Anti-human CD40 protein antibody, antibody pair and double-antibody sandwich method detection kit

Abstract

The invention belongs to the technical field of antibodies, and particularly relates to an anti-human CD40 protein antibody, an antibody pair and a double-antibody sandwich method detection kit. The antibody is a first antibody or a second antibody, amino acid sequences of light chains CDR1-3 of the first antibody are respectively shown as SEQ ID NO.3-5, and amino acid sequences of heavy chains CDR1-3 of the first antibody are respectively shown as SEQ ID NO.8-10; the amino acid sequences of light chains CDR1-3 of the second antibody are respectively as shown in SEQ ID NO.13-15, and the amino acid sequences of heavy chains CDR1-3 of the second antibody are respectively as shown in SEQ ID NO.18-20. The invention provides two novel anti-human CD40 protein antibodies and an antibody pair composed of the two novel anti-human CD40 protein antibodies, and the antibodies and the antibody pair have strong specificity and high affinity for human CD40 protein, have relatively high recognition sensitivity and selectivity, and have good application prospects in the fields of immunodiagnosis and immunotherapy with CD40 as a target spot.

Description

Technical Field

[0001] This invention relates to the field of antibody technology, and in particular to antibodies and antibody pairs against human CD40 protein, as well as a double-antibody sandwich assay kit. Background Technology

[0002] CD40 (Clusters of Differentiation 40) is a type I transmembrane glycoprotein closely related to immune cell function. A member of the tumor necrosis factor receptor superfamily, it plays a crucial role in the immune system, regulating the activation, proliferation, and survival of immune cells. The CD40 precursor contains 297 amino acids, consisting of an N-terminal signal peptide, an extracellular region, a transmembrane region, and a cytoplasmic region. Its extracellular region contains four CDRs (Complementarity-determining regions) with a total of 22 cysteine ​​residues, providing the structural basis for its signal transduction between immune cells. CD40 is widely expressed on antigen-presenting cells (APCs) such as dendritic cells (DCs), B cells, and monocytes, participating in the activation of various immune cells. CD40 is also expressed on many non-immune cells, such as endothelial cells, fibroblasts, smooth muscle cells, and some malignant cells. The ligand for CD40 is CD154 (also known as CD40L) on TH cells. The interaction between CD40 and CD40L can promote the maturation and activation of APC cells, induce the expression of co-stimulatory molecules, enhance antigen presentation capacity, and promote T cell activation and proliferation, playing a crucial role in T cell-mediated anti-tumor immunity. Simultaneously, CD40 signaling is also essential for the activation, proliferation, and differentiation of B cells, promoting antibody production, class switching, and the formation of memory B cells, thus enhancing humoral immunity.

[0003] The CD40-CD40L signaling pathway is involved in various pathological processes, including autoimmune diseases, inflammatory diseases, and tumorigenesis. Studies have found that CD40 is highly expressed in almost all B-cell malignancies and many solid tumors. CD40 signaling can promote tumor cell proliferation, survival, and migration, and helps tumor cells evade the body's immune surveillance. In some autoimmune diseases, such as systemic lupus erythematosus (SLE), the CD40-CD40L signaling pathway is overactivated, leading to abnormal B-cell activation, the production of large amounts of autoantibodies, and consequently, damage to tissues and organs. Detecting the expression level of CD40 molecules is helpful for the diagnosis and disease assessment of these diseases. Furthermore, due to CD40's crucial role in immune activation, it has become an important target for immunotherapy. Several agonist CD40 antibodies have been developed for potential cancer treatment, and antagonist CD40 antibodies have also shown potential in the treatment of autoimmune diseases, particularly in SLE, transplantation, rheumatoid arthritis, Crohn's disease, and other indications, with rapid progress in research and development. Therefore, antibodies targeting the CD40 protein have broad application prospects in the immunodiagnosis and treatment of related diseases.

[0004] Currently, most commercially available CD40 antibodies are derived from mouse monoclonal antibodies, which have relatively weak affinity and specificity. Developing monoclonal antibodies with high affinity and specificity as a core technology for immunodiagnosis and immunotherapy can improve the accuracy of CD40 protein detection and the diagnostic efficacy of related diseases, while also providing potential options for CD40 therapeutic antibodies. Summary of the Invention

[0005] To address the issues of weak specificity and / or affinity of existing anti-human CD40 protein antibodies, this invention provides two novel anti-human CD40 protein antibodies and their antibody pairs. These antibodies and antibody pairs exhibit strong specificity and high affinity for human CD40 protein, demonstrating high recognition sensitivity and selectivity, and show promising application prospects in the fields of CD40-targeted immunodiagnosis and immunotherapy. This invention also provides the application of the aforementioned antibodies or antibody pairs in the detection of human CD40 protein, as well as related detection kits, especially double-antibody sandwich detection kits based on a double-antibody sandwich method. To achieve this objective, this invention utilizes the following technical solutions:

[0006] The first aspect of this invention provides an antibody against human CD40 protein, which is a first antibody or a second antibody, wherein: the amino acid sequences of the complementarity-determining regions CDR1-3 on the light chain variable region of the first antibody are shown in SEQ ID NO. 3-5, and the amino acid sequences of the complementarity-determining regions CDR1-3 on the heavy chain variable region are shown in SEQ ID NO. 8-10; the amino acid sequences of the complementarity-determining regions CDR1-3 on the light chain variable region of the second antibody are shown in SEQ ID NO. 13-15, and the amino acid sequences of the complementarity-determining regions CDR1-3 on the heavy chain variable region are shown in SEQ ID NO. 18-20.

[0007] Further, the amino acid sequence of the light chain variable region of the first antibody is shown in SEQ ID NO.2, and the amino acid sequence of the heavy chain variable region is shown in SEQ ID NO.7; the amino acid sequence of the light chain variable region of the second antibody is shown in SEQ ID NO.12, and the amino acid sequence of the heavy chain variable region is shown in SEQ ID NO.17.

[0008] Further, the amino acid sequence of the first antibody light chain is shown in SEQ ID NO.1, and the amino acid sequence of the heavy chain is shown in SEQ ID NO.6; the amino acid sequence of the second antibody light chain is shown in SEQ ID NO.11, and the amino acid sequence of the heavy chain is shown in SEQ ID NO.16.

[0009] Further, the first antibody and / or the second antibody are full-length antibodies or antigen-binding regions of the full-length antibody; the antigen-binding region is selected from at least one of the Fab fragment, F(ab)2 fragment, Fv fragment, (Fv)2 fragment, scFv fragment, and sc(Fv)2 fragment.

[0010] A second aspect of the present invention provides a nucleic acid molecule or a recombinant vector, the recombinant vector containing the nucleic acid molecule, the nucleic acid molecule encoding a first antibody or a second antibody as described above.

[0011] Furthermore, the nucleic acid sequence of the light chain variable region of the first antibody is as shown in SEQ ID NO.22 or its complementary sequence, and the nucleic acid sequence of the heavy chain variable region is as shown in SEQ ID NO.24 or its complementary sequence; the nucleic acid sequence of the light chain variable region of the second antibody is as shown in SEQ ID NO.26 or its complementary sequence, and the nucleic acid sequence of the heavy chain variable region is as shown in SEQ ID NO.28 or its complementary sequence.

[0012] Further, the nucleic acid sequence of the first antibody light chain is as shown in SEQ ID NO.21 or is complementary to it, and the nucleic acid sequence of the heavy chain is as shown in SEQ ID NO.23 or is complementary to it; the nucleic acid sequence of the second antibody light chain is as shown in SEQ ID NO.25 or is complementary to it, and the nucleic acid sequence of the heavy chain is as shown in SEQ ID NO.27 or is complementary to it.

[0013] A third aspect of the present invention provides an antibody pair against human CD40 protein, comprising a first antibody and a second antibody as described above.

[0014] The fourth aspect of the present invention provides the use of the antibody or antibody pair against human CD40 protein as described above in the preparation of a human CD40 protein detection kit.

[0015] The fifth aspect of the present invention provides a human CD40 protein detection kit, the detection kit comprising an antibody or antibody pair against human CD40 protein as described above.

[0016] Furthermore, the detection kit is a double antibody sandwich detection kit, comprising a first antibody and a second antibody, wherein the first antibody is a capture antibody, the second antibody is a detection antibody, and the second antibody is conjugated with a detection label.

[0017] The present invention has the following beneficial effects: It provides two novel anti-human CD40 protein antibodies and their antibody pairs. These antibodies and antibody pairs exhibit high specificity and affinity for human CD40 protein, as well as high recognition sensitivity and selectivity. The two antibodies recognize and bind to different epitopes of the CD40 protein and can be used as paired antibodies in a double-antibody sandwich immunoassay system. When used to detect and quantify CD40 protein concentration, the detection limit can be as low as 1.84 pg / mL. It possesses advantages such as high specificity, high sensitivity, a wide linear detection range, high reliability of results, and rapid and convenient detection process. It provides a reliable means for the stable detection of trace levels of Human CD40 protein and for the auxiliary diagnosis, disease monitoring, and prognostic assessment of diseases related to abnormal human CD40 expression or function. It also provides excellent candidate antibodies for CD40-targeted immunotherapy, showing promising application prospects in the fields of CD40-targeted immunodiagnosis and immunotherapy. Attached Figure Description

[0018] To more clearly illustrate the technical solutions in the embodiments of the present invention, the accompanying drawings used in the description of the embodiments will be briefly introduced below. Obviously, the accompanying drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0019] Figure 1 The vector map used to construct the monoclonal antibody expression vector in Example 1 of this invention, from left to right, is the pBR322 vector map carrying the light chain constant region and the heavy chain constant region;

[0020] Figure 2 This is an affinity curve of the monoclonal antibody binding to human CD40 protein in Example 2 of the present invention;

[0021] Figure 3 This is a graph showing the antigenic epitope curve of the monoclonal antibody recognizing human CD40 protein in Example 2 of the present invention.

[0022] Figure 4 This is the standard curve for detecting human CD40 protein in Example 3 of the present invention, based on a double-antibody sandwich enzyme-linked immunosorbent assay system established using monoclonal antibodies 1E4 and 3F9.

[0023] Figure 5 The specific detection results of human CD40 protein using the double-antibody sandwich enzyme-linked immunosorbent assay system established based on monoclonal antibodies 1E4 and 3F9 in Example 4 of this invention are shown.

[0024] Figure 6 The results of the thermostability detection of human CD40 protein in Example 5 of this invention are based on the double-antibody sandwich enzyme-linked immunosorbent assay system established by monoclonal antibodies 1E4 and 3F9. Detailed Implementation

[0025] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to embodiments. The embodiments described herein are for illustrative purposes only and are not intended to limit the invention.

[0026] Based on the information contained herein, various changes to the precise description of the invention can be readily made by those skilled in the art without departing from the spirit and scope of the appended claims. It should be understood that the scope of the invention is not limited to the defined processes, properties, or components, as these embodiments and other descriptions are merely illustrative of specific aspects of the invention. In fact, various modifications to embodiments of the invention that will be apparent to those skilled in the art or related fields are covered within the scope of the appended claims.

[0027] To better understand the invention and not to limit its scope, all figures and other numerical values ​​used in this invention to indicate amounts, percentages, or other quantities should, in all cases, be understood to be modified by the word "approximately." Therefore, unless specifically stated otherwise, the numerical parameters listed in the specification and appended claims are approximate values ​​and may vary depending on the desired properties being sought. Each numerical parameter should at least be considered as obtained based on reported significant figures and through conventional rounding methods.

[0028] Additionally, it should be noted that, unless otherwise defined, the scientific and technical terms used in the context of this invention should have the meanings commonly understood by those skilled in the art.

[0029] The terms “including,” “contains,” “includes,” “has,” and similar words are non-restrictive and can include other steps and other components that do not affect the result.

[0030] The term “and / or” should be considered as a specific disclosure of each of the two specified features or components, with or without the other. For example, “A and / or B” is considered to include (i) A, (ii) B, and (iii) A and B.

[0031] The terms “first”, “second”, etc., are used to distinguish similar objects, not necessarily to describe a specific order or sequence. It should be understood that such usage can be interchanged where appropriate.

[0032] The terms "rabbit monoclonal antibody," "monoclonal antibody," "rabbit-derived antibody," and "rabbit monoclonal antibody," etc., have the same meaning and, unless otherwise specified, refer to rabbit-derived antibodies that specifically bind to the Human CD40 protein. The modifier "rabbit" indicates that the antibody's complementarity-determining region (CDR) is derived from a rabbit immunoglobulin sequence. The terms "CD40 protein," "CD40," etc., have the same meaning and can be used interchangeably.

[0033] An antibody is an immunoglobulin molecule that specifically binds to a target antigen or epitope through at least one antigen recognition site located in the variable region of the immunoglobulin molecule. In this invention, the term "antibody" is to be interpreted in the broadest sense and includes various antibody structures, including but not limited to so-called full-length antibodies, antibody fragments, and their genetic or chemical modifications, provided they exhibit the desired antigen-binding activity. An antibody fragment may be one or more portions or fragments of a full-length antibody, retaining the antibody's ability to specifically bind to a target antigen.

[0034] A typical antibody molecule (full-length antibody) consists of two identical light chains (L) and two identical heavy chains (H). Light chains can be classified into two types: κ chains and λ chains; heavy chains can be classified into five types: μ, δ, γ, α, and ε chains, with antibodies defined as IgM, IgD, IgG, IgA, and IgE, respectively. The amino acid sequences near the N-terminus of both the heavy and light chains vary considerably, while the amino acid sequences of other parts are relatively constant. The regions with significant amino acid sequence variation near the N-terminus in both the light and heavy chains are called variable regions (V), and the regions with relatively stable amino acid sequences near the C-terminus are called constant regions (C). The variable regions of the heavy chain (VH) and light chain (VL) are usually the most variable parts of the antibody and contain antigen recognition sites. The VH and VL regions can be further subdivided into hypervariable regions (HVR) and framework regions (FR). The hypervariable region, also known as the complementarity-determining region (CDR), is a ring structure. Heavy chain CDRs and light chain CDRs are tightly joined together by the FR region and cooperate to form a surface that is complementary to the three-dimensional structure of the target antigen or epitope, determining the antibody's specificity and serving as the site for antibody recognition and antigen binding. The FR regions are the more conserved parts of the VH and VL, generally exhibiting a β-sheet configuration, linked by three CDRs forming a connecting loop. Each VH and VL typically consists of three CDRs and four FRs, arranged in the following order from the amino terminus to the carboxyl terminus: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4.

[0035] CDRs and FRs can be identified according to Kabat definitions, Chothia definitions, the sum of Kabat and Chothia definitions, AbM definitions, contact definitions, IMGT unique numbering definitions and / or conformational definitions, or any CDR determination method known in the art. As used in this invention, they are defined by the Kabat numbering system.

[0036] The light chain constant region (CL) and heavy chain constant region (CH) do not directly participate in antibody-antigen binding, but they exhibit different effector functions, such as participating in antibody-dependent cell-mediated cytotoxicity (ADCC). The CL lengths of different Ig types (κ or λ) are generally consistent, but the CH lengths differ among Ig classes. For example, IgG, IgA, and IgD include CH1, CH2, and CH3, while IgM and IgE include CH1, CH2, CH3, and CH4. The amino acid sequences of the antibody heavy and light chain constant regions are well-known in the art and can be obtained by searching the IMGT database.

[0037] Full-length antibodies are the most complete antibody molecular structures, with a typical Y-type molecular structure. Therefore, in the context of this invention, "full-length antibody," "complete antibody," and "Y-type antibody" have the same meaning and can be used interchangeably.

[0038] An antibody fragment is one or more portions or segments of a full-length antibody that substantially retain the same biological function or activity as the full-length form. Specifically, an antibody fragment includes at least the same CDR region as the full-length antibody, and more preferably the same variable region, thereby retaining complete antigen recognition and binding sites, enabling it to bind to the same antigens, especially the same epitopes, as the full-length antibody. Typical examples of antibody fragments include Fab, F(ab)2, Fab', F(ab')2, Fv, (Fv)2, scFv, and sc(Fv)2, which can be obtained using conventional techniques in the art.

[0039] (i) Fab: An antigen-binding fragment (Fab) is a monovalent fragment consisting of a complete light chain (variable and constant regions) and a portion of a heavy chain (variable and first constant region). Fragments such as Fab, F(ab')2, and Fab' can be obtained by protease cleavage of a full-length antibody. For example, under the action of papain, IgG can be degraded into two Fab fragments and one Fc fragment; under the action of pepsin, IgG can be degraded into one F(ab')2 fragment and one pFc' fragment. The F(ab')2 fragment is further reduced to form two Fab' fragments. Because Fab possesses an antigen-binding region and a portion of a constant region, it not only has antibody-antigen affinity and excellent tissue penetration like scFv, but also has a more stable structure.

[0040] (ii)F(ab)2: Contains a bivalent segment consisting of two Fabs connected by a disulfide bridge in the hinge region.

[0041] (iii) Fv: The variable fragment (Fv) is located at the N-terminus of the antibody Fab fragment. It contains only the variable region and consists of a variable region of one light chain and one heavy chain. It is a non-covalently bound dimer of VH and VL (VH-VL dimer). The three CDRs of each variable region interact to form an antigen-binding site on the surface of the VH-VL dimer, which has the ability to recognize and bind antigens, although the affinity is lower than that of the intact antibody.

[0042] (iv)(Fv)2: Consists of two Fv segments covalently linked together.

[0043] (v)scFv: A single-chain variable fragment (scFv) is an Fv fragment composed of a single polypeptide chain, consisting of a heavy chain variable region (VH) and a light chain variable region (VL) linked by a flexible linker (typically composed of 10-25 amino acids). It retains the original antibody's specificity for binding to the antigen. The linker in this invention is not particularly limited as long as it does not interfere with the expression of the antibody variable regions linked to its two ends. Compared to full-length antibodies, scFv has a smaller molecular weight, thus exhibiting higher penetration and lower immune side effects.

[0044] The (vi)sc(Fv)2 segment is formed by connecting two heavy chain variable regions and two light chain variable regions through a joint, etc.

[0045] In some embodiments, the full-length sequence of the antibody or antibody fragment of the present invention may include a complementarity-determining region (CDR) and a framework region (FR) derived from a rabbit immunoglobulin sequence. In other embodiments, the antibody may contain amino acid residues encoded by a non-rabbit immunoglobulin sequence, such as humanized antibodies, chimeric antibodies, etc., to reduce the body's rejection response while maintaining the desired specificity and affinity. The term "chimeric antibody" refers to an antibody in which a portion is derived from a specific source or species, while the remainder is derived from a different source or species. The term "humanized antibody" is a chimeric antibody containing the CDR region of a non-human antibody, such as a rabbit antibody, and a region derived from a human FR. In some cases, the variable region of a non-human antibody binds to the constant region of a human antibody, such as a human-rabbit chimeric antibody; in other cases, the CDR region of a non-human antibody binds to both the FR and constant regions derived from a human antibody sequence, i.e., the CDR region of a non-human antibody is grafted onto a human antibody framework (FR) sequence derived from the FR sequence of one or more other human antibody variable regions. In this invention, the CDR region in the chimeric antibody or humanized antibody is derived from the rabbit CDR region.

[0046] The terms "monoclonal antibody" or similar terms are used interchangeably and refer to a homogeneous group of antibodies, meaning that the individual antibodies constituting the group are identical except for a small number of naturally occurring mutations and / or post-translational modifications (e.g., isomerization, amidation). A "monoclonal antibody" is highly specific, exhibiting a single binding specificity and affinity for the same or substantially identical epitopes on an antigen. The modifier "monoclonal" indicates that the antibody is obtained from a substantially homogeneous group of antibodies and should not be interpreted as limiting the source or method of preparation of the antibody. This antibody can be prepared by a variety of methods, including but not limited to hybridoma, phage display, yeast display, recombinant DNA, single-cell screening, or single-cell sequencing.

[0047] The term “specific binding” is a well-known term in the art. A molecule exhibits “specific binding” if it reacts more frequently, more rapidly, for a longer duration, and / or with greater affinity for a particular target antigen or epitope than it reacts with other target antigens or epitopes. “Specific binding”, or “preferred binding”, does not necessarily require (although may include) exclusive binding.

[0048] To make the above-mentioned objectives and advantages of the present invention more apparent and understandable, the specific embodiments of the present invention will be described in detail below.

[0049] This invention provides an antibody against human CD40 protein, which is either a first antibody or a second antibody. The antibody includes a light chain variable region and a heavy chain variable region. Both the light chain variable region and the heavy chain variable region include three complementarity-determining regions (CDRs), named CDR1, CDR2, and CDR3, respectively. The amino acid sequences of CDR1, CDR2, and CDR3 on the light chain variable region of the first antibody are shown in SEQ ID NO.3, SEQ ID NO.4, and SEQ ID NO.5, respectively, and the amino acid sequences of CDR1, CDR2, and CDR3 on the heavy chain variable region are shown in SEQ ID NO.8, SEQ ID NO.9, and SEQ ID NO.10, respectively. The amino acid sequences of CDR1, CDR2, and CDR3 on the light chain variable region of the second antibody are shown in SEQ ID NO.13, SEQ ID NO.14, and SEQ ID NO.15, respectively, and the amino acid sequences of CDR1, CDR2, and CDR3 on the heavy chain variable region are shown in SEQ ID NO.18, SEQ ID NO.19, and SEQ ID NO.20, respectively.

[0050] The monoclonal antibody provided by this invention has specific and sensitive recognition and binding ability to human CD40 protein, and strong affinity for CD40 protein. The affinity constant K of the first antibody and the second antibody is... DThe two antibodies, with concentrations of 0.161 nM and 0.212 nM respectively, exhibit high selectivity for CD40 protein and no cross-reactivity with structurally similar proteins. This provides an effective antibody tool for the specific, sensitive, and accurate detection of human CD40, and also offers excellent candidate antibodies for CD40-targeted immunotherapy, showing promising application prospects in the fields of CD40-targeted immunodiagnosis and immunotherapy. Furthermore, the two antibodies recognize and bind to different epitopes of the CD40 protein, making them suitable as paired antibodies for a double-antibody sandwich immunoassay system. A double-antibody sandwich enzyme-linked immunosorbent assay (ELISA) system can be constructed using one antibody as the capture antibody and the other, labeled with biotin, as the detection antibody. This system can accurately detect and quantify CD40 protein concentration, with a detection limit as low as 1.84 pg / mL. It possesses advantages such as high specificity, high sensitivity, a wide linear detection range, high reliability of results, and rapid and convenient detection, providing a reliable means for the stable detection of trace levels of Human CD40 protein and for the auxiliary diagnosis, disease monitoring, and prognostic assessment of diseases related to abnormal human CD40 expression or function.

[0051] Optionally, both the light chain variable region and the heavy chain variable region include four frame regions (FRs), which are arranged in an alternating sequence with three core parameters (CDRs) to form the variable region. The amino acid sequence of the first antibody light chain variable region is shown in SEQ ID NO.2, and the amino acid sequence of the heavy chain variable region is shown in SEQ ID NO.7. The amino acid sequence of the second antibody light chain variable region is shown in SEQ ID NO.12, and the amino acid sequence of the heavy chain variable region is shown in SEQ ID NO.17.

[0052] Optionally, the antibody of the present invention further includes a light chain constant region (CL) and a heavy chain constant region (CH), wherein CL and VL constitute the light chain, and CH and VH constitute the heavy chain. The constant regions of the antibody are typically obtained by querying the IMGT online database.

[0053] Optionally, the amino acid sequence of the first antibody light chain (FL) is shown in SEQ ID NO.1, and the amino acid sequence of the heavy chain (FH) is shown in SEQ ID NO.6. The amino acid sequence of the second antibody light chain (FL) is shown in SEQ ID NO.11, and the amino acid sequence of the heavy chain (FH) is shown in SEQ ID NO.16.

[0054] It should be noted that the antibody of the present invention can be a full-length antibody (having a typical Y-shaped molecular structure) or the antigen-binding region of the full-length antibody; the antigen-binding region refers to a polypeptide that substantially retains the same biological function or activity as the full-length antibody. Specifically, the antigen-binding region includes the CDR region as described above, and more preferably has the variable region as described above, thereby retaining an intact antigen recognition and binding site, capable of binding to the same antigen as the full-length antibody, especially to the same epitope. Optionally, the antigen-binding region is selected from at least one of Fab, F(ab)2, Fab', F(ab')2, Fv, (Fv)2, scFv, and sc(Fv)2. These antigen-binding regions can be obtained using conventional techniques in the art.

[0055] Another embodiment of the present invention provides a nucleic acid molecule, a recombinant vector containing the aforementioned nucleic acid molecule, or a host cell containing the aforementioned nucleic acid molecule, wherein the nucleic acid molecule encodes a first antibody and / or a second antibody as described above.

[0056] Nucleic acid molecules can be in the form of DNA (such as cDNA, genomic DNA, or synthetic DNA) or RNA (such as mRNA or synthetic RNA). DNA can be single-stranded or double-stranded, and can be a coding strand or a non-coding strand. The sequence of a nucleic acid molecule can be derived from the antibody's amino acid sequence using conventional methods such as codon coding rules.

[0057] The full-length sequence of a nucleic acid molecule or its fragments can usually be obtained by PCR amplification, recombination, or artificial synthesis.

[0058] For example, the nucleic acid sequence of the light chain variable region of the first antibody is shown in SEQ ID NO.22 or its complementary sequence, and the nucleic acid sequence of the heavy chain variable region is shown in SEQ ID NO.24 or its complementary sequence. The nucleic acid sequence of the light chain variable region of the second antibody is shown in SEQ ID NO.26 or its complementary sequence, and the nucleic acid sequence of the heavy chain variable region is shown in SEQ ID NO.28 or its complementary sequence.

[0059] For example, the nucleic acid sequence of the first antibody light chain is as shown in SEQ ID NO.21 or its complementary sequence, and the nucleic acid sequence of the heavy chain is as shown in SEQ ID NO.23 or its complementary sequence. The nucleic acid sequence of the second antibody light chain is as shown in SEQ ID NO.25 or its complementary sequence, and the nucleic acid sequence of the heavy chain is as shown in SEQ ID NO.27 or its complementary sequence.

[0060] Those skilled in the art will understand that, due to the degeneracy of the genetic code, nucleic acid molecules other than those in the above examples can also encode the antibodies of the present invention. Therefore, the nucleic acid molecules in the above examples should not be regarded as limiting the scope of protection of the present invention.

[0061] The original vector used to construct the recombinant vector is any vector conventional in the art, as long as it can contain the nucleic acid molecule. Typical vectors include plasmids (such as pBR322, pUC series, pET series, pGEX series, pcDNA series), viral vectors, bacteriophages (such as λgt4λB, λ-Charon, λΔz1, and M13), viscera, and mini-chromosomes. The vector can be a cloning vector (i.e., used to transfer nucleic acid molecules into a host and multiply them in host cells) or an expression vector (i.e., containing the necessary genetic elements to allow the nucleic acid molecule inserted into the vector to be expressed in the host cell). The nucleic acid molecule is inserted into a suitable vector to form a cloning vector or expression vector carrying the nucleic acid molecule. This is a well-known technique in the art.

[0062] The nucleic acid molecules encoding the antibodies FL and FH of this invention can be inserted into two vectors, which can be introduced into the same or different host cells. When the heavy and light chains are expressed in different host cells, each chain can be isolated from the host cell expressing it, and the isolated heavy and light chains can be mixed and incubated under suitable conditions to form antibodies. In other embodiments, the nucleic acid molecules encoding antibodies FL and FH can also be cloned into a single vector, with each nucleic acid sequence ligated downstream of a suitable promoter; for example, each nucleic acid sequence encoding the heavy and light chains can be operatively ligated to different promoters, or the nucleic acid sequences encoding the heavy and light chains can be operatively ligated to a single promoter, such that both the heavy and light chains can be expressed by the same promoter. The choice of expression vector / promoter depends on the type of host cell used to produce the antibodies.

[0063] Recombinant vector transfection or transformation into host cells is performed using conventional techniques. When the host is a prokaryote such as *E. coli*, competent cells capable of absorbing DNA are harvested after the exponential growth phase and treated with CaCl2 or MgCl2; alternatively, methods such as microinjection, electroporation, liposome packaging, or gene gun can be used. When the host is a eukaryote, the following DNA transfection methods can be used: calcium phosphate coprecipitation, microinjection, electroporation, liposome packaging, or gene gun.

[0064] The host cell can be a prokaryotic or eukaryotic cell. Examples of prokaryotic host cells that can be used in this invention include, but are not limited to, *Escherichia coli* (e.g., DH5α, JM109, BL21, W3110), *Bacillus* spp. (e.g., *Bacillus subtilis*, *Bacillus thuringiensis*), *Enterobacterium* strains (e.g., *Salmonella typhimurium*, *Serratia marcescens*), and *Pseudomonas* spp. Eukaryotic host cells that can be used for transformation include, but are not limited to, yeast, insect cells, and animal cells, such as Drosophila S2 or Sf9 cells, mammalian CHO, CHO DG44, CHO-S, COS-7, 293 series cells, HepG2, Huh7, 3T3, RIN, and MDCK. After obtaining host cells transfected or transformed with the recombinant vector described above, they can be cultured under suitable conditions to express antibodies, which can then be isolated to obtain purified antibodies.

[0065] In a typical embodiment, the preparation method of the antibody of the present invention includes: tandemly loading the light chain and heavy chain genes of the antibody with a signal peptide, respectively, onto the expression vector pBR322, co-transfecting human renal epithelial cells (293F), culturing the 293F cells, collecting the cell culture supernatant, and purifying to obtain the target antibody strain. The sequence of the signal peptide is designed according to the host cell, and the present invention does not have any special limitations in this regard. The signal peptide encoding gene is located upstream (5' end) of the antibody gene.

[0066] Another embodiment of the present invention provides an antibody pair against human CD40 protein, which consists of a first antibody and a second antibody as described above.

[0067] The first and second antibodies of this invention bind to different epitopes of the CD40 protein and can be used as paired antibodies. They have good application prospects in the field of constructing double-antibody sandwich immunological detection methods, such as double-antibody sandwich ELISA or double-antibody sandwich immunochromatography.

[0068] Another embodiment of the present invention provides the use of the antibody or antibody pair against human CD40 protein as described above in the preparation of a human CD40 protein detection kit.

[0069] The advantages of the antibody or antibody pair against human CD40 protein in the preparation of human CD40 protein detection kit are the same as those of the antibody or antibody pair against human CD40 protein described above, and will not be repeated here.

[0070] The monoclonal antibody provided by this invention can specifically recognize and bind to human CD40 protein. When used to detect CD40 protein, CD40 protein should be interpreted in the broadest sense, including not only pure CD40 protein, but also mixtures containing CD40 protein or organisms containing CD40 protein such as cells and tissues.

[0071] Based on the same inventive concept described above, embodiments of the present invention also provide a human CD40 protein detection kit, the detection kit comprising the first antibody and / or the second antibody as described above.

[0072] In this invention, the first antibody and the second antibody can be used separately, together, or in pairs. During detection, whether used separately or together, the first antibody and / or the second antibody serve as the primary antibody or capture antibody. The sample to be tested is contacted with the capture antibody, and then the antibody is detected. In some embodiments, the capture antibody can be conjugated (covalently or non-covalently) to a detection label, and qualitative or quantitative detection of CD40 protein is achieved by analyzing the signal changes generated by the detection label; for example, in a direct ELISA system, the analyte is coated onto a solid-phase carrier, and then the labeled antibody of this invention is used to specifically recognize and bind to the solid-phase antigen to achieve detection of CD40 protein. In other embodiments, the primary antibody against human CD40 protein is not labeled, but the detection label is conjugated to a secondary antibody against the capture antibody (as the detection antibody) or other molecules to achieve detection; for example, in an indirect ELISA system, the anti-human CD40 protein antibody of this invention (as the primary antibody) is a rabbit-derived IgG antibody, and the secondary antibody can be an anti-rabbit IgG antibody. Detection is achieved by the signal change generated after the secondary antibody binds to the primary antibody. When used in pairs, one of the two antibodies is used as the primary antibody or capture antibody, and the other is used as the secondary antibody or detection antibody.

[0073] The detection markers used to generate identifiable signal changes include, but are not limited to: biotin, fluorescent dyes (such as acridinium ester, umbelliferone, fluorescein, anthocyanin, fluorescein isothiocyanate (FITC), rhodamine, dichlorotriazineamine fluorescein, dansyl chloride), fluorescent proteins (such as isophycocyanin, phycoerythrin, PerCP and phycocyanin), enzymes (such as alkaline phosphatase, acid phosphatase, β-galactosidase, glucose oxidase, horseradish peroxidase, acetylcholinesterase, avidin), colloidal gold, colored magnetic beads, latex particles, radionuclides, detection antibodies or combinations thereof.

[0074] The detection methods employ conventional immunological techniques, such as enzyme-linked immunosorbent assay (ELISA), enzyme-linked immunospot assay (ELISPOT), immunohistochemistry (IHC), immunofluorescence assay (IF), immunoprecipitation assay (IP), immunochromatography (ICA), Western blotting (WB), and flow cytometry (FC). The detection targets include recombinantly expressed human CD40 protein as well as naturally secreted or expressed human CD40 protein from cells / tissues. Samples include, but are not limited to, serum, plasma, urine, cells or cell culture medium, tissue or tissue homogenate.

[0075] Preferably, the detection kit is a detection kit based on a double antibody sandwich method, such as a double antibody sandwich enzyme-linked immunosorbent assay kit. The detection kit includes a first antibody and a second antibody, wherein the first antibody serves as a capture antibody (or primary antibody), and the second antibody serves as a detection antibody (or secondary antibody) and is conjugated with a detection label.

[0076] In double-antibody sandwich enzyme-linked immunosorbent assay (ELISA) kits, the detection marker is typically biotin. In other types of double-antibody sandwich assay kits, the detection marker can be adapted; for example, in immunochromatographic kits, the detection marker is typically colloidal gold.

[0077] Optionally, the double-antibody sandwich enzyme-linked immunosorbent assay kit further includes a diluent, a blocking solution, a horseradish peroxidase-labeled streptavidin solution, and a 3,3',5,5'-tetramethylbenzidine chromogenic solution.

[0078] The present invention will be further illustrated below with reference to specific embodiments. Experimental methods in the following embodiments that do not specify specific conditions are generally performed under conventional conditions, such as those described in *Molecular Cloning: A Laboratory Manual (Fourth Edition)* published by Cold Spring Harbor Laboratory, or generally under the conditions recommended by the manufacturer.

[0079] Example 1: Screening and preparation of rabbit antibodies against Human CD40 protein

[0080] 1.1 Animal Immunization: The immunogen was a commercially available recombinant Human TNFRSF5 / CD40 protein (from ABclonal, catalog number RP01214, protein sequence see UniProt number: P25942-1). Two New Zealand white rabbits were immunized at 200 μg / rabbit. Before the first immunization, the immunogen was mixed with an equal volume of complete Freund's adjuvant to prepare an emulsion, which was injected subcutaneously at multiple sites on the abdomen and back of the rabbits. Three weeks later, 100 μg of the immunogen was mixed with an equal volume of incomplete Freund's adjuvant to prepare an emulsion, which was also injected subcutaneously at multiple sites on the abdomen and back of the rabbits for two booster immunizations. After the three immunizations, serum was collected, and the titer against Human CD40 was determined by ELISA. Rabbits with high serum titers were given a second booster immunization with 200 μg of the immunogen. Three days later, the animals were sacrificed, and their spleens were harvested.

[0081] 1.2 Isolation of B lymphocytes and sorting of antigen-specific B lymphocytes in the spleen: For relevant methods, please refer to the published patents “Method for efficient isolation of single antigen-specific B lymphocytes from spleen cells (Publication No.: CN110016462A, Publication Date: 2019-07-16)” and “An in vitro culture system for B lymphocytes and its application (Publication No.: CN111518765A, Publication Date: 2020-08-11)”.

[0082] 1.3 Cloning of the gene encoding a monoclonal antibody: The supernatant from cultured B cells was used to identify antigen-specific B lymphocytes using a Human CD40-coated ELISA method. The cells were then collected, lysed, and analyzed using Quick-RNA... TM RNA was extracted using the MicroPrep kit (ZYMO, catalog number R1051) and reverse transcribed into cDNA. Using cDNA as a template, the naturally paired antibody light chain variable region (VL) and heavy chain variable region (VH) were amplified by PCR. The PCR reaction mixture consisted of: 4 μL cDNA, 1 μL forward primer (10 mM), 1 μL reverse primer (10 mM), 12.5 μL 2×Gloria HiFi (ABclonal, catalog number RK20717), and 6.5 μL H2O. The primer sequences (5'-3') for amplifying the VL and VH genes are shown below, where F and R represent the forward and reverse primers, respectively.

[0083] VL-F: tgaattcgagctcggtacccATGGACACGAGGGCCCCCAC (see SEQ ID NO. 29);

[0084] VL-R: cacacacgatggtgactgTTCCAGTTGCCACCTGATCAG (see SEQ ID NO. 30);

[0085] VH-F: tgaattcgagctcggtacccATGGAGACTGGGCTGCGCTG (see SEQ ID NO. 31);

[0086] VH-R: gtagcctttgaccaggcagcCCAGGGTCACCGTGGAGCTG (see SEQ ID NO. 32).

[0087] The amplified products were sequenced to obtain the antibody variable region and its encoding gene sequence. The sequencing work was commissioned to Kinkai Biotechnology Co., Ltd. The heavy chain constant region (CH) was obtained by searching the rabbit-derived IgG gamma Creign database (www.imgt.org), and the light chain constant region (CL) was obtained by searching the rabbit-derived IgG Kappa C reign, thus obtaining the complete antibody gene and protein sequences.

[0088] 1.4. Large-scale production of monoclonal antibodies: The obtained antibody heavy chain and light chain genes were loaded into the expression vector pBR322, respectively. In this example, the light chain CL and heavy chain CH genes were pre-inserted into pBR322, and the resulting vector map is shown below. Figure 1In this model, pBR322 origin and f1 origin are replication promoters, Ampcillin is the resistance gene, CMV promoter is the transcription promoter, SV40 PAterminator is the tailing signal, the Light chain constant is the CL sequence (left figure), and the Heavy chain constant is the CH sequence (right figure). The amplified VL and VH genes were then ligated to the pBR322 expression vector carrying the CL and CH genes, linearized with XbaI and NheI restriction endonucleases respectively, via homologous recombination to obtain the FL and FH gene expression vectors. Sequencing confirmed the successful vector construction.

[0089] To facilitate antibody purification, a signal peptide is added upstream of VL and VH to achieve secretory expression of the antibody. Commonly used antibody expression signal peptides in the field can be used, such as those in the patents "Rabbit Monoclonal Antibody against Human Interferon α2 and its Application (Publication No.: CN116063487A, Publication Date: 2023-05-05)" and "High Affinity Human IL-5 Rabbit Monoclonal Antibody and its Application (Publication No.: CN115819578A, Publication Date: 2023-03-21)". The upstream of VL contains the signal peptide "MDTRAPTQLLGLLLLWLPGATF" (in this embodiment, the encoded gene is atggacacgagggcccccactcagctgct). "gggactcctccttctgtggttacccggggcgaccttc)" or MDTRAPTQLLGLLLLWLPGARC (in this embodiment, the encoding gene is atggacacgagggcccccactcagctgctgggactgttactcctttggctgcccggggcccgctgt), with a signal peptide "METGLRWLLLVAVLKGVQC" (in this embodiment, the encoding gene is atggagactgggctgcgctggcttctcctggtgg cagtgcttaaaggcgtccagtgt or atggagactgggctgcgctggcttctcctggtcgccgtactgaaaggcgttcagtgc)" upstream of VH. Of course, those skilled in the art can replace the signal peptide with other ones after obtaining the antibody sequence of this invention. Therefore, the signal peptide sequence is not shown in the antibody sequences in Tables 1-2 below in this embodiment.

[0090] The successfully constructed expression vectors containing FL and FH genes were co-transfected into 293F cells. After transfection, the cells were cultured for 72-96 hours, and the culture supernatant was collected. The recombinant rabbit antibodies that recognize Human CD40 were purified from the culture supernatant using protein A affinity gel resin (purchased from Tiandi Renhe, catalog number SA023100), and named 1E4 and 3F9.

[0091] The amino acid (AA) and nucleotide (DNA) sequences of monoclonal antibodies 1E4 and 3F9 are shown in Table 1-2. For ease of description, the light chain CDR1-3 are denoted as LCDR1-3, and the heavy chain CDR1-3 are denoted as HCDR1-3.

[0092] Table 1. Sequence information of monoclonal antibody 1E4 in this embodiment.

[0093]

[0094] Table 2. Sequence information of monoclonal antibody 3F9 in this embodiment.

[0095]

[0096]

[0097] Example 2: Performance testing of antibodies 1E4 and 3F9 against Human CD40 protein

[0098] Antigen-antibody binding curves were determined using the Gator Prime biomolecular interaction analyzer from Probe Life to identify antibody affinity and antigen recognition epitopes. The probes used to immobilize the antigen or antibody were HFC probes (Anti-HumanIgG Fc(HFC)Probes, purchased from Gator Bio, catalog number 160003).

[0099] 2.1 Affinity Test: The primary antibody (1E4) and secondary antibody (3F9) were immobilized on the HFC probe at a concentration of 3 μg / mL. Then, recombinant Human CD40 at concentrations of 36.93 nM and 33.53 M were used to bind to the primary and secondary antibodies, respectively, to obtain affinity curves. The affinity curves of antibody 1E4 (top) and 3F9 (bottom) binding to CD40 are shown below. Figure 2 As shown in the figure, the vertical axis represents the change in the thickness of the conjugate after the probe binds to the antibody and protein, and the horizontal axis represents the binding time. The dark gray curve is the real-time binding numerical curve, and the light gray curve is the fitted average curve. The affinity constant obtained through curve fitting and calculation is shown in Table 3, and the dissociation coefficient K... off A constant characterizing the rate of antibody-antigen dissociation, the binding coefficient K. onThe affinity constant K is a constant characterizing the rate at which an antibody binds to its target. D For K off / K on The ratio of to represents the dissociation equilibrium constant between the antibody and the antigen.

[0100] Table 3. Affinity parameter determination results for monoclonal antibodies 1E4 and 3F9.

[0101] Antibody <![CDATA[K off (1 / s)]]> <![CDATA[K on (1 / Ms)]]> <![CDATA[K D (M)]]> 1E4 <![CDATA[2.33×10 -4 ]]> <![CDATA[1.45×10 6 ]]> <![CDATA[1.61×10 -10 ]]> 3F9 <![CDATA[3.01×10 -4 ]]> <![CDATA[1.42×10 6 ]]> <![CDATA[2.12×10 -10 ]]>

[0102] From Table 3, Figure 2 It can be seen that the affinity constant K for antibodies 1E4 and 3F9 against human CD40 protein is... D The values ​​were 0.161 nM and 0.212 nM, respectively, indicating a high affinity for human CD40.

[0103] 2.2 Identification of antigen recognition epitopes: Human CD40 protein was immobilized on an HFC probe at a concentration of 3 μg / mL. The probe with immobilized antigen was placed in a 3 μg / mL antibody 1E4 (primary antibody) solution to allow antibody 1E4 to bind to CD40 protein. Then, the probe was placed in a 3 μg / mL antibody 3F9 (secondary antibody) solution to allow antibody 3F9 to bind to CD40 protein. The epitope recognized was determined by analyzing the signal changes after the antibody binds to the antigen.

[0104] The antigenic determinant recognition results for the two antibodies are shown in the figure. Figure 3 The graph shows the change in the thickness of the conjugate after the probe binds to the antibody and CD40 protein, with the vertical axis representing the binding time between the antibody and CD40 protein. It is evident that after binding to antibody 1E4, the CD40 protein can also bind to antibody 3F9, with the shift value further increasing, indicating that the two antibodies recognize different antigenic epitopes.

[0105] Example 3: Establishment of a double-antibody sandwich enzyme-linked immunosorbent assay (ELISA) system based on antibodies 1E4 and 3F9 and its sensitivity analysis.

[0106] Biotin labeling of antibody 3F9: The detection antibody and biotin (Uelandy, B5064) were mixed at a mass ratio of 10:1 and reacted at 4°C for 16-20 hours to obtain biotin-labeled antibody 3F9 (3F9-biotin).

[0107] A double-antibody sandwich enzyme-linked immunosorbent assay (ELISA) detection system was established using antibody 1E4 as the capture antibody and antibody 3F9-biotin as the detection antibody. The steps are as follows: 1) Coating with capture antibody 1E4: Prepare a 2 μg / mL antibody 1E4 solution with 1×PBS and add 100 μL / well to a 96-well microplate. Incubate at 4℃ for 16-20 h; 2) Washing: After incubation, discard the liquid in the wells, wash once with 300 μL of 1×PBST, let stand for 40 s, and then discard the liquid in the wells; 3) Blocking: Add 200 μL / well of E013 blocking buffer (1×PBS containing 2% BSA, 5% sucrose, 0.05% Tween 20 and 0.1% Proclin 300, pH 7.2) to the wells and block at 37℃ for 2 h. After blocking, discard the blocking buffer and dry in a 37℃ oven for 0.5-2 h; 4) Adding antigen protein: Add Human... CD40 protein (from ABclonal, catalog number RP01214) was serially diluted with E003 dilution buffer (1×PBS containing 2% BSA, 0.05% Tween 20, and 0.1% Proclin 300, pH 7.2) to concentrations of 1000, 500, 250, 125, 62.5, 31.25, 15.625, and 0 pg / mL, 100 μL / well of each buffer was added to a well of a plate and incubated at 37°C for 2 h. Simultaneously, the protein solution was replaced with E003 dilution buffer as a blank control. 5) Wash the plate: same as step 2). 6) Add the detection antibody 3F9-biotin: 0.0125 μg / mL of antibody 3F9-biotin solution was added to 100 μL / well of the plate and incubated at 37°C for 1 h. 7) Wash the plate: same as step 2). 8) Add SA-HRP: 100× horseradish permeate solution was added to the plate. 9) Wash the plate: Same as step 2) 10) Add 100 μL of oxidase-labeled streptavidin solution (SA-HRP, purchased from Wuhan Sanying, catalog number SA00001-0) concentrate to each well and incubate at 37℃ for 0.5 h; 10) Add chromogenic solution: Add 100 μL of 3,3',5,5'-tetramethylbenzidine (TMB) chromogenic solution (purchased from Sizhengbai, catalog number 4ATMB1000) to each well and incubate at 37℃ for 15 min; 11) Read the values: After incubation, remove the microplate, add 50 μL of stop solution (1 mol / L hydrochloric acid) to each well, and immediately read the values ​​using a microplate reader.

[0108] A standard curve was constructed by plotting Human CD40 protein concentration on the x-axis and absorbance value (OD450nm) on the y-axis. (See attached graph). Figure 4 As can be seen, the double-antibody sandwich antibody pair composed of antibodies 1E4 and 3F9 of the present invention exhibits a good linear relationship between CD40 protein concentration and detection signal when detecting CD40 protein. It has the advantages of wide linear range, good reliability, and high sensitivity, and the detection limit can be as low as 1.84 pg / mL (see Table 4).

[0109] Table 4 shows the sensitivity of the double-antibody sandwich enzyme-linked immunosorbent assay based on antibodies 1E4 and 3F9.

[0110]

[0111]

[0112] Example 4: Specificity testing of a double-antibody sandwich enzyme-linked immunosorbent assay system based on antibodies 1E4 and 3F9.

[0113] The specificity of antibodies 1E4 and 3F9 was detected using multiple proteins similar to Human CD40. Cross-reactivity was performed using the double-antibody sandwich enzyme-linked immunosorbent assay method described in Example 3. The cross-reactivity test proteins were Human sCD40L (from Abclonal, catalog number RK00053) and Human TNFR1 (from Abclonal, catalog number RK04665), and the detection concentration of each standard protein was 20 ng / mL.

[0114] The results are as follows Figure 5 As shown in the figure, Positive Control represents Human CD40 protein, Blank represents blank control, and H. represents Human. It can be seen that antibodies 1E4 and 3F9 have a high specific binding ability to Human CD40 and do not cross-react with other proteins.

[0115] Example 5: Thermal stability test of a double-antibody sandwich enzyme-linked immunosorbent assay system based on antibodies 1E4 and 3F9.

[0116] The ELISA plate coated with capture antibody 1E4, lyophilized Human CD40 protein, and 100× concentrated detection antibody 3F9-biotin were sealed and stored at 37°C for heat destruction. After 7 days, the plate was removed and detected using the double-antibody sandwich ELISA method described in Example 3, with the plate stored at -20°C serving as a baseline control. The coefficients of variation of the standard curves established under different treatment conditions were compared to analyze the thermal stability of the detection system.

[0117] The results are shown in Table 5 and Figure 6As can be seen, the coefficients of variation (CVs) of the rabbit monoclonal antibodies 1E4 and 3F9, which were treated at -20℃ and 37℃ respectively, for detecting Human CD40 protein concentration were less than 15%. Specifically, the CV of the protein after 7 days of destruction at 37℃ compared with the control group was 3.34%, the CV of the detection antibody after 7 days of destruction at 37℃ compared with the control group was 5.79%, the CV of the ELISA plate coated with the capture antibody after 7 days of destruction at 37℃ compared with the control group was 8.14%, and the CV of the completely destroyed group after 7 days of destruction at 37℃ compared with the control group was 10.25%. This shows that the antibodies of the present invention have good thermostability.

[0118] Table 5. Stability of the double-antibody sandwich enzyme-linked immunosorbent assay (ELISA) based on antibodies 1E4 and 3F9

[0119]

[0120] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. An antibody against human CD40 protein, characterized in that, It is either a primary antibody or a secondary antibody, wherein: The amino acid sequences of CDR1, CDR2 and CDR3 on the light chain variable region of the first antibody are shown in SEQ ID NO.3-5, and the amino acid sequences of CDR1, CDR2 and CDR3 on the heavy chain variable region are shown in SEQ ID NO.8-10, respectively. The amino acid sequences of CDR1, CDR2 and CDR3 on the light chain variable region of the second antibody are shown in SEQ ID NO.13-15, and the amino acid sequences of CDR1, CDR2 and CDR3 on the heavy chain variable region are shown in SEQ ID NO.18-20, respectively.

2. The antibody against human CD40 protein according to claim 1, characterized in that, The amino acid sequence of the light chain variable region of the first antibody is shown in SEQ ID NO.2, and the amino acid sequence of the heavy chain variable region is shown in SEQ ID NO.7; The amino acid sequence of the light chain variable region of the second antibody is shown in SEQ ID NO.12, and the amino acid sequence of the heavy chain variable region is shown in SEQ ID NO.

17.

3. The antibody against human CD40 protein according to claim 1, characterized in that, The amino acid sequence of the light chain of the first antibody is shown in SEQ ID NO.1, and the amino acid sequence of the heavy chain is shown in SEQ ID NO.6; The amino acid sequence of the light chain of the second antibody is shown in SEQ ID NO.11, and the amino acid sequence of the heavy chain is shown in SEQ ID NO.

16.

4. The antibody against human CD40 protein according to claim 1, characterized in that, The first antibody or the second antibody is a full-length antibody or the antigen-binding region of the full-length antibody; The antigen-binding region is selected from at least one of the following fragments: Fab fragment, F(ab)2 fragment, Fv fragment, (Fv)2 fragment, scFv fragment, and sc(Fv)2 fragment.

5. A nucleic acid molecule or recombinant vector, characterized in that, The recombinant vector contains the nucleic acid molecule, which encodes the first antibody or the second antibody as described in any one of claims 1-4.

6. The nucleic acid molecule or recombinant vector according to claim 5, characterized in that, The nucleic acid sequence of the light chain variable region of the first antibody is as shown in SEQ ID NO.22 or a complementary sequence thereto, and the nucleic acid sequence of the heavy chain variable region is as shown in SEQ ID NO.24 or a complementary sequence thereto. The nucleic acid sequence of the light chain variable region of the second antibody is shown in SEQ ID NO.26 or is complementary to it, and the nucleic acid sequence of the heavy chain variable region is shown in SEQ ID NO.28 or is complementary to it.

7. The nucleic acid molecule or recombinant vector according to claim 6, characterized in that, The nucleic acid sequence of the light chain of the first antibody is as shown in SEQ ID NO.21 or a complementary sequence thereto, and the nucleic acid sequence of the heavy chain is as shown in SEQ ID NO.23 or a complementary sequence thereto. The nucleic acid sequence of the light chain of the second antibody is as shown in SEQ ID NO.25 or a complementary sequence thereto, and the nucleic acid sequence of the heavy chain is as shown in SEQ ID NO.27 or a complementary sequence thereto.

8. An antibody pair against human CD40 protein, characterized in that, It consists of the first antibody and the second antibody as described in any one of claims 1-4.

9. A human CD40 protein detection kit, characterized in that, The detection kit includes an antibody against human CD40 protein as described in any one of claims 1-4 or an antibody pair against human CD40 protein as described in claim 8.

10. The human CD40 protein detection kit according to claim 9, characterized in that, The detection kit is a double-antibody sandwich method detection kit, comprising a first antibody and a second antibody; The first antibody is a capture antibody, and the second antibody is a detection antibody, with a detection marker conjugated to the second antibody.

Images