weight of 10214, corresponding to a peak at 10215. MALDI-TOF mass spectrometry identification (see...). Figure 14 The comparison results showed that the peptide coverage reached 92%, confirming the target ubiquitin protein UbK48TAG.

[0143] Figures 11-12 This is an SDS-PAGE assay of the expression and purification of BioUb as described in this invention.

[0144] Figure 11 This involves SDS-PAGE detection of BioUb expression. Note: SDS-PAGE detection of BioUb expression includes: 1. Negative control; 2. Control group with only IPTG inducer added, without Plk; 3. Group with both IPTG inducer and Plk added.

[0145] Figure 12 This is an SDS-PAGE assay for the purification and enrichment of BioUbK48TAG. Note: SDS-PAGE assay for the purification and enrichment of BioUbK48TAG. Lanes 1-7 are the supernatant after cell lysis (1), N-0 washing buffer (2), N-10 washing buffer (3), N-20 washing buffer (4), N-60 elution buffer (5), N-100 elution buffer (6), and N-200 elution buffer (7), respectively. M is the marker.

[0146] Figure 12 UbK48TAG molecular weight detection results.

[0147] Figure 13 This is a UbK48TAG MALDI-TOF mass spectrum peak diagram.

[0148] Figure 14 These are the results of UbK48TAG mass spectrometry sequencing coverage.

[0149] Example 5: Construction of recombinant plasmids pHR-HalotagParkin-mCherry and pHR-mNeonGreenFKBP12F36V.

[0150] This embodiment constructs the plasmid required for the HEK293T cell line overexpressing the target protein FKBP12F36V and the E3 ubiquitin ligase Parkin. FKBP12 F36V The gene sequences of Parkin were cloned into the lentiviral plasmid pHR vector, which can be expressed in mammalian cells, and cell lines expressing both proteins independently were obtained through lentiviral infection. For ease of screening and detection, fluorescent protein and puromycin resistance genes were inserted into both plasmids (see schematic diagram). Figure 15 The specific steps are as follows.

[0151] 5.1 Thermal shock conversion of compounds containing HaloTag, IRES-Puro, Parkin, and FKBP12 F36V The mRuby3 and mNeonGreen sequence plasmids were introduced into DH5α, and the plasmids were extracted after culturing. For specific operation steps, please refer to the instructions of the rapid plasmid miniprep kit.

[0152] 5.2 The mNeonGreenFKBP12, IRES-Puro, HalotagParkin, and P2A-mCherry sequences were amplified by polymerase chain reaction (PCR). The PCR primers, reaction conditions, and PCR reaction system are shown in Table 6. The PCR products were separated by electrophoresis, gel-cut, purified, and their concentrations were determined. Specific purification procedures were performed according to the instructions of the general DNA purification and recovery kit.

[0153]

[0154]

[0155]

[0156] Note: The IRESPuro-1 primer pair is used for ligating the Puro sequence to the mNeonGreenFKBP12 sequence, and the IRES-Puro-2 polymerase chain reaction (PCR) primer pair is used for ligating the Puro sequence to the P2A-mCherry sequence.

[0157] 5.3 The pHR plasmid was digested with restriction endonucleases MulI and NotI at 37°C for 15 minutes. The digestion products were separated by electrophoresis, and the linearized plasmid fragments were purified and their concentrations were determined.

[0158] 5.4 The purified DNA fragments were recombined using a seamless cloning method. Specific procedures were followed according to the EasyGeno kit instructions. The recombinant plasmid ligation system is shown in Table 7. The recombinant plasmid was transformed into DH5α, and single colonies were picked for polymerase chain reaction (PCR) identification and sequencing.

[0159]

[0160] Note: The connection conditions are: co-incubation in a 50℃ metal bath for 1 hour.

[0161] 5.5 Identify and sequence the plasmids of the correct strains, denoted as pHR-HalotagParkin-mCherry and pHR-mNeonGreenFKBP12.F36V , stored at -20℃.

[0162] Figure 15 The target protein FKBP12F36V and the E3 ubiquitin ligase Parkin plasmid were overexpressed, respectively.

[0163] Example 6: Lentiviral packaging and infection of target cells.

[0164] This embodiment provides a method for packaging and infecting target cells with lentivirus. The preparation method is based on the recombinant plasmid described in Example 5, and further involves packaging and infecting target cells with lentivirus. The specific steps are as follows.

[0165] 6.1 Cell resuscitation: HEK293T cells were quickly removed from the liquid nitrogen container and immediately placed in a 37°C water bath to thaw while stirring. When the frozen fragment in the tube was reduced to the size of a soybean, it was removed, and the cell suspension was transferred to a new centrifuge tube. The tube was centrifuged at 1000 rpm for 5 minutes. The supernatant was carefully discarded, and the cell pellet was resuspended in 1 mL of high-glucose DULBECCO modified EAGLE medium (DMEM) containing 10% fetal bovine serum (FBS). The entire pellet was transferred to a new T25 cell culture flask, and 4 mL of complete culture medium was added. The flask was then incubated at 37°C in a 5% CO2 incubator.

[0166] 6.2 Cell Passaging: If HEK293T cells are growing well after resuscitation, fresh culture medium should be added the day after inoculation. Passaging should begin on the third day when the cell density reaches approximately 80%. Before passage, discard the culture medium in the flask, carefully wash the cells with phosphate-buffered saline (PBS) and discard the PBS. Add 500 µl of 0.25% trypsin and incubate for 30 seconds. Observe under a microscope that the cells have shrunk and become rounded. Immediately add 2 mL of complete culture medium to stop the digestion. Transfer the cells to new centrifuge tubes and centrifuge at 1000 rpm for 5 minutes. Discard the supernatant, add fresh complete culture medium, and transfer to two new T25 cell flasks.

[0167] 6.3 Lentiviral Packaging: Expand the culture of HEK293T cells and seed 2×10⁶ cells. 7Cells were cultured in T175 cell culture flasks at approximately 70% confluence to prepare for plasmid transfection. The culture medium was replaced with one containing 5% fetal bovine serum (FBS), and chloroquine was added to a final concentration of 25 µM. The packaging plasmid pspax2, the envelope plasmid pMD2.G, and the target plasmid pHR were mixed in 200 µl of phosphate-buffered saline (PBS) at a molar ratio of 4:4:1, resulting in a total plasmid volume of 61 µg. The mixture was vortexed for 1 minute and allowed to stand for 10 minutes. 157 µl of PEI was added to 200 µl of PBS and vortexed for 1 minute, then allowed to stand for 10 minutes. The PEI solution was then added to the plasmid solution, and the mixture was gently pipetted once to mix. The mixture was allowed to stand at room temperature for 3 minutes. This PEI / plasmid mixture was then added to the cell culture flask, gently mixed, and cultured. After 3 hours, discard the culture medium and add culture medium containing 10% fetal bovine serum (FBS) to continue culturing. Collect the cell culture supernatant after 48 hours and 72 hours of culture and filter through a 0.45 µM filter. After filtration, aliquot the supernatant into 32 mL tubes, gently add 4 mL of 20% sucrose solution to the bottom, and centrifuge at 25,000 rpm and 4°C for 2 hours. Discard the supernatant after centrifugation and resuspend the virus-containing droplet at the bottom of the tube in 100 µl of pre-chilled phosphate-buffered saline (PBS). It is best to use the collected supernatant immediately or aliquot and store at -80°C. Do not repeatedly freeze and thaw.

[0168] 6.4 Lentiviral infection: Inoculate 5 × 10⁵ cells into a 6-well plate. 5 HEK293T cells were incubated on the second day with an appropriate amount of virus (100 µl) and polybrene at a ratio of 0.1%. After mixing, the cells were cultured for another 72 hours. Fluorescence was observed to determine whether the lentivirus infection was successful. Culture medium was replenished during this period.

[0169] Example 7: Screening and identification of positive cells.

[0170] This embodiment provides a method for screening and identifying positive cells. The preparation method further screens and identifies the infected cells based on the infected cells described in Example 5. The specific steps are as follows.

[0171] 7.1 Puromycin Screening: For HEK293T cells in good growth condition, puromycin was added to a final concentration of 2 µg / mL for 7 consecutive days, during which the cells were passaged normally. Well-grown cells were screened and expanded for culture. Two types of HEK293T cells infected with lentivirus were observed under a fluorescence microscope, showing expression of both mNeonGreen and mChreey.

[0172] 7.2 Western blot assay: 1×10⁻⁶ selected cells were used for the assay.6 Cells were seeded at 1 / mL in 6-well plates. When cell growth and confluence reached approximately 80%, the culture medium was discarded. Cells were washed twice with phosphate-buffered saline (PBS), and 200 µl of RIPA lysis buffer was added. After thorough mixing, the mixture was transferred to a 1.5 mL centrifuge tube and centrifuged at 14000 g for 5 minutes. The protein supernatant was collected. After protein concentration was determined using a BCA kit, the protein was separated using a 10% SDS-PAGE gel. The membrane was transferred for 10 minutes under constant pressure using a semi-dry transfer apparatus. After transfer, blocking buffer was added, and the membrane was placed on a shaker at 65 rpm and slowly shaken for 2 hours at room temperature. The blocking buffer was discarded, and the membrane was washed once with 1×TBST. A suitable amount of diluted primary antibody was added to cover the membrane, and the membrane was incubated overnight at 4°C at 65 rpm. The next day, the primary antibody was recovered, and the membrane was washed three times with 1×TBST, followed by three more washes of 10 minutes each. Diluted secondary antibody solution was added, and the membrane was incubated at room temperature at 1.5 hours at 65 rpm. The membrane was then washed three times with 1×TBST, followed by three more washes of 10 minutes each. Finally, Western blot imaging was used for detection. The results of the Western blot analysis are shown (see...). Figure 16 , Figure 17 In uninfected HEK293T cells, mNeonGreen-FKBP12 (39.2 Kda) and Halotag-Parkin (63 Kda) were not detected, while they were significantly expressed in infected cells.

[0173] Figures 16-17 It is an overexpression of the target protein FKBP12 F36V The fluorescence image and Western blot analysis of HEK293T cells containing the E3 ubiquitin ligase Parkin.

[0174] Figure 16 It is an overexpression of the target protein FKBP12 F36V The fluorescence image and Western blot analysis of HEK293T cells.

[0175] Figure 16 Left side image of FKBP12-293T cell detection; Figure 16 The right side shows a Western blot image, where lane C represents uninfected HEK293T cells and lane F represents infected HEK293T cells.

[0176] Figure 17 These are fluorescence images and Western blot results of HEK293T cells overexpressing the target protein E3 ubiquitin ligase Parkin.

[0177] Figure 17 Left side HT7-Parkin-293T cell detection. Figure 17 The right side shows a Western blot image, where lane C represents uninfected HEK293T cells and lane F represents infected HEK293T cells.

[0178] 7.3 Flow cytometry was used to detect the positive rate of 293T cells overexpressing FKBP12 and HT7-Parkin. The results showed (see...). Figure 18 The positive rate of FKBP12-293T cells reached 98.29%, and the positive rate of HT7-Parkin-293T cells expressing mChreey was 54.82%.

[0179] Figure 18 Detection of positive rates of FKBP12-293T and HT7-Parkin-293T cells.

[0180] Figure 18 This is a flow cytometry result of the positive rate of mGreen-FKBP12 and HT7–Parkin-mChreey in HEK293T cells. The top left image shows the flow cytometry results of uninfected normal HEK293T cells detected in the FITC fluorescence channel; the top right image shows the flow cytometry results of uninfected normal HEK293T cells detected in the ECD fluorescence channel; the bottom left image shows the flow cytometry results of mGreen-labeled FKBP12-293T cells detected in the FITC fluorescence channel; and the bottom right image shows the flow cytometry results of mCherry-labeled HT7-Parkin-293T cells detected in the ECD fluorescence channel.

[0181] 7.4 Positive cells overexpressing pHR-mNeonGreenFKBP12 and pHR-HalotagParkin-mCherry were named FKBP12-293T cells and HT7-Parkin-293T cells, respectively.

[0182] Example 8: Verification of the function of the Suluding fishing target.

[0183] This embodiment provides a method for validating the function of TrLUTI fishing targets. The preparation method is based on the extraction of total cellular protein from positive FKBP12-293T cells and HT7-Parkin-293T cells described in Example 7, followed by TrLUTI fishing target testing. The specific steps are as follows.

[0184] 8.1 FKBP12-293T cells and HT7-Parkin-293T cells were cultured in T25 cell flasks. When the cell confluence reached about 90%, the cells were collected with a cell scraper, centrifuged at 2000 rpm for 5 minutes, the supernatant was discarded, and the cell pellet was collected (the pellet can be frozen and stored at -80℃).

[0185] 8.2 Add 2 mL of Buffer-2 to the FKBP12-293T and HT7-Parkin-293T cell pellets, and add 1% 100 mM PMSF. Use an ultrasonic cell disruptor to disrupt the cells. Set the power to 300 W, sonicate for 2 seconds, pause for 3 seconds, and repeat for 3 cycles.

[0186] 8.3 Centrifuge the cell lysate at 12000 rpm and 4℃ for 10 minutes, discard the precipitate, and collect the protein supernatant.

[0187] 8.4 Add the supernatant to a 10000MW ultrafiltration centrifuge tube and centrifuge at 4000 rpm and 4℃ for 20 minutes.

[0188] 8.5 Collect the solution from the inner tube, detect the protein concentration using a BCA kit, mix the two protein solutions, and dilute the protein to a concentration of 0.15-0.2 mg / mL.

[0189] 8.6 Aliquot the mixed protein solution into 1.5 mL centrifuge tubes, 200 µl per tube, add ATP to a final concentration of 5 mM, and add different concentrations of BioUb and Sulfuric acid molecules as shown in Table 8. Incubate at 37°C for 4 hours.

[0190]

[0191] 8.7 Collect protein solutions of each gradient for Western blot analysis. Results are shown (see...). Figure 19 Co-incubation of sulpiride with crude cell protein extract for 1.5 hours did not cause degradation of target proteins, while co-incubation for 4 hours using 0.67-0.0027 µM (3-8) sulpiride could efficiently induce the degradation of mNeonGreen-FKBP12.

[0192] Figure 19 Results of Western blot analysis of TrLUTI target protein. Note: Top side shows TrLUTI incubated with crude cell protein extract for 1.5 hours; bottom side shows TrLUTI incubated with crude cell protein extract for 4 hours.

[0193] Due to the advanced nature of this technical solution, it can be widely applied in fields such as drug discovery, metabolic research, and small molecule drug design.

[0194] First, this invention provides a new, efficient, and accurate strategy for discovering target proteins bound by small molecules, which can greatly improve the efficiency and accuracy of drug target identification and has important application value in the field of drug discovery.

[0195] Secondly, the strategy of this invention is based on a novel fishing target system—TrLUTI, which can effectively detect the interaction between small molecules and proteins and has important application value for related fields involving small molecule binding proteins.

[0196] Finally, the strategy of this invention can effectively remove experimental noise and improve the reliability and accuracy of results, which has important application value for the field of small molecule drug development.

Claims

1. A fishing target system, characterized in that... The fishing target system, Suluding, is structured as shown in Formula I. Formula I.

2. The fishing target system Suluding as described in claim 1, characterized in that, The soludin is synthesized by activating the small molecule to be studied and attaching it to a three-terminal linker with a chlorine atom on one end and an azide atom on the other end.

3. A construction method for a fishing target system as described in claim 1, characterized in that, The construction of the fishing target system, Sulde, includes: Step 1: Synthesizing a three-terminal Sulde molecule, determining the synthetic route based on the molecular structure; activating the small molecule to be studied and synthesizing it onto a three-terminal linker with a chlorine atom at one end and an azide atom at the other, i.e., Sulde; Step 2: Binding the small molecule to the target protein: mixing Sulde with a solution containing the target protein, allowing the small molecule to effectively bind to the target protein; Step 3: Ubiquitinizing the target protein using E3 ubiquitin ligase: covalently binding the E3 ubiquitin ligase to Sulde via a fusion protein, modifying the target protein with ubiquitin containing alkyne, which can be obtained by non-natural amino acid localization insertion technology; Step 4: Utilizing the click chemistry reaction between azide and alkyne, covalently linking the small molecule to the target protein via ubiquitin; Step 5: Removing impurities by washing with high salt and high surfactant, and further identifying the target protein.

4. The construction of the fishing target system Suluding as described in claim 3, characterized in that, After the reaction in step two is completed, a high-salt, high-surfactant solution is added, and impurities that are not bound to small molecules are removed by washing.

5. The construction of the fishing target system Suluding as described in claim 3, characterized in that, Mass spectrometry and immunoblotting were used to identify target proteins that are covalently linked to small molecules.

6. The construction of the fishing target system Suluding as described in claim 5, characterized in that, Includes: construction of pET11a / Ubi-tRNA recombinant plasmid; construction of pRSFDuet-1 / PylRS recombinant plasmid; construction of pET11a / BioUb-tRNA recombinant plasmid; and chemical synthesis and identification of non-natural amino acid serine / threonine kinases.

7. The construction of the fishing target system Suluding as described in claim 6, characterized in that, The chemical synthesis and identification of the non-natural amino acid serine / threonine kinase comprises: dissolving 3.1 g Boc-lys-OH in 30 mL of 1M NaOH and 30 mL of THF, and heating to 0°C on ice; adding 980 µl of propargyl chloroformate dropwise, and stirring overnight at room temperature; the next day, heating the solution to 0°C on ice, adding 150 mL of cold diethyl ether, and extracting by pouring into a separatory funnel, allowing the layers to separate, collecting the lower layer, and pouring it into a new separatory funnel; adding 150 mL of 1M ice-cold HCl, and after a white precipitate appears, adding 150 mL of cold ethyl acetate for extraction, allowing it to stand for 15 minutes, collecting the upper ethyl acetate layer, and pouring the lower layer back into the separatory funnel; adding 150 mL of ethyl acetate again for extraction, collecting the upper ethyl acetate layer; adding 10-20 g of anhydrous magnesium sulfate to the ethyl acetate layer, and stirring at room temperature for 1-2 hours; filtering to remove magnesium sulfate, collecting the liquid, and rotary evaporating to obtain a yellow viscous intermediate; adding 26 mL of DCM to dissolve the product, and then adding 26 mL of TFA dropwise, stirring at room temperature for 1 hour. Hours; rotary evaporation again, 200 mL of diethyl ether was added to the remaining product to dissolve it; the white precipitate was collected, dried, and the final product, the non-natural amino acid serine / threonine kinase, was obtained; the synthesized non-natural amino acid serine / threonine kinase was detected by mass spectrometry and nuclear magnetic resonance; the mass spectrometry results showed that the two main peaks were 457 and 1141, which were both target peaks; the results of the proton nuclear magnetic resonance spectrum confirmed that the synthesis of Plk was correct.

8. An application of the fishing target system Suluding as described in claim 1, characterized in that: It is applied to metabolic research, small molecule drug development, pharmacology and toxicology.

9. The application of the fishing target system Suluding as described in claim 8, characterized in that: The application of the fishing target system, Sulde, led to the discovery of target proteins of lead compounds and proteins such as enzymes bound to small molecule metabolites.

Images