Saline-alkali-resistant soil conditioner and application
By using a compound microbial agent and carrier formulation composed of Staphylococcus xylitol and Aspergillus niger, the problems of pH and electrical conductivity in saline-alkali soil improvement were solved, crop growth and yield were improved, and soil quality was improved.
Patent Information
- Application Number
- CN202510961648.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-07-11
- Publication Date
- 2025-10-28
AI Technical Summary
Existing technologies are insufficient to effectively improve the pH and electrical conductivity of saline-alkali soils, and are also insufficient to improve crop growth and yield on saline-alkali lands.
A compound microbial agent composed of Staphylococcus xylosus JNKB3 and Aspergillus niger JNKYF1, combined with amino acids and bone meal, is loaded onto carriers such as humic acid, superphosphate, and diatomaceous earth to form a carrier preparation, which is then applied to saline-alkali soils to improve soil structure and promote crop growth.
It significantly reduces the pH and electrical conductivity of saline-alkali soils, increases soil organic matter and total nitrogen content, promotes crop biomass, and increases crop yield and quality.
Smart Images

Figure CN120843335A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of agricultural planting technology, specifically relating to a soil conditioner resistant to salinity and alkali and its application. Background Technology
[0002] Soil conditioners are materials added to soil to improve its physical, chemical, and biological properties. Their functions include improving soil structure, reducing soil salinity and alkalinity, regulating soil pH, improving soil moisture, and remediating contaminated soil. Soil conditioners can be categorized by function into soil structure improvers, soil pH regulators, soil water retention agents, saline-alkali soil conditioners, and contaminated soil remediation agents. They can also be categorized by raw material source or main components into natural minerals, solid wastes, synthetic materials, natural-synthetic copolymers, and biological agents.
[0003] There are numerous reports on soil conditioners. Studies have shown that peat can improve saline-alkali soils, reducing soil pH and alkalinity, and significantly desalinizing the topsoil. Soil conditioners made from biochemical humic acid have been used to improve saline-alkali land, resulting in significant improvements in soil pH and physical properties. Soil conditioners also have excellent water retention capabilities. Solid waste soil conditioners such as legume green manure, livestock manure, and crop straw can enhance soil water holding capacity, promote the formation of soil aggregates, and reduce soil bulk density.
[0004] With the development of science and technology, applying soil conditioners is an economical, convenient, and quick method for soil improvement. Microbial preparations represent a promising direction in the development of soil conditioners. Nitrogen-fixing bacteria, silicate bacteria, photosynthetic bacteria, and phosphate-solubilizing bacteria are commonly used functional bacteria in saline-alkali soils. Microbial preparations can improve soil physicochemical properties, enhance soil fertility, increase fertilizer utilization, and strengthen crop resistance. Studies show that microorganisms isolated from saline-alkali habitats perform better than those isolated from non-halotropic habitats in improving plant salt tolerance. Therefore, understanding and developing the microbial resources in the root soils of halophytes growing in natural saline-alkali environments is crucial for improving the efficiency of ecological restoration of saline-alkali soils. Summary of the Invention
[0005] This invention provides a saline-alkali resistant soil conditioner and its application. The soil conditioner can significantly improve soil nutrient status and promote crop vegetative and reproductive growth, while reducing indicators such as pH and electrical conductivity associated with saline-alkali land.
[0006] This invention provides a compound microbial agent with salt and alkali resistance, comprising Staphylococcus xylitol and Aspergillus niger.
[0007] In a preferred embodiment of the present invention, the Staphylococcus xylosus includes Staphylococcus xylosus JNKB3, with accession number CGMCC No. 33969;
[0008] The Aspergillus niger mentioned includes Aspergillus niger JNKYF1, with accession number CGMCCNo.41601.
[0009] In a preferred embodiment of the present invention, the volume ratio of the Staphylococcus xylose suspension to the Aspergillus niger suspension is 1:1.
[0010] The Staphylococcus xylosus bacterial suspension contains 1×10 8 bacteria / mL;
[0011] The Aspergillus niger suspension contains 1×10 6 bacteria / mL.
[0012] The present invention also provides a microbial agent, comprising the above-mentioned compound microbial agent, amino acids and bone meal.
[0013] In a preferred embodiment of the present invention, the volume ratio of the compound microbial agent, amino acids and bone meal is 90:5:5.
[0014] The present invention also provides a carrier formulation formed by loading the above-mentioned microbial agent onto a carrier.
[0015] In a preferred embodiment of the present invention, the carrier includes at least one of the following: humic acid, superphosphate, diatomaceous earth, and organic fertilizer.
[0016] In a preferred embodiment of the present invention, the volume ratio of the microbial agent to the carrier is (5-10):(90-95).
[0017] The present invention also provides the application of the above-mentioned compound microbial agent, the above-mentioned microbial agent or the above-mentioned carrier preparation in soil improvement.
[0018] The present invention also provides the application of the above-mentioned compound microbial agent, the above-mentioned microbial agent, or the above-mentioned carrier preparation in improving crop yield and quality.
[0019] Beneficial Effects: This invention provides a compound microbial agent mainly composed of Staphylococcus xylose and Aspergillus niger. Both strains have acid-producing capabilities. After 24 hours of cultivation, JNKB3 can lower the pH of Gibbson liquid medium (pH 12) to 9.92, and JNKYF13 can lower the pH of PDB medium (pH 12) to 6.09. Adding this compound microbial agent to saline-alkali soil can significantly reduce soil pH and EC, and promote crop growth and development.
[0020] This invention utilizes the aforementioned compound microbial agent combined with other components to prepare a microbial preparation, and then uses a carrier to load the microbial preparation to prepare a carrier preparation. Applying the carrier preparation prepared according to this invention to saline-alkali soil can significantly increase the biomass of crops grown on saline-alkali land, and improve yield and quality. Soil surveys conducted after crop harvest revealed a significant increase in soil organic matter and total nitrogen content, and a decrease in soil pH and total salt content.
[0021] Biological Preservation Information:
[0022] Staphylococcus xylosus JNKB3 was deposited on March 25, 2025, at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, with accession number CGMCC No. 33969.
[0023] Aspergillus niger JNKYF1 was deposited on October 30, 2024, at the China General Microbiological Culture Collection Center (CGMCC), Institute of Microbiology, Chinese Academy of Sciences, No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing, with accession number CGMCC No. 41601. Attached Figure Description
[0024] Figure 1 This is a graph showing the change in pH value of the culture medium after 24 hours of cultivation for JNKB3.
[0025] Figure 2 This is a graph showing the change in pH value of the culture medium after 24 hours of cultivation of JNKYF1.
[0026] Figure 3 The antagonistic effect of strains JNKB3 and JNKYF1 is shown in the figure.
[0027] Figure 4 The results show the effects of different microbial agents on pH (a) and EC value (b) of saline-alkali soil;
[0028] Figure 5 A graph showing the differences in plant height and tiller number among different conditioner formulations as of July 5, 2024.
[0029] Figure 6 The graph shows the differences in plant height and tiller number among different conditioner formulations as of July 19, 2024. Detailed Implementation
[0030] This invention provides a compound microbial agent with salt and alkali resistance, comprising Staphylococcus xylitol and Aspergillus niger.
[0031] The *Staphylococcus xylosus* strain described in this invention includes *Staphylococcus xylosus* JNKB3, with accession number CGMCC No. 33969. The JNKB3 strain can grow on a medium with pH 12 and a NaCl concentration of 200 g / L, and it exhibits acid-producing ability; after 24 hours of cultivation, JNKB3 can lower the pH of Gibbson liquid medium (pH 12) to 9.92.
[0032] The Aspergillus niger strain described in this invention includes Aspergillus niger JNKYF1, with accession number CGMCCNo.41601. JNKYF1 can grow on a medium with pH 12 and a salt concentration of NaCl 200 g / L. Furthermore, the strain JNKYF1 has acid-producing ability; after 24 h of cultivation, JNKYF1 can lower the pH of the PDB medium with pH 12 to 6.09.
[0033] In one embodiment, the compound bacterial agent of the present invention is a mixed bacterial suspension. The method for preparing the JNKB3 bacterial suspension includes selecting a single colony of JNKB3, inoculating it onto LB medium, culturing it at 28°C and 180 r / min for 3 days, and preparing the strain into 10... 8 The bacterial suspension of JNKYF1 was prepared by inoculating a single colony of JNKYF1 into PDB medium, culturing at 28°C and 180 r / min for 3 days, and then preparing the strain into 10⁶ cells / mL. 6 The prepared JNKB3 bacterial suspension and JNKYF1 bacterial suspension were combined at a volume ratio of 1:1 to form the composite bacterial agent JNRSA.
[0034] In one embodiment of the present invention, the compound microbial agent JNRSA was added to saline-alkali soil. After culturing for 30 days, the pH value and EC of the soil were measured. The experimental results showed that, compared with the control, the compound microbial agent JNRSA reduced the soil pH value by 0.17 units and the EC value by 17.48%. At the same time, the application of the compound microbial agent JNRSA to saline-alkali soil and the cultivation of rice showed a significant promoting effect on the plant height, root length, fresh weight and dry weight of rice.
[0035] The present invention also provides a microbial agent, comprising the above-mentioned compound microbial agent, amino acids and bone meal.
[0036] The amino acids described in this invention are raw amino acid powders, which can be purchased from the market or online shopping platforms such as Taobao; the bone meal is also a commercially available product. The amino acids and bone meal described in this invention can provide active nutrients for microorganisms, which is beneficial for the colonization, survival, and function of the microbial agent in the environment.
[0037] In a preferred embodiment of the present invention, the volume ratio of the compound microbial agent, amino acids and bone meal is 90:5:5.
[0038] The present invention also provides a carrier formulation formed by loading the above-mentioned microbial agent onto a carrier.
[0039] The carrier of the present invention includes at least one of the following: humic acid, superphosphate, diatomaceous earth and organic fertilizer, wherein the volume ratio of the microbial agent to the carrier is (5-10):(90-95), such as 5:95, 6:94, 7:93, 8:92, 9:91 or 10:90.
[0040] The present invention does not specifically limit the preparation method of the carrier formulation; the carrier and the microbial agent can be mixed and stirred.
[0041] The present invention also provides the application of the above-mentioned compound microbial agent, the above-mentioned microbial agent or the above-mentioned carrier preparation in soil improvement.
[0042] The soil improvement method described in this invention includes reducing the pH and EC values of saline-alkali soils and increasing the organic matter content and total nitrogen content.
[0043] The present invention also provides the application of the above-mentioned compound microbial agent, the above-mentioned microbial agent, or the above-mentioned carrier preparation in improving crop yield and quality.
[0044] The compound microbial agent, microbial agent, or carrier preparation described in this invention can significantly increase the biomass of crops in saline-alkali soils, such as increasing the plant height and tiller number of rice, and improving the yield and quality of rice.
[0045] To further illustrate the present invention, the following detailed description, in conjunction with embodiments, of a saline-alkali resistant soil conditioner and its application, should not be construed as limiting the scope of protection of the present invention.
[0046] Example 1: Salt- and alkali-resistant functional bacterial strain (JNRSA) and its preparation method
[0047] (1) Isolation, screening and identification of strains
[0048] Weigh 10g of saline-alkali soil sample and add it to 90mL of sterile water. Shake on a shaker at 180r / min for 30min. Perform serial dilution with sterile water and take 10g of each sample. -5 , 10 -6 , 10 -7 Dilute 0.1 mL and spread it on a Gibbon modified medium plate. Take 10... -1 , 10 -2 , 10 -3Dilute 0.1 mL and spread it on PDA selective medium. All were incubated in a 37°C incubator. After colonies grew, colonies with obvious morphological differences were picked and isolated and purified by repeated streak plating. The obtained strains were stored in a -80°C refrigerator.
[0049] The isolated and purified bacteria were streaked onto Gibbon modified medium plates with varying salt (NaCl concentrations of 100, 125, 150, and 200 g / L) or alkalinity (pH values of 9, 10, 11, and 12). The fungi were inoculated onto PDA selective medium plates with varying salt or alkalinity. The plates were incubated at 37°C for 5 days. The survival of the strains was used as the standard for judging their tolerance to the corresponding salt and alkalinity. Finally, the strains with high salt tolerance and high alkali tolerance were placed in Gibbon modified medium (bacteria) and PDA selective medium (fungi) with simultaneously increased salt concentration and pH. Bacteria JNKB3 and fungus JNKYF1 with strong salt and alkali tolerance were screened out. Both strains could grow on medium with pH 12 and a salt concentration of 200 g / L NaCl.
[0050] Identification was performed using molecular sequencing (bacterial amplification primers 16S-27Fnew and 1541Rnew; fungal primers ITS1 and ITS4). The obtained sequences were then BLAST-aligned in GenBank. JNKB1, JNKB3, JNKB7, and JNKB8 were identified as Thalassobacillus sp., Staphylococcus xylosus, Bacillus subtilis, and Halobacillus sp., respectively. JNKYF1, JNKYF5, JNKYF6, and JNKYF12 were identified as Aspergillus niger, Penicillium griseofulvum, Aspergillus terreus, and Penicillium halotolerans, respectively. The acid-producing capacity test of the strain showed that after 24 hours of cultivation, JNKB3 could lower the pH of Gibbson liquid medium (pH 12) to 9.92. Figure 1 JNKYF1 is more effective than other bacteria. It can lower the pH of PDB medium from pH 12 to 6.09. Figure 2 It is more effective than other fungi.
[0051] 16S-27F-new (SEQ ID No. 1): AGAGTTTGATCCTGGCTCAG;
[0052] 1541R-new(SEQ ID No.2):AAGGAGGTGATCCAGCCGCA;
[0053] ITS1 (SEQ ID No. 3):TCCGTAGGTGAACCTGCGG;
[0054] ITS4 (SEQ ID No. 4):TCCTCCGCTTATTGATATGC.
[0055] JNKB3 and JNKYF1 have been deposited. JNKB3 is deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 33969. JNKYF1 is deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 41601.
[0056] (2) Construction of salt-alkali resistant functional bacterial strain (JNRSA)
[0057] An antagonistic growth test was conducted on strains JNKB3 and JNKYF1. Strands were plotted on a combined LB and PDA solid medium and incubated upside down for 3 days. If the growth of both strains was weak or absent at the crossover point, it indicated an antagonistic relationship between the two bacteria; if both strains grew well at the crossover point, it indicated no antagonistic relationship. The results are as follows: Figure 3 As shown, strains JNKB3 and JNKYF1 do not have antagonistic effects and can be combined.
[0058] The soil for the pot experiment was sourced from severely saline-alkali soil (pH = 9.4, electrical conductivity 0.75 mS / cm) in Da'an City, Jilin Province. Four groups of experiments were set up.
[0059] ① No bacterial agent added (CK);
[0060] ② Add bacterial agent JNKB3(B), take the solid bacterial culture JNKB3 preserved on the slant and inoculate it into 50ml of sterile LB medium, incubate at 28℃ and 180r / min for 3 days, and prepare the strain into 10 8 CFU / mL of bacterial culture;
[0061] ③ Add bacterial agent JNKYF1(F), take the solid bacterial culture JNKYF1 preserved on the slant and inoculate it into 50ml of sterile PDB medium, incubate at 28℃ and 180r / min for 3 days, and prepare the strain into 10 6 CFU / mL of bacterial culture;
[0062] ④ Add the compound bacterial strain JNRSA(BF), which is a combination of prepared JNKB3 and JNKYF1 bacterial solutions in a volume ratio of 1:1.
[0063] One kilogram of saline-alkali soil was placed in a container, and 5 mL of inoculant was added to each container. After 30 days of cultivation, the pH and EC values of the saline-alkali soil decreased after the addition of the inoculant. Figure 4 The pH values of bacteria with added B, F, and BF decreased by 0.06, 0.08, and 0.17 units respectively compared to the control (CK), and all differences were statistically significant. Figure 4 (a) The EC value of the bacterial agent B was 7.15% lower than that of the control (CK), but the difference was not significant; the EC values of the bacterial agents F and BF were 9.40% and 17.48% lower than those of the control (CK), respectively, and the differences were significant. Figure 4 (b) The addition of compound microbial agent BF had the most significant effect on reducing soil pH and EC values.
[0064] The effects of adding microbial agents B, F, and BF on plant height, root length, fresh weight, and dry weight of rice were statistically analyzed. The results are shown in Table 1. All microbial agents had a promoting effect. Compared with the control (CK), the plant height increased by 7.14% and 10.71% after adding microbial agents B and F, respectively, with no significant difference; the plant height increased by 26.79% after adding microbial agent BF, with a significant difference. Compared with the CK, the root length increased by 2.63%, 23.68%, and 26.32% after adding microbial agents B, F, and BF, respectively, with no significant difference. Compared with the CK, the fresh weight increased by 7.69%, 25.64%, and 46.15% after adding microbial agents B, F, and BF, respectively, with significant differences. Compared with the CK, the dry weight increased by 7.69% after adding microbial agents B and F, with no significant difference; the dry weight increased by 23.08% after adding microbial agent BF, with a significant difference.
[0065] Table 1 Effects of microbial inoculants on rice plant growth
[0066] deal with Plant height (cm) Root length (cm) Fresh weight (g) Dry weight (g) CK 5.6±0.6B 3.8±0.6A 0.039±0.001D 0.013±0.001B B 6.0±0.7AB 3.9±0.4A 0.042±0.001C 0.014±0.002AB F 6.2±0.9AB 4.7±0.4A 0.049±0.001B 0.014±0.001AB BF 7.1±0.5A 4.8±0.7A 0.057±0.003A 0.016±0.001A
[0067] Example 2
[0068] 1. Description of experimental materials:
[0069] (1) Functional bacterial fermentation broth: Solid bacterial strains JNKB3 and JNKYF1 preserved on slant agar were inoculated into 50 ml of sterile LB medium and PDB medium, respectively, and cultured at 28℃ and 180 r / min for 3 days. Single strains were then prepared into 10... 8 CFU / mL (bacteria) or 10 6 A bacterial suspension of 1 fungus per mL, mixed at a volume ratio of 1:1, is the functional bacterial fermentation broth—a salt- and alkali-resistant functional bacterial strain (JNRSA).
[0070] (2) Composition and proportion of microbial preparation: 90% functional strain (JNRSA) fermentation broth + 5% amino acid raw powder + 5% bone meal;
[0071] (3) Carrier formulations and codes: The microbial preparations were adsorbed onto different carriers and combinations thereof, such as humic acid, diatomaceous earth, organic fertilizer, sodium citrate, desulfurized gypsum, and superphosphate. Nine different carrier formulations were set up, and their codes are as follows:
[0072] Formula J: Single-strain type (microbial preparation) (0.5g / kg soil);
[0073] Formula F: Humic acid type I (5.0% microbial preparation + 95% humic acid) (2g / kg soil);
[0074] Formula G: Diatomaceous earth type (5.0% microbial preparation + 95% diatomaceous earth) (2g / kg soil);
[0075] Formula SS: Gypsum type (5.0% microbial preparation + 47.5% sodium citrate + 47.5% desulfurized gypsum) (2g / kg soil);
[0076] Formula P: Superphosphate type (5.0% microbial preparation + 95% superphosphate) (2g / kg)
[0077] Formula M: Organic fertilizer type (5.0% microbial preparation + 95% organic fertilizer) (2g / kg soil);
[0078] Formula FJ: Humic acid type II (7.0% microbial preparation + 93% humic acid) (2g / kg soil);
[0079] Formula FGJ: Humic acid type III (10.0% microbial preparation + 90% humic acid) (2g / kg soil);
[0080] Formula FGJSS: Comprehensive (8% microbial preparation + 23% humic acid + 23% diatomaceous earth + 23% sodium citrate + 23% desulfurized gypsum) (2g / kg soil).
[0081] 2. Experimental Procedure:
[0082] Each treatment consisted of 3 pots, each containing 16 kg of saline-alkali soil (30 cm in diameter and 50 cm in height) and 5 rice seedlings. The experimental materials were added according to the prescribed dosage. The experiment began in May 2024 and ended in October 2024, with soil physicochemical properties and rice yield measured.
[0083] 3. The effects of different conditioner formulations on soil nutrient status
[0084] Soil samples were collected from the topsoil after rice harvest to determine soil organic matter, total nitrogen, pH, and total salt content. The results showed that the soil nutrient content varied greatly depending on the formulation of the conditioner. Compared with the control (CK) treatment, the increase in soil organic matter, from highest to lowest, was as follows: FGJ (7.50%), FJ (6.96%), P (5.36%), G (4.48%), M (4.45%), F (2.92%), and J (0.52%). SS and FJGSS decreased by 0.47% and 6.50% respectively compared with CK. The increase in total nitrogen content was as follows: FGJ (15.69%), FJ (14.72%), F (11.04%), M (9.70%), G (7.83%), P (5.96%), J (4.26%), and SS (2.41%). FJGSS decreased by 4.65%. The effect on soil pH was best with FGJ, reducing it by 0.65 compared to the control (CK). Other treatments, in descending order, were FJ (0.07), P, F, G (0.04), M, and J (0.03). FJGSS and SS increased pH by 0.10 and 0.13 pH values, respectively. The reduction in total soil salinity was best with FGJ (22.95%), FJ (18.24%), M (13.63%), F (10.28%), G (8.9%), J (8.45%), and P (0.5%). SS and FJGSS increased by 5.78% and 6.83% compared to the control (CK), respectively. Overall, the effects of different conditioner formulations on soil organic matter, total nitrogen, pH, and total salt content showed roughly the same trend as their effects on plant biological traits. Formulations FGJ and FJ had the best effect on improving saline-alkali land, while formulations P, G, M, and F also had some improvement effects. However, formulations SS and FJGSS had poor effects and are not recommended for promotion and application as saline-alkali land improvement formulations in production practice.
[0085] Table 2. Differences in soil nutrient content among different conditioner formulations.
[0086]
[0087] 4. Effects of different conditioner formulations on the biological traits of rice plants
[0088] Plant height and tiller number of rice under different treatments were measured on July 5th and July 19th, 2024, respectively. The results measured on July 5th, 2024 are as follows: Figure 5 As shown, different formulations of conditioners have varying effects on promoting rice growth.
[0089] Compared with the control (CK), the effects of formulations FJGSS and SS on rice plant height were reduced by 0.93% and 2.97%, respectively. Other formulations showed higher increases than the CK treatment, with the following increases in the order of: FGJ (17.80%), FJ (11.04%), G (10.40%), F (8.19%), J (8.03%), P (4.08%), and M (2.47%). Different conditioner formulations also showed varying effects on tillering promotion in rice. Formulation SS was similar to the CK, while formulation FJGSS was 2.0% lower than the CK. Other formulations showed higher increases than the CK, with the following increases in the order of: FGJ (18.0%), FJ (14.00%), F (12.0%), G (10.64%), M (9.92%), P (8.48%), and J (8.0%).
[0090] The measurement results on July 19, 2024 are as follows: Figure 6 As shown, different conditioner formulations all significantly promoted rice growth. Except for the FJGSS treatment, the plant height of the other formulations was higher than that of the CK treatment, with the following increases in the order: FGJ (10.14%), FJ (8.39%), G (7.30%), J (6.16%), P (3.78%), M (3.23%), and F (0.84%). SS was the same as CK, while FJGSS decreased by 1.27% compared to CK. Different conditioner formulations also had a certain effect on promoting tillering. Compared with CK, the increase in tiller number was as follows: FGJ (46.30%), FJ (42.0%), G (24.0%), J, P and F (20.37%), and M (16.67%). SS and FJGSS decreased by 1.85% and 3.70%, respectively. Based on a comprehensive evaluation of rice plant height and tiller number, the conditioner formulations with better effects on improving saline-alkali soil are FGJ, FJ, G, J, P and M. Combined with yield indicators, high-quality conditioner formulations for promotion and application in production are further screened.
[0091] 5. Effects of different conditioner formulations on rice yield and yield composition
[0092] After rice harvest, yield and yield composition were measured, and the results are shown in Table 3. Different conditioner formulations had significant effects on rice yield and yield composition. From the yield level analysis, compared with the control (CK) treatment, the order of yield increase from high to low was: FGJ (29.53%), FJ (29.35%), G (28.66%), M (21.91%), J (15.60%), P (4.63%), and F (3.48%). The yields of SS and FJGSS decreased by 11.25% and 38.38% respectively compared with CK. The total dry weight and grain weight showed roughly the same trend. Overall, the effects of different conditioner formulations on soil organic matter, total nitrogen, pH, and total salt content showed roughly the same trend as their effects on plant biology and yield traits. Formulations FGJ and FJ had the best effect on improving saline-alkali land, while formulations G, M, P, F, and J all had some improvement effect. However, the combination of microbial agents and carriers had a more significant effect, while formulations SS and FJGSS had poor effects and are not recommended for promotion and application as saline-alkali land improvement formulations in production practice.
[0093] Table 3. Differences in rice yield and yield composition with different conditioner formulations.
[0094]
[0095] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.
Claims
1. A compound microbial agent with salt-alkali resistance, characterized in that, This includes Staphylococcus xylitol and Aspergillus niger.
2. The compound microbial agent according to claim 1, characterized in that, The Staphylococcus xylosus mentioned includes Staphylococcus xylosus JNKB3, with accession number CGMCC No. 33969; The Aspergillus niger mentioned includes Aspergillus niger JNKYF1, with accession number CGMCCNo.41601.
3. The compound microbial agent according to claim 1 or 2, characterized in that, The volume ratio of the Staphylococcus xylosus suspension to the Aspergillus niger suspension is 1:
1. The Staphylococcus xylosus bacterial suspension contains 1×10 8 bacteria / mL; The Aspergillus niger suspension contains 1×10 6 bacteria / mL.
4. A microbial inoculant, characterized in that, It includes the compound microbial agent, amino acids, and bone meal as described in any one of claims 1 to 3.
5. The microbial agent according to claim 4, characterized in that, The volume ratio of the compound microbial agent, amino acids, and bone meal is 90:5:
5.
6. A carrier formulation formed by loading the microbial agent of claim 4 or 5 onto a carrier.
7. The carrier formulation according to claim 6, characterized in that, The carrier includes at least one of the following: humic acid, superphosphate, diatomaceous earth, and organic fertilizer.
8. The carrier formulation according to claim 6, characterized in that, The volume ratio of the microbial agent to the carrier is (5-10):(90-95).
9. The application of the compound microbial agent according to any one of claims 1 to 3, the microbial agent according to claim 4 or 5, or the carrier preparation according to any one of claims 6 to 8 in soil improvement.
10. The application of the compound microbial agent according to any one of claims 1 to 3, the microbial agent according to claim 4 or 5, or the carrier preparation according to any one of claims 6 to 8 in improving crop yield and quality.