Precise editing method of universal virulent phage genome

Abstract

The invention discloses an accurate editing method of a universal virulent phage genome, and belongs to the technical field of biology. The method comprises the following steps: carrying out homologous recombination on a defective bacteriophage without an essential gene and a genetic gene box for editing a bacteriophage target gene in a host bacterial cell in an electrotransformation or helper plasmid mode to obtain a recombinant bacteriophage; removing essential genes in the recombinant bacteriophage by adopting a gene knockout tool for identifying the cleavage site to obtain a defective recombinant bacteriophage; the method comprises the following steps: recombining a back-complementing genetic gene box and a defective recombinant bacteriophage in a host bacterial cell, back-complementing an essential gene to an original genome position, and recovering a wild genotype phenotype. The method breaks through the bottleneck that the traditional homologous recombination technology is difficult to accurately edit the virulent bacteriophage genome due to lack of an efficient screening mechanism, can successfully implement complex genetic operations such as gene deletion, insertion and site-specific mutagenesis, achieves the recombination accuracy of 100%, and remarkably improves the development efficiency of the engineered bacteriophage.

Description

Technical Field

[0001] This invention relates to a precise method for editing the genome of a general-purpose virulent bacteriophage, belonging to the field of biotechnology. Background Technology

[0002] Bacterial resistance is becoming an increasingly serious problem. Bacteriophages, as viruses that specifically infect bacteria, effectively kill drug-resistant pathogens through their strict lytic life cycle. In recent years, phage therapy has become a prospective treatment strategy against multidrug-resistant infections and has received widespread attention from the academic community. However, wild-type phages face multiple challenges in clinical application, including limited bactericidal efficacy, a narrow host lineage, and potential virulence factor genes in their genome, which severely restrict their therapeutic effects. Therefore, developing highly efficient engineered phages has become an urgent need for phage therapy. However, successfully artificially modifying phages requires a comprehensive understanding of the genetic structure and function of the phage genome, followed by the implementation of precise genome engineering strategies, and even rational de novo design of the phage genome. Achieving these technical goals highly depends on a precise, efficient, and convenient gene editing technology.

[0003] Previous studies have established various phage genome editing technologies, including yeast-based assembly, de novo synthesis, SMART, homologous recombination, BRED, and CRISPR-Cas systems. Despite their methodological diversity, these methods still have limitations in analyzing phage genome structure and functional annotation. While yeast-based assembly and de novo phage genome synthesis can achieve single-base-pair resolution editing, random mutations introduced during synthesis inevitably interfere with the association between genotype and phenotype. SMART achieves high-fidelity gene editing through fragment cloning and in situ plasmid modification of the phage genome, but the toxicity of phage genes to host cells poses a significant challenge to fragment cloning. Homologous recombination and BRED both rely on allele recombination for precise gene editing. Given the low recombination frequency of homologous guided repair mechanisms (10-1), further research is needed. -4 ~10 -8Therefore, effective screening markers are needed for the rapid isolation of recombinant phages. However, virulent phages infect and rapidly lyse host cells, rendering traditional positive selection systems based on antibiotic resistance genes ineffective, resulting in a cumbersome process for isolating recombinant phages. Although CRISPR-Cas systems can be used as reverse selection tools to improve homologous recombination efficiency (~20%), their editing efficiency and precision are hampered by inherent limitations such as low CRISPR-Cas enzyme activity in some microbial hosts, off-target effects, and strict dependence on protospacer neighbor motifs (PAMs). To date, no existing tool integrates high fidelity, high efficiency, and ease of operation to meet the demands of rigorous phage genotype-phenotype analysis. Summary of the Invention

[0004] To address the shortcomings of existing technologies, this invention provides a precise method for editing bacteriophage genomes. Specifically, a defect-complementation homologous recombination (DCHR) technology has been developed. This technology combines homologous recombination mechanisms with a defect-complementation strategy for essential bacteriophage genes, thereby achieving precise genome editing. Using DCHR technology, genetic operations such as gene knockout, insertion, and point mutation can be performed precisely, efficiently, and rapidly on the genomes of virulent bacteriophages.

[0005] The first objective of this invention is to provide a method for precise editing of the genome of a universal virulent bacteriophage, the method comprising the following steps: S1. A recombinant phage is obtained by homologous recombination of a defective phage with an essential gene deletion and a genetic cassette that edits the target gene of the phage in a host bacterial cell. The genetic cassette contains a homologous arm sequence targeting the target gene, a phage essential gene sequence, and a splicing site sequence. S2. Use a gene knockout tool that identifies the splicing site to remove the essential genes in the recombinant phage to obtain a defective recombinant phage; S3. The phage genome editing is performed in the host bacterial cell by using a complemented genetic cassette and a defective recombinant phage to add the essential gene back to its original genomic position, restore the wild-type gene phenotype of the essential gene, and complete the phage genome editing; wherein, the complemented genetic cassette contains the essential gene and homologous arms that target the upstream and downstream of the essential gene.

[0006] In one embodiment of the present invention, the defective phage lacking the essential gene is constructed and screened in the following manner: S01. Plasmids for cleaving essential genes of wild-type bacteriophage and plasmids for complement expression of essential genes are introduced into host bacterial cells. Cas9 nuclease expression is induced first, followed by infection of bacteriophages to produce progeny bacteriophages. The plasmid for cleaving essential genes of wild-type bacteriophage contains the Cas9 nuclease encoding gene, a DNA sequence encoding the gRNA sequence of an essential gene targeting the bacteriophage genome, and a genome repair template for repairing the genome cleaved by the Cas9 nuclease. The plasmid for complement expression of essential genes contains the essential gene with a synonymous mutation in its codon. S02. Perform double-spot detection on the bacterial flora of two types of host bacteria to screen out defective bacteriophages with missing essential genes. The two types of host bacteria are host bacteria carrying plasmids that express the essential genes and host bacteria that do not carry plasmids that express the essential genes.

[0007] In one embodiment of the present invention, the plasmid for complementing expression of the essential gene is the pBAC-cmR-gp* plasmid; furthermore, the host bacterial cell in step S01 contains two plasmids, one is a Cas9 plasmid used for cutting the essential gene, and the other is the pBAC-cmR-gp* plasmid for functional complementing expression of the essential gene. In the pBAC-cmR-gp* plasmid, the genetic codons encoding the essential gene by gp are all synonymous mutations, firstly to avoid being cut by the Cas9 nuclease, and secondly to prevent the repair of the broken progeny bacteriophage genome.

[0008] In one embodiment of the present invention, the cleavage site is lox66 / lox71 The gene knockout tool that identifies splicing sites is the Cre-loxP system.

[0009] In one embodiment of the present invention, the homologous arm sequence is a gene sequence 200bp~1000bp upstream and downstream of the target gene.

[0010] In one embodiment of the present invention, the excision of essential genes in recombinant bacteriophages is specifically performed in the following manner: Recombinant phages were used to infect host bacteria containing a gene knockout plasmid that recognizes a splicing site, as well as a plasmid that complements the expression of an essential gene. The gene knockout plasmid that recognizes the splicing site carries the Cre-loxP system for recognizing the same gene. lox66 / lox71 site, and cut lox66 / lox71 Essential genes between; plasmids that back-express essential genes carry essential genes with synonymous mutations in the codons.

[0011] In one embodiment of the present invention, the gene knockout plasmid that identifies the splicing site is pSC101-BAD-Cre-tetR, and pSC101-BAD-Cre-tetR carries the Cre-loxP system for recognizing the same direction. lox66 / lox71 site, and cut lox66 / lox71 The essential genes between them; the plasmid for restoring expression of the essential genes is pBAC-cmR-gp* plasmid; further, the two plasmids are in the same host, pBAC-cmR-gp* plasmid expresses the essential gene gp*, functionally restoring the protein expressed by the missing essential gene gp, pSC101-BAD-Cre-tetR expresses Cre enzyme, cleaving the essential gene gp. If the pBAC-cmR-gp* plasmid is not present, the progeny phages that have had the essential gene cleaved will not be active.

[0012] In one embodiment of the present invention, the defective recombinant phage obtained in step S2 can be used for the next round of gene editing, and the necessary gene replenishment in step S3 is performed after all gene editing is completed.

[0013] In one embodiment of the present invention, the recombinant phage mentioned in step S1 is obtained by homologous recombination of a defective phage lacking an essential gene and a genetic cassette that has edited the target gene of the phage in a host bacterial cell through electroporation or assisted plasmid transformation.

[0014] In one embodiment of the present invention, the method for assisting plasmid transformation includes: S11. The genetic cassette for editing the target gene of the bacteriophage is cloned into a plasmid vector to construct a donor plasmid; wherein the plasmid vector contains a Cas9 recognition site; S12. The Cas9 nuclease encoding gene is cloned into the BAC plasmid to construct a cutting plasmid that can target and cut the donor plasmid and release the genetic cassette. S13. The two plasmids constructed in S11 and S12 are transformed into host cells. When the defective phage infects the host, it induces the expression of Cas9 nuclease, cuts the donor plasmid and releases the gene cassette. The gene cassette and the defective phage undergo homologous recombination to obtain recombinant phage.

[0015] In one embodiment of the present invention, the plasmid vector used for the donor plasmid is the p15A plasmid.

[0016] In one embodiment of the present invention, the virulent bacteriophage includes, but is not limited to, virulent Escherichia coli bacteriophage, Salmonella bacteriophage, Klebsiella pneumoniae bacteriophage, Pseudomonas bacteriophage, and Acinetobacter baumannii bacteriophage.

[0017] In one embodiment of the present invention, the phage essential genes described in S1 are genes that are indispensable for the phage to complete key steps in its life cycle.

[0018] In one embodiment of the present invention, the key steps in completing the life cycle include, but are not limited to, infecting the host, replicating, assembling and releasing progeny bacteriophages.

[0019] The second objective of this invention is to provide a precise method for editing the genome of a general-purpose virulent bacteriophage and its application in editing the genome of virulent bacteriophages.

[0020] Beneficial effects (1) The recombinant phages obtained by the method of the present invention have an accuracy of 100%. Only progeny phages that have successfully completed homologous recombination can obtain the necessary genes, thereby forming phage plaques on the wild-type host culture medium and being isolated. This completely eliminates the need for a large number of recombinant phage isolation processes.

[0021] (2) The method of the present invention has high fidelity. The phage genome editing method (DCHR) of the present invention is a gene editing technology based on homologous recombination. It achieves precise gene modification in the phage genome through sequence-specific homologous pairing. Whole genome sequencing showed that no perceptible off-target mutations were detected in non-target regions.

[0022] (3) Simplicity of operation of the method of the present invention. For host bacteria with high electroporation efficiency, the phage genome editing method only requires electroporation. A genetic cassette fragment for homologous recombination is constructed by overlapping extension PCR, and the genetic cassette fragment and the defective phage genomic DNA are co-electro-transmitted into the host cell to achieve homologous recombination. Each editing cycle is completed in approximately 48 hours. For host bacteria with low electroporation efficiency, only helper plasmid transformation is required. The genetic cassette fragment for homologous recombination is cloned into a plasmid vector and transformed into the host bacteria together with the Cas9 cutting plasmid. During the infection of the host bacteria by the phage with the essential gene deletion, Cas9 cuts the plasmid containing the genetic cassette fragment, releasing the genetic cassette, which then achieves homologous recombination with the phage genome. This editing cycle is also completed in approximately 72 hours.

[0023] (4) The method of the present invention has iterative gene editing capability. Through the Cre-loxP-mediated selective marker removal mechanism, selective markers can be removed after each round of gene editing, and the next round of gene editing can be carried out on this basis, realizing the cyclical execution of gene editing operations.

[0024] (5) The method of this invention also has wide applicability. The phage genome editing method has high recombination efficiency, and the yield of recombinant phages can reach (5.35±0.65)×105 The PFU / mL concentration fully meets the requirements for isolating recombinant phages in later stages. Furthermore, the phage genome editing method eliminates the dependence on efficient electroporation and exogenous homologous recombination systems. Phage genome editing can be implemented using various non-model strains, expanding the potential applications of phage genome engineering. Attached Figure Description

[0025] Figure 1 This is a schematic diagram illustrating the technical principle of the bacteriophage genome editing method (DCHR) of the present invention.

[0026] Figure 2 For T7 (Δ) gp10 A schematic diagram of the construction of defective bacteriophages.

[0027] Figure 3 To identify T7 (Δ) using the double spot test gp10 (Defective bacteriophages)

[0028] Figure 4 To use DCHR to screen out T7 genomes gp4.3-4.7 and gp0.4-0.7 Non-essential gene regions.

[0029] Figure 5 To insert reporter genes into the T7 genome using DCHR lacZ .

[0030] Figure 6 To implement gene point mutations in the T7 gene using DCHR. Detailed Implementation

[0031] Source of materials: T7 is a virulent bacteriophage of Escherichia coli with a genome size of approximately 39.9 kb (Genbank ID: NC_001604). This embodiment utilizes CIRSPR-Cas9 engineering technology to construct a genome encoding the major capsid protein of T7. gp10 Defective T7 phage; gp10 The encoding gene is (Gene ID: 1261026). Information and construction methods for the pSC101-BAD-Cre-tetR plasmid have been publicly available; please refer to the article "Yuan, H., et al ., Direct cloning of a herpesvirus genome for rapid generation ofinfectious BAC clones . J Adv Res, 2023.43: p. 97-107."

[0032] How to build pBAC-cmR-gp10*: Using the primer pairs in Table 1, the chloramphenicol resistance gene (chloramphenicol-resistance gene) was used. cmR ) was used as a template for PCR amplification of the cmR gene fragment; artificially synthesized gp10 *The gene is a template PCR amplification controlled by the TAC promoter. gp10 Gene fragments were amplified, and the pBAC plasmid backbone was amplified using pBAC-cm-BR322-ccdB-hyg as a template. After separating the PCR products by 1% agarose gel electrophoresis, the target band was purified using a gel extraction kit. Recombinant plasmids were constructed using the Gibson assembly system: 2 μL of purified plasmid was used... gp10 The gene fragment (0.4 μg) was mixed with 3 μL of pBAC vector fragment (0.6 μg), followed by the addition of 5 μL of Gibson Assembly Master Mix. The mixture was incubated at 50°C for 2 h to complete in vitro recombination. After desalting via a 0.025 μm Millipore filter, 10 μL of the ligation product was electroporated to… E. coli In GB2005 competent cells, the pulse parameters were set to 1800 V / 5 ms. The transformed bacterial culture was plated on LB solid medium containing 15 μg / mL chloramphenicol and incubated at 37°C for 16 h. Positive clones were obtained by colony PCR screening, and the sequence integrity of the recombinant plasmid was further verified by Sanger sequencing. Finally, single clones carrying the correct recombinant plasmid were obtained. How to build pBAC-kanR-cas9-HA: Using the primer pairs in Table 2, the pBAC plasmid backbone was amplified using pBAC-cm-BR322-ccdB-hyg as a template; the kanamycin resistance gene was amplified. kanR ) for template PCR amplification kan Gene fragment; PCR amplification using the Cas9 nuclease gene as a template cas9 Gene fragments. After separating the PCR products using 1% agarose gel electrophoresis, the target band was purified using a gel extraction kit. Recombinant plasmids were constructed using the Gibson assembly system: 2 μL of the pBAC vector fragment (0.6 μg) and 1 μL of purified... kan Gene fragment (0.2 μg), 2 μL cas9The gene fragment was mixed thoroughly, then 5 μL of Ibson Assembly Master Mix was added, and the mixture was incubated at 50°C for 2 h to complete in vitro recombination. After desalting through a 0.025 μm Millipore filter, 10 μL of the ligation product was electroporated to... E. coli In GB2005 competent cells, the pulse parameters were set to 1800 V / 5 ms. The transformed bacterial culture was plated on LB solid medium containing 5 μg / mL kanamycin and incubated at 37°C for 16 h. Positive clones were obtained by colony PCR screening, and the sequence integrity of the recombinant plasmid was further verified by Sanger sequencing. Finally, single clones carrying the correct recombinant plasmid were obtained.

[0033] The primers used in the examples are as follows: Table 1

[0034] Note: The underlined gene sequences are homologous arms used for recombination operations.

[0035] Table 2

[0036] Note: The underlined gene sequences are homologous arms used for recombination operations.

[0037] Table 3

[0038] Note: The underlined gene sequences are homologous arms used for recombination operations.

[0039] Table 4

[0040] Note: The underlined gene sequences are homologous arms used for recombination operations.

[0041] Table 5

[0042] Note: The underlined gene sequences are homologous arms used for recombination operations.

[0043] Table 6

[0044] Note: The underlined gene sequences are homologous arms used for recombination operations.

[0045] The technical principle diagram of the editing method involved in the embodiment is as follows: Figure 1 As shown, the steps are as follows: (1) Construction of defective phages: Defective phages with essential gene deletions were constructed using CRISPR-Cas9 assist technology. First, two plasmids were transformed into host cells. The first plasmid was based on the pBR322 vector and named pBR322-ampR-cas9-gp (wherein... gp The plasmid (short for essential gene) contains three functional components: (a) an arabinose-induced expression system for expressing the Cas9 nuclease; (b) a DNA sequence encoding a gRNA sequence targeting an essential gene in the bacteriophage genome; and (c) a genome repair template located 500 base pairs upstream and downstream of this essential gene. The second plasmid is an artificially modified bacterial chromosome plasmid (…). b Acterial a rtificial c A hromosome (BAC) named pBAC-cmR-gp* was used to express this essential gene. Notably, all codons of the essential gene in the BAC plasmid underwent synonymous mutations to achieve two key functions: evading Cas9 nuclease recognition and cleavage, and preventing this essential gene from participating in genome repair processes. Next, Cas9 nuclease expression was pre-induced in host cells, followed by infection with multiples of 100 (MLU). m ultiplicity o f i Phages were added at a MOI (Minimum Infection) ratio of 0.001. After the phage genome was injected into the host bacteria, the gRNA-guided Cas9 nuclease specifically targeted and cleaved the wild-type essential genes. Double-strand breaks in the phage genome were repaired using the provided template, ultimately producing defective phages. Subsequently, the progeny phages were isolated and purified from the bacterial flora of the host bacteria and spotted onto two different host bacterial flora. One type carried the essential genes. gp *The host bacteria containing the BAC plasmid (pBAC-cmR-gp*) were selected. Another host bacteriophage lacked the plasmid. Phages that produced plaques on the former's bacterial colony and those that did not on the latter's were chosen. Finally, the deletion of the essential gene gp was confirmed by PCR and Sanger sequencing.

[0046] (2) Implementation of Defect-Completion Homologous Recombination (DCHR): Using overlap extension PCR technology, a phage containing homologous arms, the essential phage gene gp (as a selection marker gene), and lox66 / lox71The genetic cassette at the locus, where the homologous arms represent the gene sequences of the upstream and downstream base pairs of the targeted modification gene. Based on the electroconversion efficiency of the phage host, two methods can be used to implement DCHR. (a) For host bacteria with high electroconversion efficiency, DCHR can be implemented via electroconversion. The PCR product of the constructed genetic cassette is co-electroconverted with the defective phage genome into the host bacteria to implement DCHR. (b) For host bacteria with low electroconversion efficiency, plasmid-assisted DCHR can be used. The construction process of the helper plasmid is as follows: The genetic cassette fragment obtained from overlap extension PCR is cloned into the p15A plasmid vector to construct a donor plasmid. cas9 The gene was cloned into the BAC plasmid to construct a cutting plasmid that could target and cleave the p15A plasmid, releasing the aforementioned gene cassette. These two plasmids were then transformed into host cells. When the defective phage infected the host, it induced the expression of the Cas9 nuclease, which cleaved the p15A plasmid and released the gene cassette fragment. Recombination occurred between the defective phage's genome and the gene cassette within the host bacterial cell. Only progeny phages that successfully underwent homologous recombination regained their infectivity, thus forming plaques on the host bacterial flora. Genetic manipulations such as gene knockout, insertion, and point mutation can be performed during this process.

[0047] (3) Removal of the selection marker gene: The recombinant phage obtained in step (2) is then used to infect host bacteria carrying the pSC101-BAD-Cre-tetR and pBAC-cmR-gp* plasmids. The Cre-loxP system will recognize the same direction. lox66 / lox71 site, and cut lox66 / lox71 Essential genes between gp (Selection marker genes) were used to restore recombinant phages to the essential gene defect type. Essential gene defective phages were isolated from host bacterial colonies containing the pBAC-cmR-gp* plasmid and identified by PCR. The essential gene defect can be iteratively edited after excision.

[0048] (4) Reinstatement of essential genes (selection marker genes): After all genetic operations are completed, a genetic cassette containing homologous arms and essential phage genes is constructed using overlap extension PCR technology. Here, homologous arms are gene sequences of upstream and downstream base pairs of the essential genes selected as selection markers in the phage genome. Subsequently, the essential genes can be reinstated using DCHR via electroporation or plasmid-assisted DCHR to restore the wild-type phenotype of this essential gene.

[0049] Terminology Explanation: CRISPR-Cas9 technology: The prokaryotic immune system, composed of Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) and the Cas9 protein, has been artificially modified into a new generation of gene editing tools capable of precisely identifying and cutting target DNA sites. The Cas9 protein is a nuclease that, guided by guide RNA (gRNA), recognizes and cuts DNA sequences complementary to the gRNA, thereby enabling targeted genome editing, such as gene knockout, gene insertion, and gene replacement.

[0050] The Cre-LoxP system: The Cre-LoxP recombinase system is a gene-editing tool composed of Cre recombinase and LoxP sites. Proposed by Sternberg and Hamilton, it is widely used in conditional, inducible, and spatiotemporally specific gene targeting technologies. The core of this system is the Cre recombinase, derived from P1 bacteriophage, which specifically recognizes a 34 bp LoxP sequence. The Cre enzyme mediates DNA recombination between two LoxP sites, and depending on the orientation of the sites, it can lead to gene deletion, inversion, or chromosomal translocation.

[0051] Gibson assembly: Gibson assembly is a DNA recombination technology that achieves seamless splicing of multiple fragments through enzymatic reactions. Its core principle utilizes the synergistic action of three enzymes: exonucleases cut the ends of DNA fragments to produce sticky ends, polymerases fill the gaps to form nicked DNA, and finally, ligases repair the nicks to form complete double-stranded DNA. This technology does not require specific restriction enzyme sites; it only requires adding homologous sequences to the ends of DNA fragments, overcoming limitations on fragment length and end sequences, and significantly improving assembly efficiency.

[0052] The multiplicity of infection (MOI) is the ratio of the number of viruses or bacteriophages to the number of host cells, used to describe the number of viruses or bacteriophages that infect a single cell.

[0053] Essential genes (EGs): Essential genes are genes that are indispensable for bacteriophages to complete key steps in their life cycle (such as infecting the host, replication, assembly, and release of progeny bacteriophages). Without these genes, bacteriophages cannot reproduce independently. Therefore, "essential gene" is a general term and can refer to any one of many essential genes. In the following examples, gp10 is used as an example of an essential gene.

[0054] Example 1: Construction of T7 (Δgp10) defective phage (1) Constructing Cas9 cleavage plasmids and gp10 helper plasmids Using the primer list in Table 3, the DNA fragment of Cas9 and the pBR322 vector fragment were amplified, and the pBR322-ampR-cas9-gp10 plasmid was constructed using Gibson assembly technology. This plasmid can target and cleave wild-type T7 phage. gp10 Gene. For wild type gp10 Synonymous mutations were performed on all codons of the gene, and the synonymous mutated gene sequence was synthesized using artificial synthesis methods and labeled as follows. gp10 *; gp10 The nucleotide sequence of * is shown in SEQ ID No. 1. Then, using the primer list in Table 1, amplification was performed respectively. gp10 The DNA fragment and BAC vector fragment were used to construct the pBAC-cmR-gp10* plasmid using Gibson assembly technology. The function of this plasmid is to synthesize the Gp10 protein.

[0055] Subsequently, the constructed plasmids pBR322-ampR-cas9-gp10 and pBAC-cmR-gp10* were transformed into... E. coli In GB2005, recombinant strains were screened on plates containing kanamycin and chloramphenicol, and named... E. coli GB2005 (pBAC-cmR-gp10* + pBR322-ampR-cas9-gp10).

[0056] (2) T7 (Δ gp10 Construction of defective bacteriophages 40 μL E. coli An overnight culture of GB2005 (pBAC-cmR-gp10* + pBR322-ampR-cas9-gp10) bacteria was inoculated into 1.4 mL of LB medium containing 15 μg / mL chloramphenicol and 5 μg / mL kanamycin, and cultured at 30°C for 2 hours on a shaker at 950 rpm. 35 μL of 10% (w / v) L-arabinose solution was added to the culture to induce Cas9 nuclease expression, and the culture was then continued at 37°C until the logarithmic growth phase (OD2005). 600 =0.6~0.8, approximately 40 min). Add wild-type T7 phage at an infection rate of 0.001 and continue culturing until bacterial culture is cleared. Centrifuge the lysate at 9500×g to remove cell debris. Serially dilute the phage-containing supernatant and... E. coliCultured on LB agar plates containing GB2005 (pBAC-cmR-gp10*). After incubation at 37°C for 4–5 h, single plaques were picked using a sterile pipette tip and inoculated onto [the plate / plate]. E. coli GB2005 (pBAC-cmR-gp10*) and E. coli GB2005 on the mycelium. Selected from E. coli Clear phagocytic plaques were formed on the GB2005 (pBAC-cmR-gp10*) plane, but E. coli GB2005 phages cannot form plaques on the plane. Finally, this was confirmed by PCR and Sanger sequencing. gp10 Gene knockout ( Figure 2 and Figure 3 ).

[0057] Example 2: T7 genome gp4.3-4.7 and gp0.4-0.7 Knockout This embodiment focuses on the T7 genome. gp4.3-4.7 and gp0.4-0.7 E. coli GB2005 strain originated from E. coli DH10B is a strain with high electroporation efficiency. Here, defect-complement homologous recombination (DCHR) was performed using co-electroporation. Primers from Table 4 were used to amplify... gp10 Homologous arm (target) gp4.3-4.7 Subsequently, using overlap extension PCR technology, a carrier array was constructed. lox66 and lox71 The DNA fragment at the site (HA1-lox66-gp10-lox71-HA2), where the homologous arm (HA1) is the target. gp4.3-4.7 The upstream gene sequence, the nucleotide sequence of HA1, is shown in SEQ ID No. 2; the homologous arm (HA2) is the target. gp4.3-4.7 The downstream gene sequence, the nucleotide sequence of HA2, is shown in SEQ ID No. 3.

[0058] Subsequently, the constructed DNA fragment was coupled with T7 (Δ gp10 The genome of ) was electroporated together with E. coli DCHR was implemented in GB2005 cells. E. coli Recombinant phages were isolated from GB2005 bacterial flora and subjected to PCR detection. The results showed that 1.02 kb of the selected six recombinant phage genes... gp4.3-4.7 All gene regions have been replaced by 1.21 kb of HA1-lox66-gp10-lox71-HA2. The accuracy of the recombinant phage reached 100% (6 / 6). Figure 4(As shown in A).

[0059] Next, a recombinant phage was selected and used to infect the bacteriophages carrying the pSC101-BAD-Cre-tetR and p15A-cmR-gp10* plasmids at a ratio of 0.001. E. coli GB2005. After the culture becomes clear, dilute it appropriately and spread it evenly on... E. coli On GB2005 (p15A-cmR-gp10*) bacterial colonies. Six plaques were randomly selected, and colony PCR was used to identify whether the gp10 gene had been excised. The results showed that the 1.21kb HA1-lox66-gp10-lox71-HA2 gene cassette in the six selected recombinant phage genes had been excised. Figure 4 (As shown in Figure B). Because the phage genome at this time is still... gp10 For defective cases, continue with the steps described above. gp0.4-0.7 Gene knockout ( Figure 4 (As shown in C and D).

[0060] Example 3: Insertion of the lacZ gene into the genome of T7 recombinant phage This embodiment is based on T7 (Δ) gp10 Δ gp0.4-0.7 Δ gp4.3-4.7 Recombinant bacteriophages gp9 downstream insertion of genes lacZ Reporter genes.

[0061] DCHR was implemented here using common electroconversion. Primers from Table 5 were used to amplify the following components. gp10 Homologous arms lacZ Subsequently, using overlap extension PCR technology, a vector carrying... lox66 and lox71 The DNA fragment at the site (HA3-gp10-lacZ-HA4), where the homologous arm (HA3) is the target. gp10 The upstream gene sequence, the nucleotide sequence of HA3 is shown in SEQ ID No. 4; the homologous arm (HA4) is the target. gp10 The downstream gene sequence, the nucleotide sequence of HA4, is shown in SEQ ID No. 5.

[0062] Subsequently, the constructed DNA fragment was coupled with T7 (Δ gp10 Δ gp0.4-0.7 Δ gp4.3-4.7 The genome of ) was electroporated together with E. coli DCHR was performed in GB2005 cells. The cells contained X-gal reagent. E. coliRecombinant bacteriophages were isolated from GB2005 bacterial flora. Results showed that those containing X-gal reagent... E. coli The recombinant phage plaques isolated from GB2005 bacterial flora were all blue, while the phage plaques of wild-type T7 phage were colorless, suggesting that the genomes of these recombinant phages carried [the following]. lacZ Gene( Figure 5 (As shown in Figure A). Six recombinant phages were selected, and 3.08 kb of their DNA was amplified using colony PCR. lacZ Genes. The results showed that all six recombinant phages carried [the gene]. lacZ Genetics, with an accuracy rate of 100% (6 / 6) Figure 5 (As shown in B).

[0063] Example 4: Implementing point mutations in the T7 genome CRISPR-Cas9 gene editing technology has been widely used to modify bacteriophage genomes, but its application is still limited to PAM sequences. This limitation is particularly evident when introducing point mutations at sites far from PAM sites, such as in the T7 genome. gp9 Mutation of the stop codon at the site. This example describes a mutation of the T7 (Δ) stop codon. gp10 In the genome gp9 The stop codon is subjected to point mutation (TGA-TAA) to demonstrate the editing flexibility of DCHR.

[0064] The distance was determined using the CRISPOR tool (https: / / crispor.gi.ucsc.edu / crispor.py). gp9 The nearest PAM sequence to the stop codon is 29 bases downstream. Given that the CRISPR-Cas9 system's operating window upstream of the PAM motif is less than 20 bases, this 29-base distance exceeds the maximum editing range of the CRISPR-Cas9 system, thus preventing Cas9-mediated target mutation editing (shown in Figure 6A).

[0065] Here, DCHR is implemented using a plasmid-assisted approach to achieve... gp9 Point mutation of the stop codon.

[0066] Using the primers in Table 6, amplify respectively gp10 Homologous arms. Subsequently, using overlap extension PCR technology, a DNA fragment HA5-gp10-HA6 was constructed, in which homologous arms HA5 and HA6 were used as target cells. gp9 Upstream and downstream gene sequences, and introduced gp9 Point mutation of the stop codon. Specifically, the homologous arm (HA5) is targeted. gp9The upstream gene sequence, the nucleotide sequence of HA5, is shown in SEQ ID No. 6; the homologous arm (HA6) is the target. gp9 The downstream gene sequence, the nucleotide sequence of HA6, is shown in SEQ ID No. 7.

[0067] Subsequently, the constructed HA5-gp10-HA6 DNA fragment was cloned into the p15A plasmid containing the Cas9 recognition site. The p15A-HA5-gp10-HA6 plasmid was constructed and electroporated together with the pBAC-kanR-cas9-HA plasmid. E. coli GB2005 cells.

[0068] T7(Δ) gp10 Bacteriophages were infected at an MOI of 0.1. E. coli When using GB2005 (p15A-HA5-gp10-HA6+ pBAC-kanR-cas9-HA), the final concentration of added arabinose is approximately 3 g / L to induce Cas9 nuclease expression. The gRNA-Cas9 nuclease complex recognizes artificially introduced cleavage sites (5'-3' gene sequence: CTGGACCTTATTCCGCGAAGAGG) at both ends of the HA5-gp10-HA6 fragment in the p15A plasmid, targeting and cleaving the p15A plasmid to release a linear HA5-gp10-HA6 DNA fragment. This linear HA5-gp10-HA6 DNA fragment interacts with T7 (Δ... gp10 ) Genome in E. coli Recombination was completed within GB2005 cells, yielding recombinant phages. Subsequently, in E. coli Recombinant phages were isolated from GB2005 bacterial flora and amplified. gp9 The gene was sequenced using Sanger sequencing.

[0069] The results showed that the obtained recombinant phages contained gp9 The stop codon is mutated from TGA to TAA ( Figure 6 (As shown in B).

[0070] Example 5: DCHR recombination efficiency determination This embodiment focuses on targeted knockout. gp4.3-4.7 Taking this as an example, we analyze the impact of electroconversion methods on DCHR recombination efficiency.

[0071] Using the primers in Table 4, the DNA fragment HA1-lox66-gp10-lox71-HA2 and the plasmid p15A-HA1-lox66-gp10-lox71-HA2 were constructed according to the methods in Examples 2 and 4, respectively. The homologous arm here targets... gp4.3-4.7 Upstream and downstream gene sequences. Electroporation efficiency was determined under both DCHR methods.

[0072] When DCHR was performed by electroporation (5 μg of DNA fragment of HA1-lox66-gp10-lox71-HA2, 20 μg of T7 (Δgp10) genome, 1800 V, 25 μF, 200 Ω), in a system containing the Red homologous recombination system... E. coli In GB05-red, the titers of recombinant phages obtained were 46 ± 8 PFU / mL. In a system without the Red homologous recombination system... E. coli In GB2005, the titers of the recombinant phages obtained were 1.3 ± 0.8 PFU / mL.

[0073] When performing DCHR using plasmids, in systems containing Red homologous recombination systems E. coli In GB05-red, the titers of the recombinant phages obtained were 1.50 ± 0.23 × 10⁻⁶. 5 PFU / mL. In the absence of the Red homologous recombination system. E. coli In GB2005, the titers of the recombinant phages obtained were 4.58 ± 1.35 × 10⁻⁶. 4 PFU / mL.

[0074] These results demonstrate that Cas9-mediated linear clone release technology can overcome the limitations of electroporation, and the use of longer homologous arms can bypass the requirements of exogenous recombination systems. Therefore, the DCHR system has broad application potential in phage genome engineering.

[0075] The sequences involved in the above embodiments are as follows: gp10 The nucleotide sequence of * is shown in SEQ ID No. 1: The nucleotide sequence of HA1 is shown in SEQ ID No. 2: GCTCGCTAAGCTGGCCTACATGCGCTCAGGCTTGGGCTGTGACGTAATCATTCTAGACCACATCTCAATCGTCGTATCCGCTTCTGGTGAATCCGATGAGCGTAAGATGATTGACAACCTGATGACCAAGCTCAAAGGGTTCGCTAAGTCAACTGGGGTGGTGCTGGTCGTAATTTGTCACCTTAAGAACCCAGACAAAGGTAAAGCACATGAGGAAGGTCGCCCCGTTTCTATTACTGACCTACGTGGTTCTGGCGCACTACGCCAACTATCTGATACTATTATTGCCCTTGAGCGTAATCAGCAAGGCGATATGCCTAACCTTGTCCTCGTTCGTATTCTCAAGTGCCGCTTTACTGGTGATACTGGTATCGCTGGCTACATGGAATACAACAAGGAAACCGGATGGCTTGAACCATCAAGTTACTCAGGGGAAGAAGAGTCACACTCAGAGTCAACAGACTGGTCCAACGACACTGACTTCTGACAGGATTCTTGAT The nucleotide sequence of HA2 is shown in SEQ ID No. 3: AGTTGTTTCATATGAAGAGATTGTTAAGTCACGATAATCAATAGGAGAAATCAATATGATCGTTTCTGACATCGAAGCTAACGCCCTCTTAGAGAGCGTCACTAAGTTCCACTGCGGGGTTATCTACGACTACTCCACCGCTGAGTACGTAAGCTACCGTCCGAGTGACTTCGGTGCGTATCTGGATGCGCTGGAAGCCGAGGTTGCACGAGGCGGTCTTATTGTGTTCCACAACGGTCACAAGTATGACGTTCCTGCATTGACCAAACTGGCAAAGTTGCAATTGAACCGAGAGTTCCACCTTCCTCGTGAGAACTGTATTGACACCCTTGTGTTGTCACGTTTGATTCATTCCAACCTCAAGGACACCGATATGGGTCTTCTGCGTTCCGGCAAGTTGCCCGGAAAACGCTTTGGGTCTCACGCTTTGGAGGCGTGGGGTTATCGCTTAGGCGAGATGAAGGGTGAATACAAAGACGACTTTAAGCGTATGCTTGAAGAGCAGGGTGAAGAATA The nucleotide sequence of HA3 is shown in SEQ ID No. 4: CTGCCTCTGAGCAACTTGGTGAGCACGAAGAGGGCTTCCAAGAGATGATTAACATTGCTGCTGAGCGTGGCATGAGTGTCGAGACCATTGAGGCTATCCAGCGTGAGTACGAGGAGAACGAAGAGTTGTCCGCCGAGTCCTACGCTAAGCTGGCTGAAATTGGCTACACGAAGGCTTTCATTGACTCGTATATCCGTGGTCAAGAAGCTCTGGTGGAGCAGTACGTAAACAGTGTCATTGAGTACGCTGGTGGTCGTGAACGTTTTGATGCACTGTATAACCACCTTGAGACGCACAACCCTGAGGCTGCACAGTCGCTGGATAATGCGTTGACCAATCGTGACTTAGCGACCGTTAAGGCTATCATCAACTTGGCTGGTGAGTCTCGCGCTAAGGCGTTCGGTCGTAAGCCAACTCGTAGTGTGACTAATCGTGCTATTCCGGCTAAACCTCAGGCTACCAAGCGTGAAGGCTTTGCGGACAGTAGCGAGATGATTAAAGCTATGAGTGACCCTCGGTATCGCACAGATGCCAACTATCGTCGTCAAGTCGAACAGAAAGTAATCGATTCGAACTTCTAATAGACTTCGAAATTAATACGACTCACTATAGGGAGACCACAACGGTTTCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACAT The nucleotide sequence of HA4 is shown in SEQ ID No. 5: TGCTGGGGGTGGCCTCAACGGTCGCTGCTAGTCCCGAAGAGGCGAGTGTTACTTCAACAGAAGAAACCTTAACGCCAGCACAGAAGGCCGCACGCACCCGCGCTGCTAACAAAGCCCGAAAGGAAGCTGAGTTGACTGCTGCCACCGCTGAGCAATAACTAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTGCTGAAAGGAGGAACTATATGCGCTCATGCGATATGAACGTTGAGACTGCCGCTGAGTTATCAGCTGTGAACGACATTCTGGCGTCTATCGGTGAACCTCCGGTATCAACGCTGGAAGGTGACGCTAACGCAGATGTAGCGAACGCTCGGCGTATTCTCAACAAGATTAACCGACAGATTCAATCTCGTGGATGGACGTTCAACATTGAGGAAGGCATAACGCTACTACCTGATGTTTACTCCAACCTGATTGTATACAGTGACGACTATTTATCCCTAATGTCTACTTCCGGTC The nucleotide sequence of HA5 is shown in SEQ ID No.6: CTTTCATTGACTCGTATATCCGTGGTCAAGAAGCTCTGGTGGAGCAGTACGTAAACAGTGTCATTGAGTACGCTGGTGGTCGTGAACGTTTTGATGCACTGTATAACCACCTTGAGACGCACAACCCTGAGGCTGCACAGTCGCTGGATAATGCGTTGACCAATCGTGACTTAGCGACCGTTAAGGCTATCATCAACTTGGCTGGTGAGTCTCGCGCTAAGGCGTTCGGTCGTAAGCCAACTCGTAGTGTGACTAATCGTGCTATTCCGGCTAAACCTCAGGCTACCAAGCGTGAAGGCTTTGCGGACAGTAGCGAGATGATTAAAGCTATGAGTGACCCTCGGTATCGCACAGATGCCAACTATCGTCGTCAAGTCGAACAGAAAGTAATCGATTCGAACTTCTAATAGACTTCGAAATTAATACGACTCACTATAGGGAGACCACAACGGTTTCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACAT The nucleotide sequence of HA6 is shown in SEQ ID No.7: GAATTCGATATCTGCTGGGGTGGCCTCAACGGTCGCTGCTAGTCCCGAAGAGGCGAGTGTTACTTCAACAGAAGAAACCCTTAACGCCAGCACAGAAGGCCGCACGCACCCGCGCTGCTAACAAAGCCCGAAAGGAAGCTGAGTTGACTGCTGCCACCGCTGAGCAATAACTAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTGCTGAAAGGAGGAACTATATGCGCTCATGCGAT ATGAACGTTGAGACTGCCGCTGAGTTATCAGCTGTGAACGACATTCTGGCGTCTATCGGTGAACCTCCGGTATCAACGCTGGAAGGTGACGCTAACGCAGATGTAGCGAACGCTCGGCGTATTCTCAACAAGATTAACCGACAGATTCAATCTCGTGGATGGACGTTCAACATTGAGGAAGGCATAACGCTACTACCTGATGTTTACTCCAACCTGATTGTATACAGTGACGACTATTTATCCCTAATGT Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Anyone skilled in the art can make various modifications and alterations without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be determined by the claims.

Claims

1. A method for precise editing of the genome of a universal virulent bacteriophage, characterized in that, The method includes the following steps: S1. A recombinant phage is obtained by homologous recombination in a host bacterial cell using a defective phage with an essential gene deletion and a genetic cassette that edits the phage's target gene. The genetic cassette contains a homologous arm sequence targeting the target gene, a phage essential gene sequence, and a splicing site sequence. S2. Use a gene knockout tool that identifies the splicing site to remove the essential genes in the recombinant phage and re-obtain the defective recombinant phage; S3. The complementary gene cassette and defective recombinant phage are used to recombine in the host bacterial cell to complement the essential gene, restore the wild-type gene phenotype of the essential gene, and complete the phage genome editing; wherein, the complementary gene cassette contains the essential gene and homologous arm sequences targeting the upstream and downstream of the essential gene.

2. The method for precise editing of the genome of a universal virulent bacteriophage according to claim 1, characterized in that, The defective phages lacking the essential gene were constructed and screened in the following manner: S01. Plasmids for cleaving essential genes of wild-type bacteriophages and plasmids for complementing expression of essential genes are introduced into host bacterial cells. Cas9 nuclease expression is induced first, followed by infection of bacteriophages to produce progeny bacteriophages. The plasmid for cleaving essential genes of wild-type bacteriophages contains the Cas9 nuclease encoding gene, a DNA sequence encoding the gRNA sequence of an essential gene targeting the bacteriophage genome, and a genome repair template for repairing the genome cleaved by the Cas9 nuclease. The plasmid for complementing expression of essential genes contains the essential gene with a synonymous mutation in its codon. S02. Perform double-spot detection on the bacterial flora of two types of host bacteria to screen out defective bacteriophages with missing essential genes. The two types of host bacteria are host bacteria carrying plasmids that express the essential genes and host bacteria that do not carry plasmids that express the essential genes.

3. The method for precise editing of the genome of a universal virulent bacteriophage according to claim 1, characterized in that, The cleavage site mentioned in step S2 is lox66 / lox71 The gene knockout tool that identifies splicing sites is the Cre-loxP system.

4. The method for precise editing of the genome of a universal virulent bacteriophage according to claim 3, characterized in that, The excision of essential genes in the recombinant phage described in step S2 is specifically performed in the following manner: Recombinant phages were used to infect host bacteria containing a gene knockout plasmid that recognizes a splicing site, as well as a plasmid that complements the expression of an essential gene. The gene knockout plasmid that recognizes the splicing site carries the Cre-loxP system for recognizing the same gene. lox66 / lox71 site, and cut lox66 / lox71 Essential genes between; plasmids that back-express essential genes carry essential genes with synonymous mutations in the codons.

5. The method for precise editing of the genome of a universal virulent bacteriophage according to claim 1, characterized in that, The recombinant phage described in step S1 is obtained by homologous recombination of a defective phage lacking an essential gene and a genetic cassette that has edited the target gene of the phage within a host bacterial cell via electroporation or plasmid-assisted transformation.

6. The method for precise editing of the genome of a universal virulent bacteriophage according to claim 5, characterized in that, The method for assistive plasmid transformation includes: S11. The genetic cassette for editing the target gene of the bacteriophage is cloned into a plasmid vector to construct a donor plasmid; wherein the plasmid vector contains a Cas9 recognition site; S12. The Cas9 nuclease encoding gene is cloned into the BAC plasmid to construct a cutting plasmid that can target and cut the donor plasmid and release the genetic cassette. S13. The two plasmids constructed in S11 and S12 are transformed into host cells. When the defective phage infects the host, it induces the expression of Cas9 nuclease, cuts the donor plasmid and releases the gene cassette. The gene cassette and the defective phage undergo homologous recombination to obtain recombinant phage.

7. The method for precise editing of the genome of a universal virulent bacteriophage according to any one of claims 1 to 6, characterized in that, The virulent bacteriophages mentioned include, but are not limited to, virulent Escherichia coli bacteriophage, Salmonella bacteriophage, Klebsiella pneumoniae bacteriophage, Pseudomonas bacteriophage, and Acinetobacter baumannii bacteriophage.

8. The method for precise editing of the genome of a universal virulent bacteriophage according to any one of claims 1 to 6, characterized in that, The essential genes for bacteriophages mentioned in step S1 refer to genes that are indispensable for the completion of key steps in the life cycle of bacteriophages.

9. The method for precise editing of the genome of a universal virulent bacteriophage according to any one of claims 1 to 6, characterized in that, The defective recombinant phages obtained in step S2 can be used for the next round of gene editing. After all gene editing is completed, the necessary gene replenishment in step S3 will be performed.

10. The application of the precise editing method for the genome of a general-purpose virulent bacteriophage as described in any one of claims 1 to 9 in editing the genome of a virulent bacteriophage.

Images