Engineered adeno-associated virus capsid proteins and vectors and uses thereof

By site-directed mutagenesis of the VP3 protein in the AAV vector, the generation of the VP3m truncated variant was optimized, which solved the problems of viral instability and infectivity caused by VP3m and achieved more efficient gene therapy, especially with a significant improvement in transduction in retinal tissue.

CN120842333APending Publication Date: 2025-10-28SHANGHAI LANGSHENG BIOTECHNOLOGY CO LTD
View PDF 13 Cites 0 Cited by

Patent Information

Application Number
CN202510832733.X
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-06-20
Publication Date
2025-10-28

AI Technical Summary

Technical Problem

The increased proportion of VP3m truncated variants in existing AAV vectors significantly reduces viral infectivity and stability, especially in AAV2, AAV9 and their variants, leading to capsid instability and affecting the efficacy of gene therapy.

Method used

By rationally designing and directionally modifying the VP3 protein of the AAV vector, controlling the amount of VP3m truncated variants generated, and optimizing the ratio of VP1:VP2:VP3 proteins, the stability of viral particles and transfection efficiency can be improved. Specific methods include site-directed mutation at the 211th amino acid position of the VP3 protein, such as M211L, M211G, or M211V.

Benefits of technology

It significantly improved the stability and transfection efficiency of recombinant AAV virus particles, enhanced viral infectivity and titer, reduced aggregates, and increased viral yield and storage stability, especially with a significant improvement in transduction in retinal tissue.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0005459837150000391
    Figure BDA0005459837150000391
  • Figure BDA0005459837150000392
    Figure BDA0005459837150000392
  • Figure BDA0005459837150000401
    Figure BDA0005459837150000401
Patent Text Reader

Abstract

The invention belongs to the field of gene therapy, and particularly provides a method for modifying a recombinant AAV vector and reducing capsid VP3 truncated protein, an engineered VP3 full-length protein obtained by the method, the recombinant AAV vector containing the VP3 protein and application of the vector.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of gene therapy. Specifically, this invention relates to a method for engineering an AAV vector to improve its infectivity, stability, and retinal tissue tropism, as well as an engineered full-length VP3 protein obtained by this method, a recombinant AAV vector containing this VP3 protein, and the use of the vector. Background Technology

[0002] AAV vectors are among the most promising gene therapy vectors currently available due to their near-virulence and the removal of their ability to integrate into the genome of infected cells. Furthermore, compared to many other vectors, AAV vectors exhibit lower immunogenicity due to their low pathogenicity. To date, six AAV vector-mediated gene therapy drugs have been approved or jointly approved by the European Medicines Agency and the U.S. Food and Drug Administration for clinical marketing as biologics: Glybera, Luxturna, Zolgensma, Roctavian, Upstaza, and Hemgenix. In addition, hundreds of clinical trials at various stages are underway.

[0003] AAV viral particles consist of a single-stranded DNA genome packaged within an icosahedral protein coat. The three structural proteins of the protein coat, namely capsid proteins VP1, VP2, and VP3, are all encoded by a single ORF of the cap gene, have overlapping C-termini, but extend to different degrees towards the N-terminus. VP1, VP2, and VP3 exist in the wild-type capsid in a ratio of approximately 1:1:10. VP1 and VP2 are involved in viral infectivity but are not essential for capsid assembly, while VP3 is essential for capsid assembly.

[0004] Oyama H et al. (Characterization of Adeno-Associated Virus Capsid Proteins with Two Types of VP3-Related Components by Capillary Gel Electrophoresis and Mass Spectrometry. Hum Gene Ther. 2021 Nov; 32(21-22):1403-1416.) reported the evaluation of VP components of native serotype AAV1 using capillary gel electrophoresis (CGE) and liquid chromatography-ultraviolet-mass spectrometry (LC-UV-MS). They found that the VP3 component included two types: a truncated VP3 fragment (VP3m) and a complete VP3 fragment. They also identified VP3m as a minor peak in VP3. VP3m is a shorter N-terminal VP3, and its translation begins at methionine at position 211 of VP1 (M211), unlike the conventional VP3 start codon which is at position 203 (M). The literature characterized and identified the VP3 truncated form in the AAV1 serotype, but did not conduct targeted design and activity studies on the VP3 truncated forms in other existing serotypes. Furthermore, the literature only studied the VP3m solution for AAV1, without systematically analyzing the components of the existing capsid VP3, nor conducting targeted modification and characterization analysis of the existing engineered capsids. It also failed to properly assess and address the impact of the VP3m truncated form on the recombinant AAV activity with clinical translational value. Invention Overview

[0005] Through rational and reasonable design, the inventors discovered for the first time that an increase in the proportion of the VP3m truncated form of recombinant AAV significantly reduces viral infectivity and stability, especially in AAV2, AAV9 and their variants. When the proportion of VP3m in the icosahedron is dominant, the infectivity of AAV decreases exponentially, and the capsid becomes unstable. These potential problems and challenges require rational design and targeted modification of the N-terminus of the VP3 protein in existing serotypes to improve the stability and activity of the recombinant AAV capsid, providing a more suitable capsid for the performance improvement and clinical application of gene therapy vectors.

[0006] This invention provides an improved recombinant AAV vector and a corresponding method for improving the recombinant AAV vector. The invention is characterized by minimizing the generation of the VP3 truncated form during expression by rationally designing and site-directedly mutagenesis of the 211th amino acid of the capsid protein based on different AAV serotypes, thereby significantly improving the stability and transfection efficiency of the obtained viral particles.

[0007] In some preferred embodiments, the engineering of the VP3 capsid protein results in the AAV virus containing the VP3 capsid protein possessing one or more improved properties selected from the following:

[0008] (i) The content of VP3m, the truncated form of VP3 capsid protein, is reduced;

[0009] (ii) Improved purity of capsid components;

[0010] (iii) The ratio of VP1:VP2:VP3 protein content is more stable;

[0011] (iv) Improved in vivo and / or in vitro transduction efficiency, preferably for tissues and / or cells derived from the retina;

[0012] (v) Increased viral particle infectivity and / or infectivity titer;

[0013] (vi) Increased viral production and / or reduced aggregates;

[0014] (vii) Improved virus storage stability.

[0015] In some embodiments, the present invention provides an engineered VP3 capsid protein, characterized in that the engineered VP3 capsid protein comprises (preferably at the first amino acid position) a methionine (Met) corresponding to position 203 of the amino acid sequence SEQ ID NO:1, and comprises glycine (Gly), leucine (Leu), or valine (Val) at position 211 (preferably position 9) of the amino acid sequence SEQ ID NO:1. In some preferred embodiments, the engineered VP3 capsid protein comprises leucine (Leu) at position 211 of the amino acid sequence SEQ ID NO:1, i.e., an amino acid substitution M211L relative to the wild-type sequence. In some preferred embodiments, the engineered VP3 capsid protein comprises glycine (Gly) at position 211 of the amino acid sequence SEQ ID NO:1, i.e., an amino acid substitution M211G relative to the wild-type sequence. In some preferred embodiments, the engineered VP3 capsid protein contains valine (Val) at position 211 corresponding to the amino acid sequence SEQ ID NO:1, that is, it contains an amino acid substitution M211V relative to the wild-type sequence.

[0016] In some embodiments, the engineered VP3 capsid protein of the present invention belongs to a serotype selected from the following: AAV2, AAV3, AAV4, AAV6, AAV7, AAV9, AAV12 and AAV40 and their natural or artificial variants, preferably AAV2, AAV6 and / or AAV9, for example, wild-type AAV2, wild-type AAV6 or wild-type AAV9.

[0017] In some embodiments, the engineered VP3 capsid protein of the present invention belongs to the artificial variant serotypes selected from the following: RC-C07, RC-C08, RC-C14, RC-C15 and RC-C18.

[0018] In some embodiments, the engineered VP3 capsid protein of the present invention comprises methionine (Met) at position 203 of the amino acid sequence SEQ ID NO:1, and contains glycine (Gly), leucine (Leu), or valine (Val) at position 211 of the amino acid sequence SEQ ID NO:1, and belongs to serotypes selected from AAV2, and its variant serotypes RC-C08 and RC-C14.

[0019] In some embodiments, the engineered VP3 capsid protein of the present invention is characterized by comprising methionine (Met) at position 203 of the amino acid sequence SEQ ID NO:1, and containing glycine (Gly) or leucine (Leu) at position 211 of the amino acid sequence SEQ ID NO:1, and belonging to serotypes selected from AAV9 and its variant serotype RC-C07.

[0020] In some embodiments, the engineered VP3 capsid protein of the present invention comprises or is composed of the following amino acid sequence:

[0021] (i) The amino acid sequence shown in any one of SEQ ID NO:5-11;

[0022] (ii) An amino acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with any of the amino acid sequences shown in SEQ ID NO:5-11 and having the same amino acid sequence at positions 1 and 8 of sequence ① and / or at positions 203 and 211 of sequence ② corresponding to amino acid sequences of SEQ ID NO:1.

[0023] The present invention also provides engineered adeno-associated virus (AAV) VP1 and VP2 capsid proteins, characterized in that their amino acid sequences contain the amino acid sequence of the VP3 capsid protein of the present invention at their C-terminus.

[0024] In some embodiments, the present invention provides a nucleic acid molecule comprising a gene sequence encoding the engineered VP3 capsid protein of the present invention. In some embodiments, the gene is an AAV cap gene. In some embodiments, the codon encoding the 211th amino acid corresponding to the amino acid sequence SEQ ID NO:1 in the cap gene is not ATG. In some embodiments, the codon encoding the 211th amino acid corresponding to the 211th amino acid corresponding to the amino acid sequence SEQ ID NO:1 in the cap gene is GTG, GTC, GTT, GTA, GGG, GGA, GGT, GGC, CTG, TTG, CTT, preferably GTG or CTG.

[0025] In some embodiments, the codon sequence at positions 631-633 of the cap gene corresponding to the nucleic acid sequence SEQ ID NO:12 or its equivalent coding sequence is not ATG. In some embodiments, the codon sequence at positions 631-633 of the cap gene corresponding to the nucleic acid sequence SEQ ID NO:12 or its equivalent coding sequence is GTG, GTC, GTT, GTA, GGG, GGA, GGT, GGC, CTG, TTG, CTT, preferably GTG or CTG.

[0026] In some embodiments, the cap gene belongs to a serotype selected from the following: AAV2, AAV3, AAV4, AAV6, AAV7, AAV9, AAV12 and AAV40, preferably a serotype selected from AAV2, AAV6 and AAV9, for example, wild-type AAV2, wild-type AAV6 or wild-type AAV9.

[0027] In some embodiments, the cap gene belongs to a serotype selected from the following: RC-C07, RC-C08, RC-C14, RC-C15, and RC-C18.

[0028] In some embodiments, the codon sequence encoding the 211th amino acid of the amino acid sequence SEQ ID NO:1 and / or a set of codon sequences corresponding to positions 631-633 of the nucleic acid sequence SEQ ID NO:12 are GTG, GTC, GTT, GTA, GGG, GGA, GGT, GGC, CTG, TTG, CTT, preferably GTG, and the cap gene belongs to the serotypes selected from AAV2, RC-C08 and RC-C14.

[0029] In some embodiments, the codon sequence encoding the 211th amino acid of the amino acid sequence SEQ ID NO:1 and / or a set of codon sequences corresponding to positions 631-633 of the nucleic acid sequence SEQ ID NO:12 are CTG, TTG, CTT, GGG, GGA, GGT, GGC, preferably CTG, and the cap gene belongs to the serotypes selected from AAV9 and RC-C07.

[0030] In some implementations, the sequence of the cap gene is:

[0031] (i) A nucleotide sequence encoding an amino acid sequence as shown in any one of SEQ ID NO:5-11;

[0032] (ii) Nucleotide sequences complementary to the nucleotide sequences in (i);

[0033] (iii) A nucleotide sequence that encodes the same VP1 / VP2 / VP3 protein as (i) or (ii), but is different from the nucleotide sequence of (i) or (ii) due to the degeneracy of the genetic code;

[0034] (iv) and any one of (i) to (iii) have at least 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or higher identity of the nucleotide sequence, and the set of codon sequences corresponding to positions 631-633 of the nucleic acid sequence SEQ ID NO:12 or its equivalent coding sequence is GTG, GTC, GTT, GTA, GGG, GGA, GGT, GGC, CTG, TTG, CTT, preferably GTG or CTG.

[0035] In some embodiments, the nucleic acid molecules of the present invention also encode the VP1 capsid protein and / or VP2 capsid protein of the present invention.

[0036] Therefore, in some embodiments, the present invention provides a vector, such as a plasmid, containing the nucleic acid molecule. In some specific embodiments, the vector is a packaging plasmid.

[0037] Therefore, in some embodiments, the present invention also provides a host cell, such as a packaging cell, comprising the nucleic acid molecule and / or the vector.

[0038] In some embodiments, the present invention provides improved recombinant adeno-associated virus vector particles or populations thereof comprising the engineered VP1, VP2 and / or VP3 capsid proteins of the present invention.

[0039] In some embodiments, the improved recombinant adeno-associated virus vector particles or populations thereof of the present invention do not contain or substantially do not contain a truncated form of VP3m of the VP3 capsid protein, wherein the first amino acid residue of VP3m corresponds to methionine (Met) at position 211 of the amino acid sequence SEQ ID NO:1. In some preferred embodiments of the improved recombinant adeno-associated virus vector of the present invention, the truncated form of VP3m constitutes less than 5% (by molar amount) of the total VP3 protein, preferably less than 5%, preferably less than 4%, preferably less than 3%, preferably less than 2%, preferably less than 1.5%, preferably less than 1%, preferably less than 0.9%, preferably less than 0.8%, preferably less than 0.7%, preferably less than 0.6%, preferably less than 0.5%, preferably less than 0.4%, preferably less than 0.3%, preferably less than 0.2%, preferably less than 0.1%.

[0040] In some embodiments, the serotypes of the improved recombinant adeno-associated virus vector particles or populations of the present invention are AAV2, AAV3, AAV4, AAV6, AAV7, AAV9, AAV12 and / or AAV40, with AAV2 and / or AAV9 being preferred.

[0041] In some embodiments, the serotypes of the improved recombinant adeno-associated virus vector particles or populations of the present invention are RC-C07, RC-C08, RC-C14, RC-C15 and / or RC-C18.

[0042] In some embodiments, the genome of the improved recombinant adeno-associated virus vector particle or population thereof of the present invention contains transgenic sequences, preferably also containing 5'-ITR sequences and 3'-ITR sequences. In some preferred embodiments, the 5'-ITR sequences and 3'-ITR sequences belong to the same serotype as the engineered VP3 capsid protein.

[0043] In some preferred embodiments, the genome of the improved recombinant adeno-associated virus vector particle of the present invention includes an expression cassette containing a transgenic sequence and an expression regulatory sequence.

[0044] In some preferred embodiments, the transgene is an ophthalmology-related gene, such as RPE65, AIPL1, PROM1, or RS1.

[0045] In some embodiments, compared to unmodified recombinant adeno-associated virus vector particles, the improved recombinant adeno-associated virus vector particles of the present invention exhibit a significantly reduced VP3 truncated content, improved capsid component purity, and a more stable VP1:VP2:VP3 ratio.

[0046] In some embodiments, the improved recombinant adeno-associated virus (AAV) vector particles can effectively transduce retinal tissue (especially RPE and photoreceptor cells), with significantly improved transduction efficiency. In some embodiments, the improved AAV vector particles have higher transduction efficiency than the unmodified AAV vector particles.

[0047] In some embodiments, the improved recombinant adeno-associated virus vector particles have activity and / or stability that are not lower than (preferably higher than) those of the unmodified recombinant adeno-associated virus vector particles.

[0048] The present invention also provides a method for engineering the VP3 capsid protein to reduce its expression as a truncated VP3m form, the method comprising mutating the gene encoding the VP3 capsid protein such that the protein it encodes does not contain methionine (Met) at position 211 (preferably at amino acid position 9) of the amino acid sequence SEQ ID NO:1, and preferably contains valine (Val), glycine (Gly), or leucine (Leu) at position 211 (preferably at amino acid position 9) of the amino acid sequence SEQ ID NO:1, i.e., containing amino acid substitutions M211V, M211G, and M211L.

[0049] In some implementations, the encoding gene is the AAV cap gene.

[0050] In some embodiments, the method includes mutating the cap gene such that the set of codons at positions 631-633 corresponding to the coding sequence SEQ ID NO:12 or its equivalent is not ATG. In some embodiments, the method includes mutating the cap gene such that the set of codons at positions 631-633 corresponding to the coding sequence SEQ ID NO:12 or its equivalent is GTG, GTC, GTT, GTA, GGG, GGA, GGT, GGC, CTG, TTG, CTT, preferably GTG or CTG.

[0051] In some embodiments, the set of codons at positions 631-633 of the cap gene corresponding to the nucleic acid sequence SEQ ID NO:12 or its equivalent coding sequence is replaced by ATG with GTG, GTC, GTT, GTA, GGG, GGA, GGT, GGC, CTG, TTG, CTT, preferably GTG. Preferably, the cap gene belongs to the serotypes selected from AAV2 and RC-C14.

[0052] In some embodiments, the cap gene has a set of codon sequences at positions 631-633 corresponding to the nucleic acid sequence SEQ ID NO:12 or its equivalent coding sequence replaced with CTG, TTG, CTT, GGG, GGA, GGT, GGC, preferably CTG. Preferably, the cap gene belongs to the serotypes selected from AAV9 and RC-C07.

[0053] Therefore, the present invention also provides engineered adeno-associated virus VP3 capsid protein that can be prepared or obtained by the method of the present invention.

[0054] Therefore, the present invention also provides adeno-associated viruses or populations thereof that can be prepared or obtained by the method of the present invention. In a preferred embodiment, the adeno-associated viruses or populations thereof of the present invention possess one or more improved properties selected from the following compared to unoptimized viruses:

[0055] (i) The content of VP3m, the truncated form of VP3 capsid protein, is reduced;

[0056] (ii) Improved purity of capsid components;

[0057] (iii) The ratio of VP1:VP2:VP3 protein content is more stable;

[0058] (iv) Improved in vivo and / or in vitro transduction efficiency, preferably for tissues and / or cells derived from the retina;

[0059] (v) Increased viral particle infectivity and / or infectivity titer;

[0060] (vi) Increased viral production and / or reduced aggregates;

[0061] (vii) Improved virus storage stability.

[0062] Therefore, the present invention also provides a method for optimizing AAV virus particles or populations thereof, the optimization comprising one or more characteristic improvements selected from the following:

[0063] (i) The content of VP3m, the truncated form of VP3 capsid protein, is reduced;

[0064] (ii) Improved purity of capsid components;

[0065] (iii) The ratio of VP1:VP2:VP3 protein content is more stable;

[0066] (iv) Improved in vivo and / or in vitro transduction efficiency, preferably for tissues and / or cells derived from the retina;

[0067] (v) Increased viral particle infectivity and / or infectivity titer;

[0068] (vi) Increased viral production and / or reduced aggregates;

[0069] (vii) Improved virus storage stability

[0070] The method includes engineering the VP3 capsid protein using the aforementioned method of the present invention to reduce its expression to a truncated VP3m form, and the method further includes assembling the VP3 capsid protein into viral particles.

[0071] The present invention also provides a method for generating recombinant AAV viral vector particles, the method comprising culturing packaging cells under conditions sufficient to generate recombinant AAV viral particles, wherein the packaging cells comprise a plasmid containing the nucleic acid molecule of the present invention. Preferably, the plasmid is a packaging plasmid.

[0072] In some embodiments, the method further includes the step of transducing a plasmid containing the nucleic acid molecule of the present invention into packaging cells.

[0073] In some embodiments, the method further includes the step of recovering the resulting recombinant AAV viral vector particles from the packaging cells and / or their culture system.

[0074] The present invention also provides pharmaceutical compositions comprising the recombinant AAV viral vector particles of the present invention, and optionally further comprising pharmaceutical excipients, such as pharmaceutical carriers and pharmaceutical excipients known in the art, including buffers.

[0075] In some embodiments, the use of the recombinant AAV viral vector particles or pharmaceutical compositions of the present invention is also provided for the preparation of a medicament for treating a disease, preferably an ocular disease. In some specific embodiments, the medicament is administered intraocularly, for example, via intraretinal or intravitreal administration, such as subretinal or intravitreal injection.

[0076] In some embodiments, the recombinant AAV viral vector particles or pharmaceutical compositions of the present invention are also provided for treating a disease, or for a method of treating a disease, preferably an eye disease.

[0077] In some specific embodiments, the recombinant AAV viral vector particles or pharmaceutical composition are administered via intraocular administration, such as intraretinal or intravitreal administration, such as subretinal or intravitreal administration, such as subretinal or intravitreal injection.

[0078] In some embodiments, a method of treating a disease is also provided, comprising the step of administering the recombinant AAV viral vector particles or pharmaceutical composition of the present invention to a subject in need, preferably an ocular disease. In some specific embodiments, the recombinant AAV viral vector particles or pharmaceutical composition is administered intraocularly, for example, via intraretinal or intravitreal administration, such as subretinal or intravitreal injection. Attached Figure Description

[0079] Figure 1 The diagram shows the expression of the cap gene and the engineering modification of the VP3 protein in the RC-C00 (natural AAV2), RC-C07, RC-C08 and RC-C14 serotypes of the present invention.

[0080] Figure 2 The diagram shows the in vitro activity assay of the VP3 engineered serotypes RC-C00V8 / RC-C00V27 and C00V29 of the present invention, as well as the effect of the content of the VP3 truncated variant (VP3m) on the transduction activity of AAV2 virus cells. The control group of virus particles containing different proportions of RC-C00 serotype containing VP3m was compared with its original natural parent serotype AAV2.

[0081] Figure 3 The results shown are the characterization results of the VP3 engineered serotype RC-C00V8 of this invention. The control group is its original natural parent serotype AAV2.

[0082] Figure 4 The results show the in vitro stability assay of the VP3 engineered serotype RC-C00V8 of this invention. The control group is its original natural parent serotype AAV2.

[0083] Figure 5 The results shown are the in vitro activity assay results of the engineered VP3 serum types RC-C14V12 and RC-C14V13 of the present invention. The control group is the original variant of VP3, RC-C14, which is not engineered.

[0084] Figure 6 The results shown are the characterization results of the engineered VP3 serotype RC-C14V12 of the present invention. The control group is the unengineered original variant of VP3 serotype RC-C14.

[0085] Figure 7 The results shown are the characterization and activity analysis of the engineered VP3 serum RC-C08V19 of this invention. The control group is the unengineered original variant of VP3, RC-C08.

[0086] Figure 8The results show the in vitro transduction activity and stability assays of RC-C08V19.

[0087] Figure 9 The results of the in vitro activity analysis of the engineered VP3 serum type RC-C07V22 of the present invention are shown. The control group was the unengineered original variant of VP3, serum type RC-C07V5.

[0088] Figure 10 The results show the in vivo activity assays of the VP3 engineered serotypes RCC00V8, RCC14V12, and RCC08V19 of this invention. All three carry the red fluorescent protein reporter gene mScarlet, which produces fluorescence after transduction. The fluorescence intensity reflects the transduction and expression efficiency of the transgene. The control serotypes are wild-type AAV2, RC-C08, and RC-C14, none of which have undergone VP3 protein engineering. Detailed Implementation

[0089] The present invention achieves the following improvements:

[0090] ① For the first time, this invention has obtained AAV capsids with significantly reduced VP3 truncated content in different serotypes such as wild-type AAV2 and its variant RC-C08, RC-C14 and AAV9 and its variant RC-C07 by site-directed mutation at amino acid position 211 of the capsid protein (relative to the full-length VP1 protein), namely RC-C00V8, RC-C00V27, RC-C00V29, RC-C08V19, RC-C14V12, RC-C14V13, and RC-C07V22.

[0091] ② This invention is the first to discover that the content of AAV aggregates of RC-C00V8 and RC-C14V12 is significantly reduced. Since the presence of the latter will significantly affect the viral infection titer, thereby reducing the efficacy of the product, the reduction of its content is of positive significance.

[0092] ③ In this invention, the infectious titer (IU) was detected on 293T cells, and it was found for the first time that the activity titers of RC-C00V8, RC-C08V19, and RC-C14V12 were significantly increased compared with their parents.

[0093] ④ This invention verified the transduction efficiency of the VP3m-modified capsid in different cell lines (293T, ARPE19, RGC-5, SY5Y), and for the first time discovered that RC-C00V8, RC-C00V27, RC-C00V29, RC-C08V19, and RC-C07V22 can improve the in vitro infection activity of AAV capsids in cells through the method of this invention.

[0094] ⑤ This invention evaluated viral stability on 293T cells and found for the first time that RC-C00V8 and RC-C08V19 were more stable than the control group, meaning they maintained good stability more effectively. This provides more convenience for their long-term storage and transportation under different conditions and effectively prolongs the titer of AAV vectors.

[0095] I. Existing Technology

[0096] Chinese Patent Publication No. CN116970648A discloses prior research by the applicant, which relates to a variant serotype obtained by modifying the capsid protein structure of a known natural serotype AAV2, named RC-C08. The patent is incorporated herein by reference in its entirety, and the VP3 sequence of the capsid protein of RC-C08 is specifically listed herein as shown in SEQ ID NO:2.

[0097] Chinese Patent Publication No. CN117247434B discloses prior research by the applicant, which relates to a variant serotype obtained by modifying the capsid protein structure of a known natural serotype AAV9, named RC-C07V5. The patent is incorporated herein by reference in its entirety, and the VP3 sequence of the capsid protein of RC-C07V5 is specifically listed herein as shown in SEQ ID NO:3.

[0098] Chinese Patent Publication No. CN118420721A relates to prior research by the applicant, which involves a variant serotype obtained by modifying the capsid protein structure of a known natural serotype AAV2, named RC-C14. The patent is incorporated herein by reference in its entirety, and the VP3 sequence of the capsid protein of RC-C14 is specifically listed herein as shown in SEQ ID NO:4.

[0099] II. Definition

[0100] The term “about” when used in conjunction with a numeric value means to cover a range of numeric values ​​that have a lower limit of 5% less than the specified numeric value and an upper limit of 5% greater than the specified numeric value.

[0101] As used herein, the terms “comprising” or “including” mean to include the stated elements, integers or steps, but do not exclude any other elements, integers or steps.

[0102] The term "coding" refers to the intrinsic properties of a specific nucleotide sequence in a nucleic acid that serves as a template for the synthesis of other polymers and macromolecules having a defined nucleotide sequence (e.g., rRNA, tRNA, and mRNA) or a defined amino acid sequence and biological properties derived therefrom during biological processes. Therefore, if the transcription and translation of the mRNA corresponding to a gene produces a protein in a cell or other biological system, then the gene, cDNA, or RNA encodes a protein. Both the coding strand (whose nucleotide sequence is identical to the mRNA sequence and is usually provided in the sequence listing) and the non-coding strand (which serves as a transcription template for the gene or cDNA) can be referred to as encoding the protein or other product of that gene or cDNA.

[0103] The terms “protein” and “polypeptide” are used interchangeably throughout this document to refer to a polymeric sequence containing amino acid residues. Unless otherwise specified, single-letter and three-letter codes for amino acids, as defined by the Joint Commission on Biochemical Nomenclature (JCBN) of IUPAC-IUB, are used. The single-letter X refers to any of the twenty amino acids. It should also be understood that, due to the degeneracy of the genetic code, a polypeptide may be encoded by more than one nucleotide sequence. Mutations in an amino acid sequence are named as follows: the single-letter code of the parent amino acid, followed by the position number, and then the single-letter code of the variant amino acid. For example, a mutation of glutamine (Q) at position 464 to valine (V) is represented as “Q464V”.

[0104] "Homologous" refers to the percentage identity between two polynucleotides or two polypeptide motifs. When referring to nucleic acids or fragments thereof, the term "substantially homologous" means that when optimally aligned with another nucleic acid (or its complementary strand) with appropriate nucleotide insertions or deletions, there is nucleotide sequence identity in about 90 to 100% of the aligned sequences. When referring to polypeptides or fragments thereof, the term "substantially homologous" means that when optimally aligned with another polypeptide with appropriate vacancies, insertions, or deletions, there is nucleotide sequence identity in about 90 to 100% of the aligned sequences. The term "highly conserved" means at least 80% identity, preferably at least 90% identity, and more preferably more than 97% identity. In some cases, highly conserved may refer to 100% identity. Identity is readily determined by those skilled in the art, for example, using algorithms and computer programs known to them.

[0105] As described herein, alignment between nucleic acid or peptide sequences is performed using any of a variety of publicly or commercially available multiple sequence alignment programs (e.g., "Clustal W", accessible via a web server on the Internet). Alternatively, the Vector NTI utility can be used. Many algorithms for measuring nucleotide sequence identity are also known in the art, including those included in the aforementioned programs. As another example, BLASTN can be used to compare polynucleotide sequences, providing alignment and percentage sequence identity for the best overlapping region between the query and search sequences. Similar programs can be used to compare amino acid sequences, such as the "ClustalX" program and BLASTP. Typically, any of these programs are used with default settings, but those skilled in the art can change these settings as needed. Alternatively, those skilled in the art can utilize another algorithm or computer program that provides at least the same level of identity or alignment as the referenced algorithms and programs. Alignment can be used to identify corresponding amino acids between two proteins or peptides. A "corresponding amino acid" is an amino acid in a protein or peptide sequence that has been aligned with an amino acid in another protein or peptide sequence. Corresponding amino acids can be the same or different. Corresponding amino acids that are different amino acids can be called variant amino acids.

[0106] Alternatively, for nucleic acids, homology can be determined by hybridizing polynucleotides under conditions that form stable double strands between homologous regions, followed by digestion with a single-strand-specific nuclease and size determination of the digested fragments. Essentially homologous DNA sequences can be identified in Southern hybridization experiments under stringent conditions, such as those determined for the specific system. Determining appropriate hybridization conditions is within the scope of the art.

[0107] Additionally or alternatively, the nucleic acid and protein sequences described herein may be further used as “query sequences” to perform searches against public databases, for example, to identify other family member sequences or related sequences.

[0108] As used herein, the term "isolated" means artificially obtained or produced. As used herein with respect to nucleic acids, "isolated" generally means: (i) amplified in vitro by, for example, polymerase chain reaction (PCR); (ii) produced by clonal recombination; (iii) purified by cutting and gel separation; or (iv) synthesized by, for example, chemical synthesis. Isolated nucleic acids are nucleic acids that can be readily manipulated using recombinant DNA techniques known in the art. Therefore, a nucleotide sequence contained in a vector, in which the 5' and 3' restriction sites are known or have disclosed polymerase chain reaction (PCR) primer sequences, is considered isolated, but a nucleic acid sequence present in its natural host in its native state is not. Isolated nucleic acids may be substantially purified, but this is not necessary. For example, nucleic acids isolated in a cloning or expression vector are not pure because they may contain only a small percentage of the material present in the cells in which they remain. However, such nucleic acids are also isolated, as the term is used herein, because they can be readily manipulated using standard techniques known to those skilled in the art. As used herein with respect to proteins or peptides, the term "isolated" generally refers to proteins or peptides that are artificially obtained or produced (e.g., through chemical synthesis, through recombinant DNA technology, etc.). In some embodiments, the proteins and nucleic acids of the present invention are isolated.

[0109] "Host cell" refers to any cell that contains or is capable of containing the target substance. Host cells are typically mammalian cells. Host cells can serve as recipients of AAV helper constructs, AAV small gene plasmids, accessory functional vectors, or other transferred DNA associated with the production of recombinant AAV. The term includes the offspring of the original transfected cell. Therefore, as used herein, "host cell" can refer to a cell that has been transfected with a foreign DNA sequence. It should be understood that, due to natural, accidental, or intentional mutations, the offspring of a single parent cell may not necessarily be identical to the original parent in morphology or in terms of genome or total DNA complement. As used herein, "host cell" includes any mammalian cell capable of serving as a packaging cell. In some aspects, the present invention provides transfected host cells. The terms "transfection," "transformation," or "transduction" refer to the process by which foreign nucleic acids are transferred into or introduced into a host cell. A "transfected," "transformed," or "transduced" cell is a cell that has been transfected, transformed, or transduced with a foreign nucleic acid. Cells include primary individual cells and their offspring. "Infection" is a specific form of "transfection," "transformation," or "transduction," in which foreign nucleic acids are transferred into or introduced into host cells with the help of a pathogen (such as a virus). "Infected" cells are cells that have been transfected, transformed, or transduced with a pathogen such as a virus (e.g., lentivirus).

[0110] The term "package cell" refers to a cell capable of gene transduction / transfection to assemble a target recombinant AAV viral particle. Typically, a package cell contains AAV rep and cap components integrated into the cell's genome, as well as adenovirus helper functions, and expresses any adenovirus proteins necessary for AAV production. Recombinant AAV viral particles are produced by at least transferring the target gene construct into the package cell. Examples of package cells include, but are not limited to, HEK 293 cells and their derived cell lines (HEK293T cells, HEK293F cells, etc.), HeLa, A549, Vero, CHO cells or CHO-derived cells, and other package cells.

[0111] The term “transduction unit (TU)” used in relation to viral titer refers to the number of infectious recombinant AAV vector particles that lead to the production of a functional transgenic product, as measured in a functional assay.

[0112] The term "vector genome (vg)" can refer to one or more polynucleotides that contain a set of polynucleotide sequences of a vector (e.g., a viral vector). The vector genome may be capsidated within a viral particle. Depending on the specific viral vector, the vector genome may contain single-stranded DNA, double-stranded DNA, or single-stranded or double-stranded RNA. The vector genome may contain endogenous sequences associated with a specific viral vector and / or any heterologous sequences inserted into the specific viral vector via recombination techniques. For example, a recombinant AAV vector genome may contain at least one ITR sequence flanking the promoter, filler fragment, foreign gene, and polyadenylated sequence. A complete vector genome may contain the complete set of polynucleotide sequences of the vector. In some embodiments, the infectivity of the viral vector can be measured by VG / TU. Suitable methods for measurement are known in the art.

[0113] The term "multiple of infection (MOI)" refers to the ratio of the number of viruses to the number of cells at the time of infection. Although this ratio may vary depending on the type of virus and cell, or even the culture conditions, those skilled in the art can easily determine the MOI of a particular virus to a particular cell type using known and conventional methods for experimental purposes.

[0114] As used herein, the term "cell line" refers to a population of cells that can sustain or prolong growth and division in vitro. Typically, a cell line is a clonal population derived from a single progenitor cell. It is also known in the art that spontaneous or induced changes in karyotype can occur during the storage or transfer of such a clonal population. Therefore, cells derived from the mentioned cell lines may not be identical to the progenitor cells or cultures, and the mentioned cell lines include these variants.

[0115] Cell transfection can also be performed using vectors that provide helper functionalities to AAV (e.g., helper vectors). Vectors providing helper functionalities can provide adenoviral functionalities, including, for example, E1a, E1b, E2a, and E4ORF6. The sequences of the adenoviral genes providing these functionalities can be obtained from any known adenoviral serotype, such as serotypes 2, 3, 4, 7, 12, and 40, and also include any currently identified human types known in the art. Therefore, in some embodiments, the method includes transfecting cells with a vector expressing one or more genes required for AAV replication, AAV gene transcription, and / or AAV packaging.

[0116] As used herein, when referring to genetic engineering or molecular cloning techniques, the term "vector" refers to any nucleic acid molecule and / or nucleic acid / protein complex capable of transferring a gene sequence to a target cell, such as plasmids, bacteriophages, transposons, granules, chromosomes, artificial chromosomes, viruses, virions, etc., and preferably capable of replication when it interacts with appropriate control elements or bioactive molecules within the host cell. Therefore, the term includes cloning and expression vectors as well as viral vectors. In some preferred embodiments, the gene sequence to be transferred in the vector (generally referred to as the exogenous gene sequence) is under the transcriptional control of a promoter and is transcribed and ultimately expressed as a protein in the host cell at the appropriate time and under appropriate conditions. The terms "effectively positioned," "under control," or "transcriptionally controlled" refer to the promoter being located in the correct position and orientation associated with the nucleic acid to control RNA polymerase initiation and gene expression.

[0117] The term "effective connection" means that the specified components are in a relationship that allows them to function in the intended way.

[0118] The term "regulatory sequence" or "expression control sequence" refers to a nucleic acid sequence that induces, inhibits, or otherwise controls the transcription of a protein encoding a nucleic acid sequence that is effectively linked to it. Regulatory sequences can be, for example, initiation sequences, enhancer sequences, intron sequences, and promoter sequences.

[0119] The term "expression vector or construct" refers to any type of genetic construct containing nucleic acids whose coding sequences, in part or all, can be transcribed. In some embodiments, expression involves transcription of nucleic acids, such as the production of a biologically active polypeptide product or repressive RNA (e.g., shRNA, miRNA, miRNA repressor) from a transcribed gene.

[0120] III. Recombinant AAV Vector

[0121] As used herein, the term "adeno-associated virus (AAV)" is named for its discovery in adenovirus products. AAV is a member of the Parvovirus family, comprising multiple serotypes, and its genome is single-stranded DNA. AAV is a replication-defective, non-enveloped virus whose replication in cells generally depends on the presence of a second virus, such as adenovirus, HPV, or herpesvirus, or on cofactors providing helper proteins. Currently, AAV has not been found to cause disease in humans, and therefore, it induces only a very mild immune response in humans. AAV can infect both dividing and non-dividing cells. Prototype AAV vectors based on serotype 2 have provided proof of concept for non-toxic and stable gene transfer, but have shown insufficient gene transfer efficiency in many major target tissues. In some aspects, this invention seeks to overcome this limitation by providing novel AAVs with unique tissue-targeting capabilities for gene therapy and research applications.

[0122] Although, as mentioned above, no disease has been found in humans caused by AAV, and therefore AAV induces only a very mild immune response in the human body, individuals who have been infected with AAV or have received recombinant AAV gene therapy may still retain a specific immune response against AAV, i.e., pre-existing immunity. This pre-existing immunity may be B-cell immunity (neutralizing antibodies) or T-cell immunity. Furthermore, this pre-existing immunity may be cross-reactive, meaning that pre-existing immunity induced by one AAV serotype may also be targeted by a subsequent AAV serotype. The presence of pre-existing immunity remains a significant obstacle to the use of viral vectors as gene therapy tools.

[0123] The earliest isolated AAV virus was serotype 2 AAV (AAV2). The AAV2 genome is approximately 4.7 kb long, with 145 bp inverted terminal repeats (ITRs) at both ends, exhibiting a palindromic-hairpin structure. The genome contains two large open reading frames (ORFs), encoding the Rep and Cap genes, respectively.

[0124] ITRs are cis-acting elements of the AAV vector genome, playing a crucial role in AAV viral integration, rescue, replication, and genome packaging. ITR sequences contain a Rep protein binding site (RBS) and a terminal resolution site (trs), enabling them to be recognized by Rep protein binding and creating a nick at the trs. ITR sequences can also form a distinctive "T"-shaped secondary structure, playing a vital role in the AAV viral life cycle. In embodiments of the present invention, ITR sequences from any serotype known in the art can be used. In some preferred embodiments, the present invention uses an ITR sequence from AAV serotype 2.

[0125] The AAV genome, such as the AAV2 genome, can be divided into two functional regions: the Rep gene region and the Cap gene region.

[0126] The Rep gene region encodes four Rep proteins: Rep78, Rep68, Rep52, and Rep40. Rep proteins play crucial roles in AAV viral replication, integration, rescue, and packaging. Rep78 and Rep68 specifically bind to the terminal unwinding sites trs and GAGY repeat motifs in the ITR, initiating the AAV genome replication process from single-stranded to double-stranded. The trs and GAGC repeat motifs and / or GAGY repeat motifs in the ITR are central to AAV genome replication; therefore, although the ITR sequences differ across AAV serotypes, they all form hairpin structures and contain Rep binding sites. The p19 promoter is located at position 19 on the AAV2 genome map, initiating the expression of Rep52 and Rep40, respectively. Rep52 and Rep40 possess ATP-dependent DNA helicase activity but lack DNA-binding function.

[0127] The term "capsid protein" encompasses the proteins that form part of the viral capsid. For adeno-associated virus (AAV), the capsid proteins are generally referred to as VP1, VP2, and / or VP3, and each is encoded by a single cap gene. For AAV, these three AAV capsid proteins are generated in an overlapping manner from the cap open reading frame (ORF) via alternating mRNA splicing and / or alternating translation start codons, using a common stop codon. VP1 of AAV2 is generally translated from the ATG start codon (amino acid M1) on 2.4-kb mRNA, while VP2 and VP3 of AAV2 originate from a smaller 2.3-kb mRNA, using the weaker ACG start codon to generate VP2 (amino acid T138), and are read through to the next available ATG codon (amino acid M203) to generate the most abundant capsid protein, VP3. Therefore, VP3 is the common C-terminal region of the three VPs; VP2 is approximately 57 amino acid residues longer at the N-terminus than VP3, and the entire sequence of VP2 is contained within VP1; compared to VP2, VP1, encoded by the complete Cap gene reading frame, has a unique N-terminal sequence of approximately 138 amino acids. The VP3 protein, as a common sequence, is responsible for assembling the icosahedral capsid and is the main protein constituting AAV particles, being the most numerous; VP1 is essential for the formation of infectious AAV; VP2 assists VP3 in entering the cell nucleus. In mature AAV particles, the ratio of VP1, VP2, and VP3 is approximately 1:1:10. The amino acid sequences of adeno-associated virus (AAV) capsid proteins are well-known in the art and are generally conserved. The exemplary sequence of AAV2 VP1 can be found in NCBI Reference Sequence YP_680426, i.e., SEQ ID NO:1 of this application. Wild-type sequences of VP1 protein from other serotypes, or wild-type VP2 and VP3 protein sequences from any serotype, can be readily found in bioinformatics databases (e.g., NCBIGenbank) using methods known in the art. Furthermore, unless otherwise specified, the amino acid positions provided herein are determined with reference to the amino acid positions of AAV2 VP1 shown in SEQ ID NO:1. Those skilled in the art can easily determine the positions of the same amino acids within the VP2 and / or VP3 capsid proteins of AAV. For other serotypes of VP1, VP2, and VP3 capsid proteins, those skilled in the art can easily map their sequences to the corresponding positions in SEQ ID NO:1. Therefore, the AAV capsid proteins described in this article include type 2 AAV (AAV2), type 3 AAV (AAV3), type 4 AAV (AAV4), type 5 AAV (AAV5), type 6 AAV (AAV6), type 7 AAV (AAV7), type 8 AAV (AAV8), type 9 AAV (AAV9), or AAV2.GL, etc.

[0128] When this document refers to SEQ ID NO:12 or its equivalent coding sequence, it is intended to indicate that the equivalent coding sequence encodes the exact same amino acid sequence as the nucleic acid sequence of SEQ ID NO:12. However, those skilled in the art will understand that, due to codon degeneracy, the equivalent coding sequence may differ considerably from the nucleic acid sequence of SEQ ID NO:12, which does not affect its functional "equivalence" in encoding proteins.

[0129] As used herein, the term "recombinant adeno-associated virus (recombinant AAV) vector" refers to a highly efficient exogenous gene transfer tool obtained by recombining wild-type AAV viruses, based on our understanding of the AAV virus life cycle and related molecular biological mechanisms. The recombinant AAV vector genome contains only the AAV virus's ITR sequence and an expression cassette carrying the exogenous gene to be transferred. The encoding genes for the Rep and Cap proteins required for AAV virus packaging are not included in the recombinant AAV vector genome but are provided through other exogenous plasmids. This provides sufficient space for the transgene carried by the vector while reducing the potential harm caused by packaging the Rep and Cap genes into the recombinant AAV vector. In this article, the term "recombinant adeno-associated virus (recombinant AAV) vector particle" is also used when intended to indicate the structure of the recombinant AAV vector itself.

[0130] In some embodiments, the recombinant adeno-associated virus (recombinant AAV) vector described herein includes amino acid changes across the capsid protein range, such as, but not limited to, substitution, deletion (i.e., removal), and addition (i.e., insertion). In some embodiments, the amino acid changes occur in all three capsid proteins.

[0131] In some embodiments, the recombinant adeno-associated virus (recombinant AAV) vector of the present invention can be used to deliver gene therapy to the whole body, for example, preferably, ocular tissue. In some preferred embodiments, the recombinant AAV vector of the present invention can be used to deliver gene therapy to human retinal tissue (e.g., RPE and / or photoreceptor cells), thereby enabling the recombinant AAV vector of the present invention to treat retinopathy.

[0132] In some embodiments, the recombinant adeno-associated virus (recombinant AAV) vector of the present invention can be used to treat diseases, such as ocular diseases, including genetically derived ocular diseases acquired through genetic or somatic mutations, such as dry age-related macular degeneration (dryAMD), geographic atrophy, crystalline retinal degeneration (BCD), wet age-related macular degeneration (wAMD), retinitis pigmentosa (RP), Fabry disease, choroidal dysplasia, Leber hereditary optic neuropathy (LHON), Stargardt disease, X-linked retinoschisis and X-linked retinitis pigmentosa, Leber congenital amaurosis, and hereditary retinal degeneration (IRD). The diseases can also be CNS-related diseases and diseases suitable for systemic administration.

[0133] In some embodiments, the recombinant adeno-associated virus (recombinant AAV) vector of the present invention is suitable for use in combination with other therapeutic agents or agents to treat diseases such as hemophilia, Canavan disease, Alzheimer's disease, lysosomal storage disease, adrenal medullary neuropathy, Parkinson's disease, amyotrophic lateral sclerosis (ALS), hereditary cardiomyopathy, familial hypercholesterolemia, Wilson's disease, Duchenne muscular dystrophy (DMD), Becker muscular dystrophy (BMD), epidermolysis bullosa (EB), hereditary deafness, type 1 diabetes, etc., or combinations thereof.

[0134] In some aspects, the present invention provides isolated recombinant AAV. Methods for obtaining recombinant AAV are well known in the art. Prior art has relatively mature packaging systems for recombinant AAV vectors, which facilitates the large-scale production of recombinant AAV vectors.

[0135] Many methods are known in the art for packaging recombinant AAV vectors. Currently, commonly used recombinant AAV vector packaging systems mainly include three-plasmid co-transfection systems, systems using adenovirus as a helper virus, packaging systems using herpes simplex virus type 1 (HSV1) as a helper virus, and baculovirus-based packaging systems. Each packaging system has its own characteristics, and those skilled in the art can make appropriate choices as needed. Recombinant AAV production cultures used to generate recombinant AAV viral particles require: 1) suitable host cells, including, for example, human cell lines such as HEK-293T cells, or insect cell lines (in the case of baculovirus production systems); 2) suitable helper virus function, provided by wild-type or mutant adenovirus (such as temperature-sensitive adenovirus), herpesvirus, baculovirus, or plasmid constructs providing the helper function; 3) AAV rep and cap genes and gene products; 4) a foreign gene flanking at least one AAV ITR sequence, preferably driven by an effectively linked promoter; and 5) a suitable culture system to support recombinant AAV production. Suitable culture media known in the art can be used to generate recombinant AAV vectors.

[0136] In the context of this document, the terms "transgenic," "exogenous gene," and "gene of interest (GOI)" have the same meaning and can be used interchangeably, referring to a nucleic acid sequence fragment that is genotypically distinct from the remaining genes of the nucleic acid / vector / host cell, etc., to which it is derived, introduced, or integrated. For example, a polynucleotide introduced into a different cell type via genetic engineering is an exogenous gene (encoding and expressing an exogenous polypeptide). Similarly, a cell sequence (e.g., a gene or a portion thereof) incorporated into a viral vector is an exogenous gene sequence relative to said vector. Those skilled in the art will understand that, in most cases, the introduction of an exogenous gene is based on the substantial lack of the gene and / or its function at the site of introduction, and thus its introduction where necessary, resulting in a substantial change (e.g., a significant increase) in the number and / or function of the gene. In a preferred embodiment, the exogenous gene of the present invention is the m-Scarlet red fluorescent protein gene. As a commonly used reporter gene in the field, it is expressed in eukaryotic cells to produce red fluorescent protein, which emits red fluorescence upon excitation at an appropriate wavelength. This allows researchers to detectably obtain the area and / or quantity of its expression, thereby directly assessing, for example, the transduction efficiency, infection efficiency, and expression efficiency of cell populations, the transduction results of individual cells, the protein expression location, etc. Methods for detecting red fluorescent protein are well known in the art, and the required reagents / instruments are readily available (e.g., commercially available). In some preferred embodiments, the exogenous gene of the present invention is an ophthalmology-related gene, such as the nucleic acid encoding a protein used to treat ophthalmic diseases, such as RPE65, AIPL1, PROM1, or RS1. In some further embodiments, the protein used to prevent or treat ophthalmic diseases includes, but is not limited to, RPE65, AIPL1, PROM1, RS1, or antibody analogs.

[0137] Components for culturing in host cells to package the recombinant AAV vector in an AAV capsid can be provided trans-to the host cells. Alternatively, any one or more desired components (e.g., the recombinant AAV vector genome, rep sequence, cap sequence, and / or helper) can be provided by stable host cells modified to contain one or more desired components using methods known to those skilled in the art. For example, such stable host cells derived from 293 cells (containing an E1 helper under constitutive promoter control) but containing rep and / or cap proteins under inducible promoter control can be generated. Additional stable host cells can also be generated by those skilled in the art.

[0138] IV. Treatment Methods

[0139] The term “treatment” refers to a clinical intervention intended to alter the natural course of a disease in an individual receiving treatment. Desired therapeutic effects include, but are not limited to, preventing the onset or recurrence of the disease, alleviating symptoms, reducing any direct or indirect pathological consequences of the disease, slowing the rate of disease progression, improving or mitigating the disease state, and alleviating or improving prognosis. When used herein, “prevention” includes the prevention or suppression of the occurrence or development of a disease or symptoms of a particular disease.

[0140] This invention provides methods for preventing or treating diseases, including delivering the recombinant AAV, pharmaceutical composition, and / or kit of the invention as described above to a subject in need. In some preferred embodiments, the disease is an ocular disease, such as retinopathy. In some more preferred embodiments, the disease is IRD. In some embodiments, the drug is prepared to be administered via systemic, intravenous, intramuscular, subcutaneous, oral, topical, local contact, intraperitoneal, or intralesional administration. In some preferred embodiments, the drug is prepared to be administered via eye drops, intravitreal injection, subconjunctival injection, intra-anterior chamber injection, intravitreal injection, or subretinal injection.

[0141] Recombinant AAV can be delivered as a composition to a subject in need, preferably for the purpose of disease prevention or treatment, using any suitable method known in the art. Recombinant AAV (preferably suspended in a physiologically compatible carrier (e.g., in composition form)) can be administered to a subject in need, for example, a host animal such as a human, mouse, rat, cat, dog, sheep, rabbit, horse, cattle, goat, pig, guinea pig, hamster, chicken, turkey, or non-human primate (e.g., macaque).

[0142] Considering the intended applications of recombinant AAV, those skilled in the art can readily select suitable pharmaceutical excipients. For example, a suitable excipient includes saline solution, which can be formulated using various buffer solutions (e.g., phosphate-buffered saline). Other exemplary carriers include sterile saline, lactose, sucrose, calcium phosphate, gelatin, dextran, agar, pectin, peanut oil, sesame oil, and water. The choice of excipient is not a limitation of this invention.

[0143] Optionally, the compositions of the present invention may also contain other conventional pharmaceutical ingredients, such as preservatives or chemical stabilizers. Suitable exemplary preservatives include chlorobutanol, potassium sorbate, sorbic acid, sulfur dioxide, propyl gallate, parabens, ethyl vanillin, glycerin, phenol, and p-chlorophenol. Suitable chemical stabilizers include gelatin and albumin.

[0144] Formulations that can be pharmaceutically excipients are well known to those skilled in the art, as are the development of suitable dosing and treatment regimens for the use of the specific compositions described herein in a variety of treatment options.

[0145] Apply recombinant AAV in sufficient quantities to transfect cells of the desired tissue and provide adequate gene transfer and expression levels without excessive adverse effects.

[0146] The dosage of recombinant AAV virion required to achieve a specific "therapeutic effect" (e.g., a dosage unit of genome copies per kilogram of body weight (GC / kg)) will vary depending on several factors, including but not limited to: the route of administration of the recombinant AAV virion, the gene or RNA expression level required to achieve the therapeutic effect, the specific disease or condition being treated, and the stability of the gene or RNA product. Those skilled in the art can readily determine the range of recombinant AAV virion dosages for treating patients with a specific disease or condition based on the above factors and other factors known in the art.

[0147] An effective dose of recombinant AAV is an amount sufficient to target and infect an animal and target the desired tissue. In some embodiments, the effective dose of recombinant AAV is an amount sufficient to produce a stable somatic transgenic animal model. The effective dose will depend primarily on factors such as the species, age, weight, health of the subject, and the tissue to be targeted, and therefore can vary between animals and tissues. For example, an effective dose of recombinant AAV typically contains approximately 10 9 Up to 10 16 A solution of approximately 1 ml to approximately 100 ml containing one genome copy. In some embodiments, 10 copies per subject. 10 10 11 10 12 10 13 10 14 or 10 15 Recombinant AAV is administered at a dose of 10 copies of the genome. In some implementations, it is administered at 10 copies per kg. 10 10 11 10 12 10 13 or 10 14 Recombinant AAV is administered at a dose of one genome copy. In some cases, approximately 10 11 Up to 10 12 A dose of one recombinant AAV genome copy is appropriate.

[0148] Typically, these formulations may contain at least about 0.1% or more of the active compound, although the percentage of the active ingredient can, of course, vary and can conveniently be about 1% or 2% to about 70% or 80% or higher of the total weight or volume of the formulation. Naturally, the amount of the active compound in each therapeutically useful composition can be prepared in such a way that a suitable dose will be obtained in any given unit dose of the compound. Those skilled in the art in preparing such pharmaceutical formulations will consider factors such as solubility, bioavailability, biological half-life, route of administration, product shelf life, and other pharmacological considerations; therefore, a variety of dosages and treatment regimens may be desirable.

[0149] In some embodiments, it is desirable to deliver the recombinant AAV-based therapeutic construct of the appropriately formulated pharmaceutical composition disclosed herein intraocularly, for example by intraretinal or intravitreal administration, such as subretinal or intravitreal administration, for example, by injection.

[0150] Suitable pharmaceutical forms for injectable applications include sterile aqueous solutions or dispersions and sterile powders for the ad hoc preparation of sterile injectable solutions or dispersions. Dispersions can also be prepared in glycerol, liquid polyethylene glycol, mixtures thereof, and in oils. Under normal storage and use conditions, these formulations contain preservatives to prevent microbial growth. In many cases, the form is sterile and fluid enough for easy injection. It must be stable under manufacturing and storage conditions and must be preserved from contamination by microorganisms (e.g., bacteria and fungi). The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyols (e.g., glycerol, propylene glycol, and liquid polyethylene glycol, etc.), suitable mixtures thereof, and / or vegetable oils. Appropriate fluidity can be maintained, for example, by using a coating such as lecithin, by maintaining the desired particle size in the case of dispersions, and by using surfactants. Preventive action against microorganisms can be achieved by a variety of antimicrobial and antifungal agents (e.g., parabens, chlorobutanol, phenol, sorbic acid, thimerosal, etc.). In many cases, isotonic agents, such as sugars or sodium chloride, are preferably included. Extended absorption of injectable compositions can be achieved by using agents that delay absorption (e.g., aluminum monostearate and gelatin) in the composition.

[0151] For administration of injectable aqueous solutions, the solution may be appropriately buffered if necessary, and the liquid diluent may first be isotonic with sufficient saline or glucose. These specific aqueous solutions are particularly suitable for intravenous, intramuscular, subcutaneous, and intraperitoneal administration. At this point, sterile aqueous media that can be used will be known to those skilled in the art.

[0152] Sterile injectable solutions are prepared by incorporating the desired amount of active recombinant AAV with several other components listed herein (as needed) into a suitable solvent, followed by filtration and sterilization. Typically, dispersions are prepared by incorporating several sterile active ingredients into a sterile carrier comprising a base dispersion medium and other desired components from those listed above. In the case of sterile powders used to prepare sterile injectable solutions, preferred methods of preparation include vacuum drying and freeze-drying techniques, which produce powders of the active ingredient and any other desired components from solutions that have been previously sterile filtered.

[0153] The recombinant AAV compositions disclosed herein can also be formulated into neutral or salt forms. Pharmaceutically acceptable salts include acid addition salts (forming with the free amino group of a protein) that are formed with inorganic acids (e.g., hydrochloric acid or phosphoric acid) or organic acids such as acetic acid, oxalic acid, tartaric acid, mandelic acid, etc. Salts that are formed with the free carboxyl group can also be derived from inorganic bases, such as sodium, potassium, ammonium, calcium, or iron hydroxides, and organic bases such as isopropylamine, trimethylamine, histidine, procaine, etc. After formulation, the solution is administered in a manner compatible with dosage forms and at a therapeutically effective amount. The formulation is readily administered in various dosage forms (e.g., injectable solutions, drug-release capsules, etc.).

[0154] The formulation for incorporating the pharmaceutically viable nucleic acid or recombinant AAV construct disclosed herein may preferably be, for example, a liposome.

[0155] Alternatively, nanocapsule formulations of recombinant AAV can be used. Nanocapsules typically capture substances in a stable and reproducible manner. To avoid side effects due to intracellular polymer overload, such ultrafine particles (approximately 0.1 μm in size) should be designed using polymers that are biodegradable in vivo. Biodegradable polyalkyl-cyanoacrylate nanoparticles that meet these requirements are anticipated.

[0156] V. Compositions, drugs or formulations, and kits

[0157] In a preferred embodiment, the recombinant AAV and pharmaceutical excipients described herein are present in the form of a composition. In a preferred embodiment, the composition is a pharmaceutical composition. In a preferred embodiment, the pharmaceutical composition comprises...

[0158] The compositions or pharmaceutical compositions may be assembled into pharmaceutical or diagnostic or research kits to facilitate their use in therapeutic, diagnostic, or research applications. The kit may contain one or more containers housing the components of the invention and instructions for use. Specifically, such a kit may contain one or more pharmaceutical agents described herein, along with instructions describing the intended use and appropriate applications of these agents. In some embodiments, the pharmaceutical agents in the kit may be pharmaceutical formulations and dosages suitable for a specific application and for methods of administration. Kits for research purposes may contain appropriate concentrations or amounts of components for conducting a variety of experiments.

[0159] In other aspects of the invention, a kit is provided comprising a container having any of the aforementioned recombinant AAV vector modified by the methods of the invention, or the recombinant AAV vector of the invention, or the pharmaceutical composition of the invention, and a container thereof. In some embodiments, the container of the kit is a syringe.

[0160] In some embodiments of the present invention, the use of the recombinant AAV, pharmaceutical composition, and / or kit of the present invention as described above is provided for the treatment or prevention of a disease. In some embodiments of the present invention, the use of the recombinant AAV, pharmaceutical composition, and / or kit of the present invention as described above is provided for methods of treating or preventing a disease. In some preferred embodiments, the disease is an ocular disease, such as retinopathy. In some more preferred embodiments, the disease is IRD. In some embodiments, the drug is prepared to be suitable for administration by systemic, intravenous, intramuscular, subcutaneous, oral, topical, local contact, intraperitoneal, or intralesional administration. In some preferred embodiments, the drug is prepared to be suitable for administration by eye drops, intraocular injection, subconjunctival injection, intra-anterior chamber injection, intravitreal injection, or subretinal injection.

[0161] VI. Pharmaceutical Uses

[0162] In other aspects of the invention, the use of the recombinant AAV, pharmaceutical compositions, and / or kits of the invention as described above is provided for the preparation of medicaments for treating diseases. In some preferred embodiments, the disease is an ocular disease, such as retinopathy. In some more preferred embodiments, the disease is IRD. In some embodiments, the medicament is prepared for administration by systemic, intravenous, intramuscular, subcutaneous, oral, topical, local contact, intraperitoneal, or intralesional administration. In some preferred embodiments, the medicament is prepared for administration by eye drops, intravitreal injection, subconjunctival injection, intra-anterior chamber injection, intravitreal injection, or subretinal injection.

[0163] The technical solution of the present invention will be clearly and completely described below with reference to the accompanying drawings and embodiments, but it is only intended to help those skilled in the art understand the present invention, and does not constitute any limitation on the implementation of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention. Although detailed annotations have been made, experimental methods with specific conditions not described in detail in the embodiments are performed according to conventional techniques known in the art, or according to the instructions provided by the reagent / reagent manufacturer.

[0164] VII. Exemplary Implementation Scheme

[0165] The present invention may include the following exemplary embodiments:

[0166] 1. An engineered adeno-associated virus (AAV) VP3 capsid protein, characterized in that the engineered VP3 capsid protein contains a methionine (Met) at position 203 of the amino acid sequence SEQ ID NO:1, and a glycine (Gly), leucine (Leu), or valine (Val) at position 211 of the amino acid sequence SEQ ID NO:1, the position being determined by sequence alignment with the amino acid sequence SEQ ID NO:1.

[0167] 2. The engineered VP3 capsid protein as described in embodiment 1, characterized in that, by sequence alignment with amino acid sequence SEQ ID NO:1, the first position of its amino acid sequence corresponds to the 203rd position of amino acid sequence SEQ ID NO:1, and / or the 9th position of its amino acid sequence corresponds to the 211th position of amino acid sequence SEQ ID NO:1.

[0168] 3. The engineered VP3 capsid protein as described in embodiment 1 or 2, which belongs to a serotype selected from the following: AAV2, AAV3, AAV4, AAV6, AAV7, AAV9, AAV12 and AAV40, preferably a serotype selected from AAV2, AAV6 and AAV9, for example, wild-type AAV2, wild-type AAV6 or wild-type AAV9.

[0169] 4. The engineered VP3 capsid protein as described in any one of embodiments 1-3, which belongs to the serotypes selected from the following: RC-C07, RC-C08, RC-C14, RC-C15 and RC-C18.

[0170] 5. The engineered VP3 capsid protein as described in any one of embodiments 1-4, characterized in that it comprises methionine (Met) at position 203 of the amino acid sequence SEQ ID NO:1, and is glycine (Gly), leucine (Leu), or valine (Val) at position 211 of the amino acid sequence SEQ ID NO:1, and belongs to the serotype selected from AAV2, RC-C08, and RC-C14.

[0171] 6. The engineered VP3 capsid protein as described in any one of embodiments 1-4, characterized in that it comprises methionine (Met) at position 203 of the amino acid sequence SEQ ID NO:1, and is glycine (Gly) or leucine (Leu) at position 211 of the amino acid sequence SEQ ID NO:1, and belongs to the serotype selected from AAV9 and RC-CO7.

[0172] 7. Engineered adeno-associated virus (AAV) VP3 capsid protein, which contains or is composed of the following amino acid sequence:

[0173] (i) The amino acid sequence shown in any one of SEQ ID NO:5-11;

[0174] (ii) An amino acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with any of the amino acid sequences shown in any of SEQ ID NO:5-11 and having the same amino acid sequences at positions 203 and 211, said positions being the positions corresponding to amino acid sequence SEQ ID NO:1.

[0175] 8. An isolated nucleic acid molecule comprising a gene sequence encoding the VP3 capsid protein of any one of embodiments 1-7, preferably, the gene being the AAV cap gene.

[0176] 9. The isolated nucleic acid molecule as described in embodiment 8, wherein the codon encoding the 211th amino acid corresponding to the amino acid sequence SEQ ID NO:1 in the cap gene is not ATG.

[0177] 10. The isolated nucleic acid molecule as described in embodiment 9, wherein the codon encoding the 211th amino acid corresponding to the amino acid sequence SEQ ID NO:1 in the cap gene is GTG, GTC, GTT, GTA, GGG, GGA, GGT, GGC, CTG, TTG, CTT, preferably GTG.

[0178] 11. The isolated nucleic acid molecule as described in embodiment 8, wherein the sequence of the cap gene is not ATG in a set of codons at positions 631-633 corresponding to the nucleic acid sequence SEQ ID NO:12.

[0179] 12. The isolated nucleic acid molecule as described in embodiment 11, wherein the sequence of the cap gene has a set of codon sequences at positions 631-633 corresponding to the nucleic acid sequence SEQ ID NO:12, which are GTG, GTC, GTT, GTA, GGG, GGA, GGT, GGC, CTG, TTG, CTT, preferably GTG.

[0180] 13. The nucleic acid molecule as described in any one of embodiments 8-12, wherein the cap gene belongs to a serotype selected from the following: AAV2, AAV3, AAV4, AAV6, AAV7, AAV9, AAV12 and AAV40, preferably, to a serotype selected from AAV2, AAV6 and AAV9, for example, wild-type AAV2, wild-type AAV6 or wild-type AAV9.

[0181] 14. The nucleic acid molecule as described in any one of embodiments 8-12, wherein the cap gene belongs to a serotype selected from the following: RC-C07, RC-C08, RC-C14, RC-C15 and RC-C18.

[0182] 15. The nucleic acid molecule according to any one of embodiments 8-14, wherein the codon sequence encoding the 211th amino acid corresponding to the amino acid sequence SEQ ID NO:1 and / or a set of codon sequences corresponding to positions 631-633 of the nucleic acid sequence SEQ ID NO:12 are GTG, GTC, GTT, GTA, GGG, GGA, GGT, GGC, CTG, TTG, CTT, preferably GTG, and the cap gene belongs to the serotypes selected from AAV2, RC-C08 and RC-C14.

[0183] 16. The nucleic acid molecule according to any one of embodiments 8-14, wherein the codon sequence encoding the 211th amino acid corresponding to the amino acid sequence SEQ ID NO:1 and / or a set of codon sequences corresponding to positions 631-633 of the nucleic acid sequence SEQ ID NO:12 is CTG, TTG, CTT, GGG, GGA, GGT, GGC, preferably CTG, and the cap gene belongs to the serotypes selected from AAV9 and RC-C07.

[0184] 17. The isolated nucleic acid molecule as described in embodiment 8, wherein the sequence of the cap gene is:

[0185] (i) A nucleotide sequence encoding an amino acid sequence as shown in any one of SEQ ID NO:5-11;

[0186] (ii) Nucleotide sequences complementary to the nucleotide sequences in (i);

[0187] (iii) A nucleotide sequence that encodes the same VP1 / VP2 / VP3 protein as (i) or (ii), but is different from the nucleotide sequence of (i) or (ii) due to the degeneracy of the genetic code;

[0188] (iv) and any one of (i) to (iii) have at least 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or higher identity of the nucleotide sequence, and the set of codon sequences corresponding to positions 631-633 of the nucleic acid sequence SEQ ID NO:12 is GTG, GTC, GTT, GTA, GGG, GGA, GGT, GGC, CTG, TTG, CTT, preferably GTG.

[0189] 18. An engineered adeno-associated virus (AAV) VP1 capsid protein, characterized in that its amino acid sequence comprises, at its C-terminus, the amino acid sequence of the VP3 capsid protein of any one of embodiments 1-7.

[0190] 19. An engineered adeno-associated virus (AAV) VP2 capsid protein, characterized in that its amino acid sequence comprises, at its C-terminus, the amino acid sequence of the VP3 capsid protein of any one of embodiments 1-7.

[0191] 20. The isolated nucleic acid molecule as described in embodiments 8-17, wherein the cap gene further encodes the VP1 capsid protein of embodiment 18 and / or the VP2 capsid protein of embodiment 19.

[0192] 21. A vector, such as a plasmid, preferably a packaged plasmid, comprising a nucleic acid molecule as described in any one of embodiments 8-17 and 20.

[0193] 22. A host cell, for example, a packaging cell, comprising a nucleic acid molecule as described in any one of embodiments 8-17 and 20 and / or a vector as described in embodiment 21.

[0194] 23. A recombinant adeno-associated virus vector particle or population thereof, comprising the engineered VP3 capsid protein as described in any one of embodiments 1-7, and / or the VP1 capsid protein as described in embodiment 18, and / or the VP2 capsid protein as described in embodiment 19.

[0195] 24. A recombinant adeno-associated virus vector particle or population thereof, which does not contain or substantially does not contain a truncated form of VP3m of the VP3 capsid protein, wherein the first amino acid residue of the VP3m corresponds to methionine (Met) at position 211 of the amino acid sequence SEQ ID NO:1, for example, in the recombinant adeno-associated virus vector particle or population thereof, the percentage (in molar amount) of the truncated form of VP3m of the total VP3 protein is less than or equal to 5%, preferably less than 5%, preferably less than 4%, preferably less than 3%, preferably less than 2%, preferably less than 1.5%, preferably less than 1%, preferably less than 0.9%, preferably less than 0.8%, preferably less than 0.7%, preferably less than 0.6%, preferably less than 0.5%, preferably less than 0.4%, preferably less than 0.3%, preferably less than 0.2%, preferably less than 0.1%.

[0196] 25. The recombinant adeno-associated virus vector particles or populations thereof as described in embodiments 23 or 24, wherein the serotypes are AAV2, AAV3, AAV4, AAV6, AAV7, AAV9, AAV12 and / or AAV40, preferably AAV2, AAV6 and / or AAV9.

[0197] 26. The recombinant adeno-associated virus vector particles or populations thereof as described in embodiments 23 or 24, wherein the serotypes are RC-C07, RC-C08, RC-C14, RC-C15 and / or RC-C18.

[0198] 27. The recombinant adeno-associated virus vector particle or population thereof as described in any one of embodiments 23-26, wherein the genome contains a transgenic sequence, preferably further containing a 5'-ITR sequence and / or a 3'-ITR sequence, more preferably the 5'-ITR sequence and / or the 3'-ITR sequence belongs to the same AAV serotype as the VP3 protein.

[0199] 28. The recombinant adeno-associated virus vector particle or population thereof as described in any one of embodiments 27, wherein the genome comprises an expression cassette containing the transgenic sequence and optional expression regulatory sequences.

[0200] 29. The recombinant adeno-associated virus vector particle as described in embodiment 27 or 28, wherein the transgene is an ophthalmology-related gene, such as RPE65, AIPL1, PROM1, or RS1.

[0201] 30. A method for engineering the VP3 capsid protein of an adeno-associated virus to reduce its expression as a truncated VP3m form, the method comprising mutating the gene encoding the VP3 capsid protein such that the protein it encodes does not contain methionine (Met) at position 211 corresponding to the amino acid sequence SEQ ID NO:1, preferably containing valine (Val), glycine (Gly), or leucine (Leu) at position 211 corresponding to the amino acid sequence SEQ ID NO:1.

[0202] 31. The method of embodiment 30, wherein the encoding gene is the AAV cap gene.

[0203] 32. A method for engineering the VP3 capsid protein of an adeno-associated virus to reduce viral particles containing a truncated form of the VP3 capsid protein, VP3m, in an adeno-associated virus population, said method comprising mutating the cap gene of the virus such that the codon encoding the amino acid at position 211 of the amino acid sequence SEQ ID NO:1 is not a methionine (Met) codon, and preferably the codon encoding the amino acid at position 211 of the amino acid sequence SEQ ID NO:1 is a valine (Val) codon, a glycine (Gly) codon, or a leucine (Leu) codon.

[0204] 33. The method as described in embodiment 31 or 32, wherein the method comprises mutating the cap gene such that a set of codons at positions 631-633 corresponding to the nucleic acid sequence SEQ ID NO:12 is not ATG.

[0205] 34. The method of embodiment 33, wherein the method comprises mutating the cap gene such that a set of codon sequences corresponding to positions 631-633 of the nucleic acid sequence SEQ ID NO:12 is GTG, GTC, GTT, GTA, GGG, GGA, GGT, GGC, CTG, TTG, CTT, preferably GTG.

[0206] 35. The method according to any one of embodiments 31-34, wherein the set of codons at positions 631-633 of the cap gene corresponding to the nucleic acid sequence SEQ ID NO:12 is replaced by ATG with GTG, GTC, GTT, GTA, GGG, GGA, GGT, GGC, CTG, TTG, CTT, preferably GTG.

[0207] Preferably, the cap gene belongs to serotypes selected from AAV2 and RC-C14.

[0208] 36. The method according to any one of embodiments 31-34, wherein a set of codon sequences corresponding to positions 631-633 of the cap gene in the nucleic acid sequence SEQ ID NO:12 is replaced with CTG, TTG, CTT, GGG, GGA, GGT, GGC, preferably CTG.

[0209] Preferably, the cap gene belongs to serotypes selected from AAV9 and RC-C07.

[0210] 37. The engineered adeno-associated virus VP3 capsid protein that can be prepared or obtained by the method of any one of embodiments 30-31 and 33-36.

[0211] 38. Adeno-associated virus or a population thereof that can be prepared or prepared by any one of the methods described in embodiments 32-36.

[0212] 39. A method for producing recombinant AAV viral vector particles, the method comprising culturing packaging cells under conditions sufficient to produce recombinant AAV viral particles, wherein the packaging cells comprise a nucleic acid molecule as described in any one of embodiments 8-17 and 20 and / or a vector as described in embodiment 21.

[0213] 40. The method of embodiment 39, further comprising the step of transducing a nucleic acid molecule as described in any one of embodiments 8-17 and 20 and / or a vector as described in embodiment 21 into packaging cells.

[0214] 41. The method of embodiment 39 or 40, further comprising the step of recovering the resulting recombinant AAV viral vector particles from the packaging cells and / or their culture system.

[0215] 42. A pharmaceutical composition comprising recombinant AAV viral vector particles according to any one of embodiments 23-29 and 38, optionally further comprising pharmaceutical excipients, such as pharmaceutical carriers and pharmaceutical excipients known in the art, including buffers.

[0216] 43. A combination product comprising recombinant AAV viral vector particles as described in any one of embodiments 23-29 and 38, and one or more other therapeutic agents.

[0217] 44. Use of the recombinant AAV viral vector particles of any one of embodiments 23-29 and 38, or the pharmaceutical composition of embodiment 42, or the combination product of embodiment 43, in the preparation of a medicament, preferably, the medicament being used to treat an eye disease.

[0218] 45. The use as described in embodiment 44, wherein the drug is administered via intraocular administration, such as intraretinal administration or intravitreal administration, such as subretinal administration or intravitreal administration, such as subretinal injection or intravitreal injection.

[0219] The present invention is illustrated by the following examples, but is not intended to limit the scope of the invention in any way. The present invention has been described in detail herein, and specific embodiments thereof have also been disclosed. Various changes and modifications to the specific embodiments of the present invention will be apparent to those skilled in the art without departing from the spirit of the invention, and are covered within the scope of protection of the present invention.

[0220] Example

[0221] The embodiments of this application are generally based on the following experimental methods and principles: site-directed mutagenesis of the cap gene in wild-type AAV2 and its variants RC-C08 / RC-C14 and AAV9 variant RC-C07V5 by polymerase chain reaction (PCR) and GIBSON recombination.

[0222] The purpose of this method is to generate AAV capsids with reduced VP3m (VP3 truncated form) content.

[0223] Procedure: Using the AAV2 RC-C00 / RC-C08 / RC-C14 / RC-C07V5 cap gene as a template, two fragments containing the site-directed mutation cap and a downstream poly sequence were amplified by PCR. The two fragments were then recombined into a vector using the Gibson ligation method. The resulting recombinant virus was packaged, and after detecting and determining the viral titer, it was used for viral quality assessment and functional validation as described in this paper.

[0224] Main detection methods:

[0225] 1. The VP3m content of the modified viral vector constructed in this paper was detected by capillary gel electrophoresis (CE-SDS), confirming that the VP3m content was significantly reduced.

[0226] 3. Cells were pre-seeded in well plates, and the modified viral vector constructed in this paper was added to each well. After 72 hours, the proportion of mScarlet-positive cells of candidate serotypes was detected by FACS.

[0227] 2. The improved viral vector constructed in this paper was subjected to temperature treatment and freeze-thaw treatment at different time periods. After treatment, it was used to infect pre-coated 293T cells. The degree of loss of viral infectivity after treatment was determined by detecting the proportion of mScarlet positive cells.

[0228] Example 1. Preparation of capsid-modified viruses RC-C00V8, RC-C00V27, RC-C00V29, RC-C14V12, RC-C14V13, RC-C08V19, and RC-C07V22

[0229] This embodiment describes the construction of plasmids containing VP3 variants of the AAV2 series RC-C00V8, RC-C00V27, RC-C00V29, RC-C14 series RC-C14V12, RC-C14V13, RC-C08 VP3 variant RC-C08V19, RC-C07V5 VP3 variant RC-C07V22, and packaged a series of AAV viruses with mScarlet transgenes, including RC-C00V8, RC-C00V27, RC-C00V29, RC-C14V12, RC-C14V13, RC-C08V19, RC-C07V22, AAV2, RC-C08, RC-C14, and RC-C07V5, for subsequent in vitro cell and mouse in vivo transduction experiments.

[0230] For plasmid construction and expression of each capsid protein, see [link to relevant documentation]. Figure 1 As shown.

[0231] (1) Construction of RC-C00V8 plasmid

[0232] The AAV2 plasmid was double-digested with BsiWI and HindIII to generate 5910bp and 1372bp fragments. The 5910bp fragment was recovered and used as a vector. Two fragments containing the RC-C00V8 site-directed mutation cap and the downstream poly sequence were replaced by homologous recombination. This fragment was amplified by polymerase chain reaction (PCR). Using the AAV2 plasmid as a template, PCR yielded two amplification products: (a) upstream of the mutation region, the 5' amplification primer was C00V8-F1: CAGCCATCGACGTCAGACGCGG (SEQ ID NO: 13), and the 3' amplification primer was C00V8-R1: GGCGCCCTCGTTATTGTCTGCCACTGGTGCGCCACTGCCTGTA (SEQ ID NO: 14); (b) downstream of the mutation region, the 5' amplification primer was C00V8-F2: TACAGGCAGTGGCGCACCAGTGGCAGACAATAACGAGGGCGCC (SEQ ID NO: 14). NO:15), the 3' end amplification primer is C00V8-R2: TTGATGCGCCGAGCCGAGGA (SEQ ID NO:16), the above two amplification products were obtained by overlap PCR to obtain a BsiWI / HindIII fragment containing the RC-C00V8 site-directed mutation cap and the downstream poly sequence.

[0233] (2) Construction of RC-C00V15 plasmid

[0234] The wild-type AAV2 plasmid was double-digested with HindIII and SmaI to generate 4626bp and 2656bp fragments. The 4626bp fragment was recovered and used as a vector. Two fragments containing the RC-C00V15 site-directed mutation cap and the downstream poly sequence were replaced by homologous recombination. This fragment was amplified by polymerase chain reaction (PCR). Using the wild-type AAV2 plasmid as a PCR template, two amplification products were obtained: (a) upstream of the mutation region, the 5' amplification primer was LRC01V1-F1: GACGTCAGACGCGGAAGCTTCGATCAAC (SEQ ID NO: 17); the 3' amplification primer was C00V15-R1: CTGTAGCCAcCGTATTAGTTCCCAGACCAG (SEQ ID NO: 18); (b) downstream of the mutation region, the 5' amplification primer was C00V15-F2: CTAATACGgTGGCTACAGGCAGTGGCGC (SEQ ID NO: 18). NO:19); the 3' end amplification primers are LRC01V1-R2: CGCTGTTTAAACGCCCGGGCTGTAG (SEQ ID NO:20); the above two amplification products were subjected to overlap PCR to obtain a SmaI / HindIII fragment containing the RC-C00V15 site-directed mutation cap and a downstream poly sequence.

[0235] (3) Construction of RC-C00V27 plasmid

[0236] The wild-type AAV2 plasmid was double-digested with HindIII and SmaI to generate 4626bp and 2656bp fragments. The 4626bp fragment was recovered and used as a vector. Two fragments containing the RC-C00V27 site-directed mutation cap and the downstream poly sequence were replaced by homologous recombination. This fragment was amplified by polymerase chain reaction (PCR). Using the wild-type AAV2 plasmid as a PCR template, two amplification products were obtained: (a) upstream of the mutation region, the 5' amplification primer was RC07V34-F1: TCGACGTCAGACGCGGAAGCTTCGATCAAC (SEQ ID NO:21); the 3' amplification primer was C00V27-R1: TTGTCTGCcagTGGTGCGCCACTGCCTGTAG (SEQ ID NO:22); (b) downstream of the mutation region, the 5' amplification primer was C00V27-F2: GCACCActgGCAGACAATAACGAGGGCG (SEQ ID NO:22). NO:23); the 3' end amplification primer is RC07V34-R2: CGCTGTTTAAACGCCCGGGCTGTAG (SEQ ID NO:24); the above two amplification products were subjected to overlap PCR to obtain a cap containing the RC-C00V27 site-directed mutation and a downstream poly sequence of SmaI / HindIII fragment.

[0237] (4) Construction of RC-C00V29 plasmid

[0238] The wild-type AAV2 plasmid was double-digested with HindIII and SmaI to generate 4626bp and 2656bp fragments. The 4626bp fragment was recovered and used as a vector. Two fragments containing the RC-C00V27 site-directed mutation cap and the downstream poly sequence were replaced by homologous recombination. This fragment was amplified by polymerase chain reaction (PCR). Using the wild-type AAV2 plasmid as a PCR template, two amplification products were obtained: (a) upstream of the mutation region, the 5' amplification primer was RC07V34-F1: TCGACGTCAGACGCGGAAGCTTCGATCAAC (SEQ ID NO:25); the 3' amplification primer was C00V29-R1: TTGTCTGCcccTGGTGCGCCACTGCCTGTAG (SEQ ID NO:26); (b) downstream of the mutation region, the 5' amplification primer was C00V29-F2: GCACCAgggGCAGACAATAACGAGGGCG (SEQ ID NO:26). NO:27); the 3' end amplification primer is RC07V34-R2: CGCTGTTTAAACGCCCGGGCTGTAG (SEQ ID NO:28); the above two amplification products were subjected to overlap PCR to obtain a cap containing the RC-C00V29 site-directed mutation and a downstream poly sequence of SmaI / HindIII fragment.

[0239] (5) Construction of RC-C14V12 plasmid

[0240] The RC-C08 plasmid in patent number CN116970648A was double-digested with HindIII and SmaI to generate 4626bp and 2656bp fragments. The 4626bp fragment was recovered and used as a vector. Two fragments containing the RC-C14V12 site-directed mutation cap and downstream poly sequence were replaced by homologous recombination. This fragment was amplified by polymerase chain reaction (PCR). Using the RC-C08 plasmid in patent number CN116970648A as the PCR template, amplification product a and RC-C14 plasmid in patent number CN117247434B as the PCR template, two amplification products were obtained. Upstream of the mutation region, the 5' amplification primer was LRCV30-F1: TCGACGTCAGACGCGGAAGCTTCGATCAAC (SEQ ID NO: 29); the 3' amplification primer was C08V19-R1: tgtctgccaCtggtgcgccactgcctgtag (SEQ ID NO: 29). (b) Downstream of the mutation region, the 5' amplification primer is C08V19-F2: cgcaccaGtggcagacaataacgaggg (SEQ ID NO:31); the 3' amplification primer is LRCV30-R2: CGCTGTTTAAACGCCCGGGCTGTAG (SEQ ID NO:32); the above two amplification products are overlapped to obtain a cap containing the RC-C14V12 site-directed mutation and a downstream poly sequence of SmaI / HindIII fragment.

[0241] (6) Construction of RC-C14V13 plasmid

[0242] The AAV2 wild-type plasmid was double-digested with HindIII and SmaI to generate 4626bp and 2656bp fragments. The 4626bp fragment was recovered and used as a vector. Two fragments containing the RC-C14V13 site-directed mutation cap and the downstream poly sequence were replaced by homologous recombination. This fragment was amplified by polymerase chain reaction (PCR). Using RC-C14 (patent number CN117247434B) as the PCR template, two amplification products were obtained. (a) Upstream of the mutation region, the 5' amplification primer was RC07V34-F1: TCGACGTCAGACGCGGAAGCTTCGATCAAC (SEQ ID NO:33); the 3' amplification primer was C00V27-R1: TTGTCTGCcagTGGTGCGCCACTGCCTGTAG (SEQ ID NO:33). (b) Downstream of the mutation region, the 5' amplification primer is C00V27-F2: GCACCActgGCAGACAATAACGAGGGCG (SEQ ID NO:35); the 3' amplification primer is RC07V34-R2: CGCTGTTTAAACGCCCGGGCTGTAG (SEQ ID NO:36); the above two amplification products were subjected to overlap PCR to obtain a cap containing the RC-C00V29 site-directed mutation and a downstream poly sequence of SmaI / HindIII fragment.

[0243] (7) Construction of RC-C08V19 plasmid:

[0244] The RC-C08 plasmid of patent number CN116970648A was double-digested with HindIII and SmaI to generate 4626bp and 2656bp fragments. The 4626bp fragment was recovered and used as a vector. Two fragments containing the RC-C08V19 site-directed mutation cap and downstream poly sequence were replaced by homologous recombination. This fragment was amplified by polymerase chain reaction (PCR). Using the RC-C08 plasmid of patent number CN116970648A as a PCR template, two amplification products were obtained. (a) Upstream of the mutation region, the 5' amplification primer was LRCV30-F1: TCGACGTCAGACGCGGAAGCTTCGATCAAC (SEQ ID NO:37); the 3' amplification primer was C08V19-R1: tgtctgccaCtggtgcgccactgcctgtag (SEQ ID NO:37). (b) Downstream of the mutation region, the 5' amplification primer is C08V19-F2: cgcaccaGtggcagacaataacgaggg (SEQ ID NO:39); the 3' amplification primer is LRCV30-R2: CGCTGTTTAAACGCCCGGGCTGTAG (SEQ ID NO:40); the above two amplification products are overlapped to obtain a cap containing the RC-C08V19 site-directed mutation and a downstream poly sequence of SmaI / HindIII fragment.

[0245] (8) Construction of RC-C07V22 plasmid:

[0246] The RC-C07V5 plasmid of patent number CN118420721A was double-digested with HindIII and SmaI to generate 4626bp and 2689bp fragments. The 4626bp fragment was recovered and used as a vector. Two fragments containing the RC-C007V22 site-directed mutation cap and downstream poly sequence were replaced by homologous recombination. This fragment was amplified by polymerase chain reaction (PCR). Using the RC-C07V5 plasmid of patent number CN118420721A as a PCR template, two amplification products were obtained. (a) Upstream of the mutation region, the 5' amplification primer was LRCV37-F1: TCGACGTCAGACGCGGAAGCTTCGATCAAC (SEQ ID NO: 41); the 3' amplification primer was C07V22-R1: tgtctgccaGtggtgcgccaccacctgaag (SEQ ID NO: 41). (b) Downstream of the mutation region, the 5' amplification primer is C07V21-F2: gcaccaCtggcagacaataacgaaggtg (SEQ ID NO:43); the 3' amplification primer is LRCV37-R2: CGCTGTTTAAACGCCCGGGCTGTAG (SEQ ID NO:44); the above two amplification products are overlapped to obtain a cap containing the RC-C07V22 site-directed mutation and a downstream poly sequence of SmaI / HindIII fragment.

[0247] (9) Packaging and purification of AAV

[0248] 293T adherent cell viral packaging: 24 hours before the experiment, 293T cells were seeded in a 15cm dish. Transfection was performed the next day when the cell density reached 80%. The transfection complex was prepared as a PEIpro:DNA mixture of 1.5μL:1μL. Solution A: LX-GOI-E10 (mScarlet reporter genome plasmid), RC-C00V8 / RC-C14V12 / RC-C08V19 / RC-C07V22 (Rep-Cap plasmid), and pHelper (helper packaging plasmid) were dissolved in 500μL of serum-free DMEM medium (one 15cm dish) at a molar ratio of 1:1:1. Solution B: PEIpro needs to be vortexed before use. 45μL of PEI was dissolved in 500μL of serum-free DMEM medium (one 15cm dish). Solution B was added to solution A, vortexed, and incubated at room temperature for 15 min. Add 1 ml of transfection complex to each 15 cm culture dish. After 24 h, replace with low-glucose DMEM containing 2% serum and penicillin antibodies. After 96 h, collect cells by centrifugation at 1500 rpm for 10 min, resuspend in 10 ml PBS, freeze and thaw three times with liquid nitrogen, add tocopheryl enzyme (200 U / μL, working concentration 50 U / ml), incubate at 37 °C for 2 h, centrifuge at 4000 rpm for 15 min to collect the supernatant, perform ultracentrifugation with iodixanol, take the 40% iodixanol layer, replace with PBS using a 50 ml Millipore 100 KD ultrafiltration tube, and store the virus at -80 °C.

[0249] Virus Packaging of 293F Suspension Cells: 293F cells were diluted to 1E+6 / ml using 300ml of suspension medium (Jensen, CD293 01) and cultured at 37℃, 120rpm, 5% CO2 for 24h until the cell density reached 2E+6 / ml. Three plasmids were added to 15ml of antibiotic-free and serum-free Gensensen medium. The mass ratio of the three plasmids used for packaging was 3:1:2: LX-GOI-E10 (mScarlet reporter genome plasmid), RC-C00V8 / RC-C14V12 / RC-C08V19 / RC-C07V22 (Rep-Cap plasmid), and pHelper (helper packaging plasmid). 600μL of Fecto VIR-AAV was added to the plasmid mixture, vortexed for 10s, and incubated at room temperature for 30min. The transfection mixture was then added dropwise to the suspension cells and cultured at 37℃, 120rpm, 5% CO2. 24 hours after packaging, Feed A (Jian Shun) was added at 3% of the total volume and Feed B (Jian Shun) was added at 0.3% of the total volume. After 72 hours, the cells were collected by centrifugation at 1500 rpm for 10 min with a horizontal rotor, resuspended in 100 ml PBS, and 11 ml 10*Lysis buffer and 100 U / μL totipotent enzyme (working concentration 50 U / ml) were added. The mixture was centrifuged at 37℃ for 2 hours, centrifuged at 4000 rpm for 15 min with a horizontal rotor, and the supernatant was collected. The virus was obtained by affinity and anion exchange purification and stored at -80℃.

[0250] (10) Determination of AAV virus genome titer

[0251] Compared to traditional detection methods, digital droplet polymerase chain reaction (ddPCR) for viral genome measurement offers higher accuracy and reduces measurement errors. Therefore, this experiment employed real-time quantitative polymerase chain reaction (qPCR) and ddPCR to determine viral genome titers. For qPCR detection of viral genome titers, the virus required pretreatment: 5 μL of purified virus was added to a final volume of 44.5 μL; 0.5 μL of proteinase K (working concentration 100 μg / ml) was added; the solution was incubated at 55°C for 10 min and then at 95°C for 20 min, recorded as E-1 (10-fold dilution); qPCR was then performed on viruses at 100-fold and 500-fold dilutions. When performing ddPCR to measure viral genome titer, the virus needs to be diluted according to the viral genome titer obtained from qPCR. A suitable dilution gradient of virus is prepared using a ddPCR supermix (BIO-RAD, #12001925). The mixture and oil are placed in a droplet generation plate, and droplet generation is initiated in a QX200 Droplet Generator. The droplets are then transferred to ddPCR Plates 96-Well and sealed using a preheated PX1 heat sealer. The program is: 180℃, 10s. Polymerase chain reaction (PCR) amplification is then performed using a QX200. TM The Droplet Reader reads the fluorescence signals of the generated droplets.

[0252] Example 2. Effects of in vitro activity of AAV2 VP3m modifier and VP3m content on AAV2 virus cell transduction activity.

[0253] Thin-tube gel electrophoresis (CE-SDS) utilizes the molecular sieving effect of polyacrylamide gels and uses SDS (sodium dodecyl sulfate) to eliminate differences in spatial structure and charge between different proteins. Under an electric field, proteins are separated according to their molecular weight, thereby achieving the purpose of detecting sample purity. It has higher sensitivity and resolution and can evaluate the VP components of AAV carriers.

[0254] This embodiment tested the VP1 / 2 / 3 content and purity of viral vectors RC-C00V27, RC-C00V29, RC-C00V8, AAV2, and RC-C00V8 / V15 M3:1, RC-C00V8 / V15 M1:1, and RC-C00V8 / V15 M1:3 (RC-C00V8 with RC-C00V15 added (no wild-type full-length VP3, only VP3m), in three different labeled ratios). 293T cells are an important cell type; cell lines derived from 293 cells through gene technology are widely used in experiments such as virus packaging, cell transfection, and transduction. SY5Y cells (human neuroblastoma cells) are a subline of the SK-N-SH cell line after three clonings. The parent SK-N-SH cell line originated in 1970 from a neuroblastoma metastasis in a 4-year-old female patient. SY5Y cells can be used for research in 3D cell culture, immunology, and neuroscience. The ARPE-19 (human retinal epithelial cell) cell line is derived from healthy human retinal pigment epithelium (RPE) cells. This cell line expresses retinal pigment cell-specific molecular markers such as intracellular retinaldehyde-binding protein and RPE-65, which can better mimic the effect of AAV infection of the human retina. During IVT (intravitreal injection), after crossing the internal limiting membrane, the AAV virus must traverse multiple cell layers, first the RGC layer, and then reach the inner retinal layer, nuclear layer, outer retinal layer, and outer nuclear layer. Because RGC-5 is a bridging neuron connecting retinal input to the visual processing center in the central nervous system, it is often used as an important model in retinal disease research. This article uses 293T, SY5Y, ARPE19, and RGC-5 cells to detect the in vitro activity of the virus.

[0255] Specific steps: (1) Capillary gel electrophoresis (CE-SDS): Take 100 μL of the virus to be tested, add 10 μL of 3% SDS and 10 μL of β-ME, vortex to mix, and heat at 90℃ for 10 min for lysis and denaturation. After the sample cools, take it out and add it to a 10 kD centrifugal filter, make up to 500 μL with ultrapure water, centrifuge at 14000 rpm / min for 10 min, concentrate by ultrafiltration twice and collect the filtrate. Add 5 μL of 3% SDS and 0.2 μL of 10 kD internal standard to the collected liquid, vortex to mix thoroughly and centrifuge briefly, and add to the sample vial for sample loading. Blank solution preparation: Take the corresponding preparation buffer of the test sample as a blank control, and perform other operations as above. Column temperature 25℃, run for 40 min.

[0256] (2) Cell infection: 293T cells, SY5Y cells, and ARPE-19 cells were seeded in 96-well plates at a density of 1E4 cells / well, and RGC-5 cells were seeded in 48-well plates at a density of 2E4 cells / well. Infection was performed the next day when cell confluence reached 20-30%. Before infection, the high-glucose DMEM medium containing 10% FBS was replaced with serum-free high-glucose DMEM medium. 72 hours after infection, the cells were digested, the medium was discarded, and 100 μL of PBS was added to the cells. The PBS was discarded, and 25 μL of 0.25% trypsin was added. Digestion was carried out at room temperature for 1 min, and then 100 μL of DMEM containing 10% FBS was added to terminate the digestion. The autofluorescence of mScarlet cells was detected using flow cytometry.

[0257] The results are as follows Figure 2 As shown in Figure a, compared to AAV2, the VP3m content (VP3 truncated form) of RC-C00V8, RC-C00V27, and RC-C00V29 was significantly reduced, with RC-C00V27 having a VP3m content of 2.37%. RC-C00V29 (VP3m = 0%) and RC-C00V8 (VP3m = 1.4%) showed no VP3m content after modification (VP3m content fluctuated between 0% and 1.5% due to limitations in equipment detection sensitivity). The VP3 ratio was improved in all cases (normalized to VP1); with the addition of RC-C00V15, the VP3m content also increased significantly, and the VP3 ratio decreased accordingly, as expected. Figure 2 As shown in b, the transduction efficiencies of the VP3m modified variants RC-C00V27, RC-C00V29, and RC-C00V8 at 293T with an MOI of 200 were significantly higher than those of AAV2. At a higher MOI of 1000, the transduction efficiencies were higher than those of AAV2, but the difference was not significant. Figure 2 As shown in c, compared with AAV2, RC-C00V8 showed improved transduction efficiency in SY5Y cells, demonstrating a difference.

[0258] The effect of VP3m content on AAV2 virus transduction activity was verified in ARPE19 and RGC-5 cells. Figure 2 As shown in d and 2e, the in vitro transduction activity trends in ARPE19 and RGC-5 cells were consistent. Compared with AAV2, the infectivity of RC-C00V8 was increased, but the difference was not significant. With the increase of RC-C00V15, the infectivity of RC-C00V8 / V15 M3:1, RC-C00V8 / V15 M1:1, and RC-C00V8 / V15 M1:3 decreased sequentially, indicating that the increase of VP3m content in AAV virus affects the infectivity of the virus to at least some extent.

[0259] Example 3. Characterization study of RC-C00V8 virus

[0260] Affinity chromatography is a commonly used method for purifying AAV viruses based on biomolecular interactions. It achieves efficient purification by specifically binding to AAV, and the A260 / 280 ratio after affinity chromatography can indirectly reflect the viral solidity rate. As shown in Figure a, the A260 / 280 of RC-C00V8 is improved compared to AAV2. During virus manufacturing and purification, impurities are formed, including molecular variants with different activities, efficacy, and safety profiles than the desired product. These include viruses or particles with packaging defects such as empty shells, and aggregates. Viruses or particles with packaging defects such as empty shells can competitively inhibit vector transduction and induce particle aggregation. The solidity and empty shell rates of the virus can be detected by the genome copy number / virus particle number (VG / VP). The presence of aggregates may reduce the viral infectious titer, thereby reducing the efficacy of the product. Aggregates can be detected by size exclusion chromatography (SEC-HPLC).

[0261] The specific steps are as follows:

[0262] (1) In this study, the AAV2 Xpress ELISA kit (PROGEN, A23007) was used to detect VP of AAV2 and RC-C00V8. The ratio of the number of viral particles (VP) determined by enzyme-linked immunosorbent assay (ELISA) to the number of genome copies determined by digital droplet polymerase chain reaction (ddPCR) was analyzed.

[0263] (2) Size exclusion chromatography (SEC-HPLC): The mobile phase used was 10 mM NaH2PO4, 10 mM Na2HPO4, 350 mM KCl, pH 6.6, the flow rate was 0.3 ml / min, the injection volume was 10 μL, and the absorption peaks (260 nm and 280 nm) and fluorescence (excitation at 280 nm and emission at 348 nm) were detected.

[0264] (3) Infectivity titer (IU): On Day 1, 293T cells were seeded in 96-well plates at a density of 1E4 cells / well. On Day 2, when the cell confluence was approximately 50%, the AAV virus was serially diluted using complete culture medium. The dilution factors were as follows:

[0265] 1×10 -2 = 990 μL solvent + 10 μL stock solution

[0266] 1×10 -3 = 900 μL solvent + 100 μL previous solution

[0267] 1×10 -4 = 900 μL solvent + 100 μL previous solution

[0268] 1×10 -5 = 900 μL solvent + 100 μL previous solution

[0269] 1×10 -6 = 900 μL solvent + 100 μL previous solution

[0270] 1×10 -7 = 900 μL solvent + 100 μL previous solution

[0271] After aspirating the complete culture medium, add 100 μL of culture medium diluted with the virus (8 wells per dilution): incubate at 37°C in a 5% CO2 cell culture incubator for 72 hours. Observe the autofluorescence of mScarlet using a microscope.

[0272] The results are as follows Figure 3 As shown in Figure d, the polymer content of RC-C00V8 decreased by 0.94 times compared to AAV2. Infectivity titer (IU) represents the total number of infectious viral particles in the product; for AAV viruses, infectious titer is a key parameter for assessing vector quality. The results, as shown in Figure d, indicate that the infectious titer of RC-C00V8 was significantly increased by 2.5 times compared to AAV2.

[0273] Example 4. Stability Study of RC-C00V8

[0274] The stability of the viral capsid directly affects its feasibility for storage and transportation, as well as its persistence in therapeutic applications. This article evaluated the stability of the RC-C00V8 capsid by simulating storage at 42°C for different times (D0, D1, D2) and repeated freeze-thaw cycles (F0, F10), and then infecting 293T cells.

[0275] Specific steps: (2) Stability experiment: Dilute RC-C00V8 and AAV2 viruses to 1E12 vg / mL and aliquot them. Place the viruses in a 42℃ metal bath for D2, D1, and D0 respectively, and then remove the viruses to infect 293T cells. Repeat the freeze-thaw cycle 0 times and 10 times respectively (freezing at -80℃ and complete thawing at room temperature is counted as one freeze-thaw cycle). 293T cells are seeded into 96-well plates at a density of 1E4 cells / well. On the second day, when the cell confluence is 20-30%, RC-C00V8 and AAV2 viruses are used to infect 293T cells with MOI=1000. Before infection, replace the high-glucose DMEM medium containing 10% FBS with serum-free high-glucose DMEM medium. 72 h after infection, the cells were digested, the culture medium was discarded, 100 μL of PBS was added to the cells, the PBS was discarded, 25 μL of 0.25% trypsin was added, and the cells were digested at room temperature for 1 min. The digestion was terminated by adding 100 μL of DMEM containing 10% FBS. The autofluorescence of mScarlet in the cells was detected by flow cytometry.

[0276] The results are as follows Figure 4 As shown, the percentage decrease in mScarlet-positive cells for RC-C00V8 was not different from that of AAV2 within the temperature range D0-D1. The rapid decline in infection efficiency for both occurred between D1 and D2, with RC-C00V8 showing a 58% decrease in mScarlet-positive cells and AAV2 a 65.3% decrease. This indicates that the decrease in infectivity for RC-C00V8 was slower than that for the control group AAV2, demonstrating a significant difference. After ten repeated freeze-thaw cycles, the percentage decrease in mScarlet-positive cells was lower in both cases compared to the unfrozen cycle. However, the average decrease in infectivity for AAV2 was 3.8%, while the average decrease for RC-C00V8 was 0%, indicating that RC-C00V8 was more resistant to the effects of repeated freeze-thaw cycles on viral activity than AAV2. In summary, the stability of RC-C00V8 is superior to AAV2, maintaining good stability, which provides more possibilities for its storage and transportation under different conditions.

[0277] Example 5. In vitro activity study of RC-C14 VP3m modified organism

[0278] Thin-tube gel electrophoresis (CE-SDS) utilizes the molecular sieving effect of polyacrylamide gels and SDS (sodium dodecyl sulfate) to eliminate differences in spatial structure and charge between different proteins. Under an electric field, proteins are separated according to their molecular weight, thereby achieving the purpose of detecting sample purity. It has higher sensitivity and resolution and can evaluate the VP components of AAV vectors. This article detected the VP1 / 2 / 3 content and purity of viral vectors RC-C14V12, RC-C14V13, and RC-C14. 293T cells are an important cell type. Cell lines derived from 293 cells through gene technology are widely used in experiments such as virus packaging, cell transfection, and transduction.

[0279] Specific steps: (1) Capillary gel electrophoresis (CE-SDS): Take 100 μL of the virus to be tested, add 10 μL of 3% SDS and 10 μL of β-ME, vortex to mix, and heat at 90℃ for 10 min for lysis and denaturation. After the sample cools, take it out and add it to a 10 kD centrifugal filter, make up to 500 μL with ultrapure water, centrifuge at 14000 rpm / min for 10 min, concentrate by ultrafiltration twice and collect the filtrate. Add 5 μL of 3% SDS and 0.2 μL of 10 kD internal standard to the collected liquid, vortex to mix thoroughly and centrifuge briefly, and add to the sample vial for sample loading. Blank solution preparation: Take the corresponding preparation buffer of the test sample as a blank control, and perform other operations as above. Column temperature 25℃, run for 40 min.

[0280] (2) Cell infection: 293T cells were seeded in 96-well plates at a density of 1E4 cells / well. On the second day, when the cell confluence was 20-30%, infection was performed. Before infection, the high-glucose DMEM medium containing 10% FBS was replaced with serum-free high-glucose DMEM medium. After 72 hours of infection, the cells were digested, the medium was discarded, 100 μL of PBS was added to the cells, the PBS was discarded, 25 μL of 0.25% trypsin was added, and digestion was carried out at room temperature for 1 min. Digestion was terminated by adding 100 μL of DMEM containing 10% FBS. The autofluorescence of mScarlet in the cells was detected by flow cytometry.

[0281] The results are as follows Figure 5 As shown in Figure a, compared to RC-C14, the VP3m content of RC-C14V12 and RC-C14V13 decreased significantly. After modification, RC-C14V12 had no VP3m (VP3m = 1.2%, but due to limitations in equipment detection sensitivity, the VP3m content fluctuated between 0% and 1.5%), while the VP3m content of RC-C14V13 was 1.8%, a decrease of 2.75 times. Compared to RC-C14, the VP3 ratio of RC-C14V12 and RC-C14V13 was improved (normalized to VP1). Figure 5As shown in b, the transduction activities of RC-C14V12 and RC-C14V13 at 293T were improved compared with RC-C14, but there was no statistically significant difference.

[0282] Example 6. Characterization and analysis of RC-C14V12 virus

[0283] Affinity chromatography is a commonly used method for purifying AAV viruses based on biomolecular interactions. It achieves efficient purification by specifically binding to AAV, and the A260 / 280 ratio after affinity chromatography indirectly reflects the viral solidity rate. As shown in Figure a, the A260 / 280 of RC-C14V12 is improved compared to RC-C14. During virus manufacturing and purification, impurities are formed, including molecular variants with different activities, efficacy, and safety profiles than the desired product. These include viruses or particles with packaging defects such as empty shells, and aggregates. Viruses or particles with packaging defects such as empty shells can competitively inhibit vector transduction and induce particle aggregation. The solidity and empty shell rates of the virus can be detected by the genome copy number / virus particle number (VG / VP). As shown in Figure b, there is no difference in VG / VP between RC-C14V12 and RC-C14. The presence of aggregates may reduce the viral infectious titer, thereby reducing the efficacy of the product. Aggregates can be detected by size exclusion chromatography (SEC-HPLC). As shown in the figure, the polymer content of RC-C14V12 decreased significantly by 2.74 times compared to RC-C14. Infectivity titer (IU) represents the total number of infectious viral particles in the product; for AAV viruses, infectious titer is a key parameter for assessing vector quality. As shown in Figure d, the infectious titer of RC-C14V12 increased significantly by 1.38 times compared to RC-C14.

[0284] Specific steps: (1) In this paper, the AAV2 Xpress ELISA kit (PROGEN, A23007) was used to detect VP of RC-C14 and RC-C14V12. The ratio of the number of viral particles (VP) determined by enzyme-linked immunosorbent assay (ELISA) to the number of genome copies determined by digital droplet polymerase chain reaction (ddPCR) was analyzed.

[0285] (2) Size exclusion chromatography (SEC-HPLC): The mobile phase used was 10 mM NaH2PO4, 10 mM Na2HPO4, 350 mM KCl, pH 6.6, the flow rate was 0.3 ml / min, the injection volume was 10 μL, and the absorption peaks (260 nm and 280 nm) and fluorescence (excitation at 280 nm and emission at 348 nm) were detected.

[0286] (3) Infectivity titer (IU): On Day 1, 293T cells were seeded in 96-well plates at a density of 1E4 cells / well. On Day 2, when the cell confluence was approximately 50%, the AAV virus was serially diluted using complete culture medium. The dilution factors were as follows:

[0287] 1×10 -2 = 990 μL solvent + 10 μL stock solution

[0288] 1×10 -3 = 900 μL solvent + 100 μL previous solution

[0289] 1×10 -4 = 900 μL solvent + 100 μL previous solution

[0290] 1×10 -5 = 900 μL solvent + 100 μL previous solution

[0291] 1×10 -6 = 900 μL solvent + 100 μL previous solution

[0292] 1×10 -7 = 900 μL solvent + 100 μL previous solution

[0293] After aspirating the complete culture medium, add 100 μL of culture medium diluted with the virus (8 wells per dilution): incubate at 37°C in a 5% CO2 cell culture incubator for 72 hours. Observe the autofluorescence of mScarlet using a microscope.

[0294] Example 7. Characterization and analysis of RC-C08V19 virus

[0295] During the manufacturing and purification process, viruses can generate impurities, including molecular variants with different activities, efficacy, and safety profiles than the desired product. These include viruses or particles with packaging defects such as empty shells, and aggregates. Viruses or particles with packaging defects such as empty shells can competitively inhibit vector transduction and induce particle aggregation. The solid and empty shell ratio of the virus can be detected by the genome copy number / virus particle number (VG / VP). As shown in Figure a, there was no difference in VG / VP between RC-C08V19 and RC-C08. The infectivity titer (IU) represents the total number of infectious viral particles in the product. For AAV viruses, the infectivity titer is a key parameter for assessing vector quality. As shown in Figure b, the infectivity titer of RC-C08V19 was significantly increased by 2.51 times compared to RC-C08. Thin-tube gel electrophoresis (CE-SDS) utilizes the molecular sieving effect of polyacrylamide gels and uses SDS (sodium dodecyl sulfate) to eliminate differences in spatial structure and charge between different proteins. Under an electric field, proteins are separated according to their molecular weight, thereby achieving the purpose of detecting sample purity. It has higher sensitivity and resolution and can evaluate the VP components of AAV carriers.

[0296] Specific steps: (1) In this paper, the AAV2 Xpress ELISA kit (PROGEN, A23007) was used to detect VP of RC-C08 and RC-C08V19. The ratio of the number of viral particles (VP) determined by enzyme-linked immunosorbent assay (ELISA) to the number of genome copies determined by digital droplet polymerase chain reaction (ddPCR) was analyzed.

[0297] (2) Infectivity titer (IU): On Day 1, 293T cells were seeded in 96-well plates at a density of 1E4 cells / well. On Day 2, when the cell confluence was approximately 50%, the AAV virus was serially diluted using complete culture medium. The dilution factors were as follows:

[0298] 1×10 -2 = 990 μL solvent + 10 μL stock solution

[0299] 1×10 -3 = 900 μL solvent + 100 μL previous solution

[0300] 1×10 -4 = 900 μL solvent + 100 μL previous solution

[0301] 1×10 -5 = 900 μL solvent + 100 μL previous solution

[0302] 1×10 -6 = 900 μL solvent + 100 μL previous solution

[0303] 1×10 -7 = 900 μL solvent + 100 μL previous solution

[0304] After aspirating the complete culture medium, add 100 μL of culture medium diluted with the virus (8 wells per dilution): incubate at 37°C in a 5% CO2 cell culture incubator for 72 hours. Observe the autofluorescence of mScarlet using a microscope.

[0305] (3) Capillary gel electrophoresis (CE-SDS): Take 100 μL of the virus to be tested, add 10 μL of 3% SDS and 10 μL of β-ME, vortex to mix, and heat at 90℃ for 10 min for lysis and denaturation. After the sample cools, take it out and put it into a 10 kD centrifugal filter, make up to 500 μL with ultrapure water, centrifuge at 14000 rpm / min for 10 min, concentrate twice by ultrafiltration and collect the filtrate. Add 5 μL of 3% SDS and 0.2 μL of 10 kD internal standard to the collected liquid, vortex to mix thoroughly and centrifuge briefly, and put it into a sample vial for sample loading. Blank solution preparation: Take the corresponding formulation buffer of the test sample as a blank control, and perform other operations as above. Column temperature 25℃, run for 40 min.

[0306] The results are as follows Figure 7 As shown, compared with RC-C08, the VP3m content of RC-C08V19 decreased significantly, by a factor of 3.18. The VP1:VP2:VP3 ratio of RC-C08 was 1:1.6:8.2, while that of RC-C08V19 was 1:1.2:6.9. Compared with RC-C08, the VP2 ratio decreased (normalized to VP1).

[0307] Example 8. Study on the in vitro transduction activity of RC-C08V19

[0308] Viral transduction was detected using RGC-5 and SY5Y cells.

[0309] Cell infection procedure: 293T cells and SY5Y cells were seeded in 96-well plates at a density of 1E4 cells / well. Infection was performed the next day when cell confluence reached 20-30%. Before infection, the high-glucose DMEM medium containing 10% FBS was replaced with serum-free high-glucose DMEM medium. 72 hours after infection, the cells were digested, the medium was discarded, and 100 μL of PBS was added to the cells. The PBS was discarded, and 25 μL of 0.25% trypsin was added. Digestion was carried out at room temperature for 1 min, and then 100 μL of DMEM containing 10% FBS was added to terminate the digestion. Flow cytometry was used to detect the autofluorescence of mScarlets in the cells.

[0310] like Figure 8 a. Figure 8 As shown in b, at a higher MOI of 1000, the transduction efficiency of both RC-C08 and RC-C08V19 in 293T cells was higher than that of RC-C08, with no significant difference. Compared with RC-C08, the transduction efficiency of RC-C08V19 in SY5Y cells was improved.

[0311] The stability of the viral capsid directly affects its feasibility for storage and transportation, as well as its persistence in therapeutic applications. This article evaluated the stability of the RC-C08V19 capsid by storing RC-C08V19 and RC-C08 viruses at simulated 40°C for different times (D0, D1, D3) and then infecting 293T cells.

[0312] Stability assay procedures: RC-C08V19 and RC-C08 viruses were uniformly diluted to 1E12 vg / mL and aliquoted. The viruses were placed in a 40℃ metal bath on days 3, 1, and 0, respectively. The viruses were then removed and used to infect 293T cells. 293T cells were seeded in 96-well plates at a density of 1E4 cells / well. On the second day, when cell confluence reached 20-30%, RC-C08V19 and RC-C08 viruses were used to infect 293T cells with an MOI of 500. Before infection, the high-glucose DMEM medium containing 10% FBS was replaced with serum-free high-glucose DMEM medium. 72 hours after infection, the cells were digested, the medium was discarded, and 100 μL of PBS was added to the cells. The PBS was discarded, and 25 μL of 0.25% trypsin was added. Digestion was carried out at room temperature for 1 min, and then 100 μL of DMEM containing 10% FBS was added to terminate the digestion. The autofluorescence of mScarlet cells was detected using flow cytometry.

[0313] The results are as follows Figure 8 As shown in Figure c, the percentage decrease in mScarlet-positive cells in RC-C08V19 was not different from that in RC-C08 within the temperature range D0-D1. The rapid decrease in infection efficiency for both occurred between D1 and D3, with RC-C08V19 showing a 42.1% decrease in positive cells and C08 showing a 43.1% decrease. This indicates that the decrease in infection activity in RC-C08V19 was slightly smaller than that in RC-C08, but the difference was not statistically significant. Overall, RC-C08V19 maintained good stability.

[0314] Example 9. In vitro activity evaluation of RC-C07V22

[0315] (1) Thin tube gel electrophoresis (CE-SDS) utilizes the molecular sieving effect of polyacrylamide gel and uses SDS (sodium dodecyl sulfate) to eliminate the differences in spatial structure and charge between different proteins. Under an electric field, the proteins are separated according to their molecular weight, thereby achieving the purpose of detecting sample purity. It has higher sensitivity and resolution and can evaluate the VP component of AAV carrier.

[0316] Specific steps: Take 100 μL of the virus to be tested, add 10 μL of 3% SDS and 10 μL of β-ME, vortex to mix, and heat at 90℃ for 10 min for lysis and denaturation. After the sample cools, remove it and add it to a 10 kD centrifugal filter. Make up to 500 μL with ultrapure water, centrifuge at 14000 rpm / min for 10 min, concentrate twice by ultrafiltration and collect the filtrate. Add 5 μL of 3% SDS and 0.2 μL of 10 kD internal standard to the collected liquid, vortex thoroughly to mix, and centrifuge briefly. Add to the sample vial for loading. Blank solution preparation: Take the corresponding formulation buffer of the test sample as a blank control, and perform other operations as above. Column temperature 25℃, run for 40 min.

[0317] (2) Cell infection: 293T cells and SY5Y cells were seeded in 96-well plates at a density of 1E4 cells / well. On the second day, when the cell confluence was 20-30%, RC-C00V8 and AAV2 cells were infected at MOI=200 and MOI=1000, respectively. Before infection, the high-glucose DMEM medium containing 10% FBS was replaced with serum-free high-glucose DMEM medium. After 72 hours of infection, the cells were digested, the medium was discarded, 100 μL of PBS was added to the cells, the PBS was discarded, 25 μL of 0.25% trypsin was added, and digestion was carried out at room temperature for 1 min. Digestion was terminated by adding 100 μL of DMEM containing 10% FBS. The autofluorescence of mScarlet cells was detected by flow cytometry.

[0318] The results are as follows Figure 9 As shown in Figure a, compared to RC-C07V5, the VP3m content of RC-C07V22 is significantly reduced. After modification, RC-C07V22 contains no VP3m (VP3m = 1.17%, but due to limitations in equipment detection sensitivity, the VP3m content fluctuates between 0% and 1.5%). Figure 9 As shown in b, compared with AAV2, there was no difference in the percentage of mScarlet-positive cells of RC-C07V22 on 293T cells at MOI=500 and 2500; Figure 9 As shown in c, when the MOI is 2500, the average fluorescence intensity of RC-C07V22 increases, which is higher than that of the AAV9 variant RC-C07V5, but the difference is not significant.

[0319] Example 10. In vivo activity assessment of VP3m modified serum type ※

[0320] Four 6-week-old C57 / BL6 mice were used as experimental subjects in each group. Six serotypes of AAV2-mScarlet, RCC00V8-mScarlet, RCC14-mScarlet, RCC14V12-mScarlet, RCC08-mScarlet, and RCC08V19-mScarlet were administered via intravitreal injection. Equal volumes (1x10⁻⁶) of each serotype were injected intravitreally. 9 AAV2 / RC-C00V8, RC-C14 / RCC14V12, and RC-C08 / RC-C08V19 viruses (all carrying the red fluorescent protein reporter gene) were injected intraocularly into the eyes of mice (vg / μL, 2μL). In vivo transduction efficiency was assessed at 4 and 6 weeks post-administration using in vivo autofluorescence (AF) and retinal section examination.

[0321] The results are as follows Figure 10 As shown, AF at 4 and 6 weeks and retinal sections at 6 weeks showed no statistically significant difference in fluorescence area and total fluorescence intensity of the RC-C00V8 reporter gene mScarlet compared to the control group AAV2; no statistically significant difference in fluorescence area and total fluorescence intensity of the RC-C08V19 reporter gene mScarlet compared to the control group RC-C08; and no statistically significant difference in fluorescence area and total fluorescence intensity of the RC-C14V12 reporter gene mScarlet compared to the control group RC-C14. In summary, RC-C00V8, RC-C08V19, and RC-C14V12, when injected intravitreal at 1x10⁻⁶ ppm, showed no statistically significant difference compared to their control groups. 9 At 4 and 6 weeks of vg / μL vg / eye infection, the modification of VP3m did not affect its transduction activity in mice, whether assessed by total fluorescence intensity or fluorescence area.

[0322] sequence list

[0323] SEQ ID NO:1 Name: Wild-type AAV2 protein VP1 full-length

[0324]

[0325] SEQ ID NO:2. Name: VP3, the capsid protein of RC-C08

[0326]

[0327] SEQ ID NO:3. Name: VP3, the capsid protein of RC-C07V5

[0328]

[0329]

[0330] SEQ ID NO:4. Name: VP3, capsid protein of RC-C14

[0331]

[0332] SEQ ID NO:5. Name: RC-C00V8 VP3

[0333]

[0334] SEQ ID NO:6. Name: RC-C00V27 VP3

[0335]

[0336]

[0337] SEQ ID NO:7. Name: RC-C00V29 VP3

[0338]

[0339] SEQ ID NO:8. Name: RC-C14V12 VP3

[0340]

[0341] SEQ ID NO:9. Name: RC-C14V13 VP3

[0342]

[0343]

[0344] SEQ ID NO:10. Name: RC-C08V19 VP3

[0345]

[0346] SEQ ID NO:11. Name: RC-C07V22 VP3

[0347]

[0348] SEQ ID NO:12. Name: Wild-type AAV2 cap gene

[0349]

[0350]

[0351] SEQ ID NO:13. Name: C00V8-F1

[0352]

[0353] SEQ ID NO:14. Name: C00V8-R1

[0354]

[0355] SEQ ID NO:15. Name: C00V8-F2

[0356]

[0357] SEQ ID NO:16. Name: C00V8-R2

[0358]

[0359] SEQ ID NO:17. Name: LRC01V1-F1

[0360]

[0361] SEQ ID NO:18. Name: C00V15-R1

[0362]

[0363] SEQ ID NO:19. Name: C00V15-F2

[0364]

[0365] SEQ ID NO:20. Name: LRC01V1-R2

[0366]

[0367] SEQ ID NO:21. Name: RC07V34-F1

[0368]

[0369] SEQ ID NO:22. Name: C00V27-R1

[0370]

[0371] SEQ ID NO:23. Name: C00V27-F2

[0372]

[0373] SEQ ID NO:24. Name: RC07V34-R2

[0374]

[0375] SEQ ID NO:25. Name: RC07V34-F1

[0376]

[0377] SEQ ID NO:26. Name: C00V29-R1

[0378]

[0379] SEQ ID NO:27. Name: C00V29-F2

[0380]

[0381] SEQ ID NO:28. Name: RC07V34-R2

[0382]

[0383] SEQ ID NO:29. Name: LRCV30-F1

[0384]

[0385] SEQ ID NO:30. Name: C08V19-R1

[0386]

[0387] SEQ ID NO:31. Name: C08V19-F2

[0388]

[0389] SEQ ID NO:32. Name: LRCV30-R2

[0390]

[0391] SEQ ID NO:33. Name: RC07V34-F1

[0392]

[0393] SEQ ID NO:34. Name: C00V27-R1

[0394]

[0395] SEQ ID NO:35. Name: C00V27-F2

[0396]

[0397] SEQ ID NO:36. Name: RC07V34-R2

[0398]

[0399] SEQ ID NO:37. Name: LRCV30-F1

[0400]

[0401] SEQ ID NO:38. Name: C08V19-R1

[0402]

[0403] SEQ ID NO:39. Name: C08V19-F2

[0404]

[0405] SEQ ID NO:40. Name: LRCV30-R2

[0406]

[0407] SEQ ID NO:41. Name: LRCV37-F1

[0408]

[0409] SEQ ID NO:42. Name: C07V22-R1

[0410]

[0411] SEQ ID NO:43. Name: C07V22-F2

[0412]

[0413] SEQ ID NO:44. Name: LRCV37-R2

[0414]

Claims

1. An engineered adeno-associated virus (AAV) VP3 capsid protein, characterized in that, The engineered VP3 capsid protein contains methionine (Met) at position 203 of the amino acid sequence SEQ ID NO:1, and glycine (Gly), leucine (Leu), or valine (Val) at position 211 of the amino acid sequence SEQ ID NO:1, the positions of which are determined by sequence alignment with the amino acid sequence SEQ ID NO:

1. The serotype of the AAV is wild-type or a variant of AAV2, AAV6, or AAV9. Preferably, by sequence alignment with amino acid sequence SEQ ID NO:1, the first position of its amino acid sequence corresponds to the 203rd position of amino acid sequence SEQ ID NO:1, and / or the 9th position of its amino acid sequence corresponds to the 211th position of amino acid sequence SEQ ID NO:

1.

2. The engineered VP3 capsid protein as described in claim 1, characterized in that, Contains methionine (Met) at position 203 of the amino acid sequence SEQ ID NO:1, and has glycine (Gly), leucine (Leu), or valine (Val) at position 211 of the amino acid sequence SEQ ID NO:1, and belongs to the serotypes selected from: AAV2, RC-C00, RC-C08, and RC-C14. Preferably, the engineered VP3 capsid protein comprises or consists of the following amino acid sequence. composition: (i) The amino acid sequence shown in any one of SEQ ID NO:5-10; (ii) An amino acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with any of the amino acid sequences shown in any of SEQ ID NO:5-10 and having the same amino acid sequences at positions 203 and 211, said positions being the positions corresponding to amino acid sequence SEQ ID NO:

1.

3. The engineered VP3 capsid protein as described in claim 1, characterized in that, It contains methionine (Met) at position 203 of the amino acid sequence SEQ ID NO:1, and glycine (Gly) or leucine (Leu) at position 211 of the amino acid sequence SEQ ID NO:1, and belongs to the serotypes selected from AAV9 and RC-C07. Preferably, the engineered VP3 capsid protein comprises or is composed of the following amino acid sequence: (i) The amino acid sequence shown in SEQ ID NO:11; (ii) An amino acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with the amino acid sequence shown in SEQ ID NO:11 and being identical to it at positions 203 and 211, the positions corresponding to the positions in amino acid sequence SEQ ID NO:

1.

4. An isolated nucleic acid molecule comprising a gene sequence encoding the VP3 capsid protein as described in any one of claims 1-3. Preferably, the gene is the AAV cap gene. More preferably, the codons encoding the 211th amino acid in the cap gene corresponding to the amino acid sequence SEQ ID NO:1 are GTG, GTC, GTT, GTA, GGG, GGA, GGT, GGC, CTG, TTG, and CTT.

5. A vector, such as a plasmid, preferably a packaging plasmid, comprising the nucleic acid molecule as described in claim 4.

6. A host cell, such as a packaging cell, comprising the nucleic acid molecule as claimed in claim 4 and / or the vector as claimed in claim 5.

7. A recombinant adeno-associated virus vector particle or population thereof, which does not contain or substantially does not contain a truncated form of VP3m of the VP3 capsid protein, wherein the first amino acid residue of VP3m is methionine (Met) corresponding to position 211 of the amino acid sequence SEQ ID NO:

1. For example, in the recombinant adeno-associated virus vector particle or population thereof, the percentage (in molar amount) of the truncated form of VP3m of the total VP3 protein is less than or equal to 5%, preferably less than 5%, preferably less than 4%, preferably less than 3%, preferably less than 2%, preferably less than 1.5%, preferably less than 1%, preferably less than 0.9%, preferably less than 0.8%, preferably less than 0.7%, preferably less than 0.6%, preferably less than 0.5%, preferably less than 0.4%, preferably less than 0.3%, preferably less than 0.2%, preferably less than 0.1%. Preferably, the serotype of the recombinant adeno-associated virus vector is wild-type AAV2, AAV6, or AAV9 or a variant thereof. Preferably, the recombinant adeno-associated virus vector particle comprises the engineered VP3 capsid protein as described in any one of claims 1-3.

8. A method for optimizing the VP3 capsid protein of adeno-associated virus (AAV), the method comprising mutating the gene encoding the VP3 capsid protein such that the protein encoded by it does not contain methionine (Met) at position 211 corresponding to the amino acid sequence SEQ ID NO:1, preferably such that the protein encoded by it contains glycine (Gly), leucine (Leu), or valine (Val) at position 211 corresponding to the amino acid sequence SEQ ID NO:

1. Preferably, the method includes mutating the cap gene so that the set of codons at positions 631-633 corresponding to the nucleic acid sequence SEQ ID NO:12 is GTG, GTC, GTT, GTA, GGG, GGA, GGT, GGC, CTG, TTG, CTT. Preferably, the optimization includes improving the AAV virus containing the VP3 capsid protein by one or more of the following properties: (i) The content of VP3m, the truncated form of VP3 capsid protein, is reduced; (ii) Improved purity of capsid components; (iii) The ratio of VP1:VP2:VP3 protein content is more stable; (iv) Improved in vivo and / or in vitro transduction efficiency, preferably for tissues and / or cells derived from the retina; (v) Increased viral particle infectivity and / or infectivity titer; (vi) Increased viral production and / or reduced aggregates; (vii) Improved virus storage stability.

9. A method for producing recombinant AAV viral vector particles, the method comprising culturing packaging cells under conditions sufficient to produce recombinant AAV viral particles, wherein the packaging cells comprise the nucleic acid molecule of claim 4 and / or the vector of claim 5. Optionally, the method further includes the step of transducing the nucleic acid molecule of claim 4 and / or the vector of claim 5 into packaging cells. Optionally, the method further includes the step of recovering the resulting recombinant AAV viral vector particles from the packaging cells and / or their culture system.

10. A pharmaceutical composition comprising recombinant AAV viral vector particles according to any one of claims 1-3, optionally further comprising pharmaceutical excipients, such as pharmaceutical carriers and pharmaceutical excipients known in the art, including buffers.

11. A combination product comprising any one of the recombinant AAV viral vector particles according to claims 1-3, and one or more other therapeutic agents.

12. Use of the recombinant AAV viral vector particles of any one of claims 1-3, the pharmaceutical composition of claim 10, or the combination product of claim 11 in the preparation of a medicament, preferably, the medicament being used to treat an eye disease. Preferably, the drug is administered via intraocular administration, such as intraretinal administration or intravitreal administration, such as subretinal administration or intravitreal administration, such as subretinal injection or intravitreal injection.

Citation Information

Patent Citations

  • Capsid modified virus vector and its preparation and use

    CN117247434B

  • Ancestral virus sequences and uses thereof

    CN108603235A

  • Novel AAV capsid modified strains and uses thereof

    CN116970648A

  • Capsid modified virus vector and preparation and application thereof

    CN117247434A

  • Isolated modified AAV9 capsid protein VP1

    CN117836312A