Application of rice gene OspPLAIII gamma in regulation and control of cold resistance

Abstract

The invention belongs to the technical field of plant genetic engineering, and particularly relates to application of a rice gene OspPLAIII gamma in regulation and control of cold resistance. The invention discloses an application of a rice gene OspPLAIII gamma in regulation and control of cold resistance. The nucleotide sequence of the OspPLAIII gamma gene is as shown in a sequence table SEQ ID NO: 1, and the coded amino acid sequence is as shown in a sequence table SEQ ID NO: 2. According to the invention, a rice gene OspPLAIII gamma is knocked out by adopting a CRISPR / Cas9 gene editing technology, so that two forms of cold-resistant rice mutants are obtained. Experimental results show that under the condition of cold stress, the survival rate of the two obtained rice mutants is obviously higher than that of the wild type, and it is indicated that the OspPLAIII gamma gene plays an important role in regulation of the cold tolerance of the rice. The invention provides new resources and technical means for cold-resistant breeding of rice and other plants.

Description

Technical Field

[0001] This invention relates to the fields of plant transgenic technology and crop genetic breeding, and more specifically, to the application of the rice gene OspPLAIIIγ in regulating cold tolerance. Background Technology

[0002] Rice (Oryza sativa L.) is extremely sensitive to low-temperature stress, and chilling injury has become one of the major obstacles limiting its widespread cultivation in cold regions such as northern regions and high altitudes. Over the past two decades, researchers have identified multiple genetic loci and candidate genes associated with cold tolerance during germination, seedling, and reproductive stages through QTL mapping, genome-wide association studies (GWAS), and systematic phenotypic evaluation. These include COLD1, OsMYB2, OsWRKY24, OsDREB1, and LTG5. These genes primarily regulate the plant's low-temperature response through mechanisms such as low-temperature signal transduction, cell membrane stability, osmotic regulation, and antioxidant responses, thereby enhancing the cold tolerance of rice.

[0003] Lipid metabolism, particularly the remodeling of membrane lipid components, is considered a key mechanism for cold tolerance. Recent combined transcriptomic and lipidomic studies have shown that under low-temperature conditions, the membrane lipid composition, fatty acid unsaturation, and membrane fluidity of rice leaves all undergo significant changes. Phospholipid metabolism pathways mediated by genes such as MGD and PAP2 play a crucial role in maintaining the stability of the photosynthetic membrane system. Furthermore, membrane lipid-related enzymes such as phospholipase D (PLDα / δ) have also been shown to participate in plant responses to cold environments, with overexpression of PLDδ significantly enhancing cold tolerance.

[0004] OspPLAIIIγ is a member of the phospholipase A III (pPLAIII) family, which includes several subtypes (such as α, γ, and δ) in rice. Although there are currently no direct reports on the function of OspPLAIIIγ, studies have shown that its homolog, OspPLAIIα, plays an important role in regulating cell wall development, plant architecture, and growth processes, and that the expression of this type of gene has significant regulatory potential under stress conditions. Based on these findings, it can be inferred that OspPLAIIIγ may play a crucial role in regulating rice cold tolerance by regulating membrane lipid components, membrane fluidity, and the accumulation of signaling lipids such as phosphatidic acid (PA), thereby affecting reactive oxygen species (ROS) scavenging, cell membrane stability, and low-temperature signaling pathways.

[0005] Therefore, the strategy for improving rice cold resistance based on the OspPLAIIIγ gene not only provides a new target for rice molecular breeding but also holds promise for improving rice production in cold regions. With the increasing frequency of extreme cold weather caused by global climate change, this technology has broad application prospects and practical significance, providing strong support for ensuring food security and sustainable agricultural development. Summary of the Invention

[0006] This invention identified and verified the OspPLAIIIγ gene, which is closely related to the cold resistance of rice. This gene is located on chromosome 3, with MSU_Locus ID LOC_Os03g57080. Its full-length genome sequence is 1765 bp, the coding region is 1389 bp, and the encoded protein is 462 amino acid residues long. Through gene knockout, we verified the function of the OspPLAIIIγ gene under low-temperature stress. Knockout of this gene significantly enhanced the cold resistance of rice seedlings and reduced mortality.

[0007] The technical solution adopted by this invention to solve its technical problem is:

[0008] In a first aspect, the present invention protects the application of the rice gene OspPLAIIIγ in regulating the cold tolerance of rice, wherein the nucleotide sequence of the rice gene OspPLAIIIγ is shown in SEQ ID NO.1.

[0009] In a specific implementation plan, knocking out the rice gene OspPLAIIIγ can improve the cold tolerance of rice.

[0010] Secondly, the present invention also protects the application of the protein encoded by the rice gene OspPLAIIIγ in regulating the cold tolerance of rice, the amino acid sequence of which is shown in SEQ ID NO.2.

[0011] The protein was named OspPLAIIIγ.

[0012] In a specific implementation plan, knocking out the rice gene OspPLAIIIγ, resulting in the non-expression or inactivation of its encoded protein, can improve the cold tolerance of rice.

[0013] Thirdly, the present invention also protects a gene knockout vector targeting the rice gene OspPLAIIIγ shown in SEQ ID NO.1.

[0014] In a specific implementation scheme, the gene knockout vector is obtained by cloning the target sequence of the gene OspPLAIIIγ into a TKC vector, and the target sequence is obtained by annealing the primers shown in SEQ ID NO.3 and SEQ ID NO.4.

[0015] Preferably, the OspPLAIIIγ gene knockout vector containing the target sequence is obtained by performing enzyme digestion and ligation reactions between the obtained target sequence and the vector, transforming it into E. coli, and then screening and sequencing to verify the result.

[0016] Fourthly, this invention also protects the application of the gene knockout vector described above in improving the cold resistance of rice.

[0017] Fifthly, the present invention also protects the application of the gene knockout vector described above in the construction of rice varieties with improved cold resistance.

[0018] Sixthly, the present invention also protects a method for cultivating cold-resistant rice, which obtains cold-resistant rice by inhibiting, reducing or silencing the expression level of the rice gene OspPLAIIIγ as described in claim 1 in the target rice, or by inhibiting, reducing or silencing the activity and / or content of the protein as described in claim 3.

[0019] The vectors described herein are well-known to those skilled in the art and include, but are not limited to: plasmids, bacteriophages (such as λ phage or M13 filamentous phage), granules (i.e., Cosmids), Ti plasmids, or viral vectors. Specifically, it may be a TKC vector.

[0020] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0021] This invention proposes a strategy to improve the cold tolerance of rice by regulating the expression of the OspPLAIIIγ gene. This technology can effectively improve the growth adaptability of rice in cold environments, providing new ideas for rice breeding. Furthermore, the cold-tolerant gene and its application technology provided by this invention not only enhance the resistance of rice to low-temperature conditions but also provide a reference for improving the cold tolerance of other crops. With global climate change leading to increasingly severe low-temperature environments, this technology has broad application prospects and can help agricultural production better cope with the challenges posed by cold weather. Attached Figure Description

[0022] Figure 1 TKC vector map for CRISPR-Cas9

[0023] Figure 2 CRISPR-Cas9 knockout target and mutation sites diagram

[0024] Figure 3 Schematic diagram of cold tolerance identification of wild-type (WT) and mutant (ospplaIIIγ-1, ospplaIIIγ-2) plants.

[0025] Figure 4 Phenotypic quantification data of OspPLAIIIγ gene-related materials under cold treatment Detailed Implementation

[0026] The following examples are provided to better understand the present invention, but are not intended to limit the invention. Unless otherwise specified, the experimental methods used in the following examples are conventional methods. Unless otherwise specified, the experimental materials used in the following examples were purchased from conventional biochemical reagent stores.

[0027] Example 1: Cloning of the rice cold tolerance gene OspPLAIIIγ

[0028] (1) Rice RNA extraction

[0029] 0.2 g of young rice leaves were used to extract total RNA using the Trizol method. The purity of RNA was assessed by measuring its concentration and A260 / A280 ratio; the integrity of RNA was verified by agarose gel electrophoresis.

[0030] (2) Obtaining rice cDNA by reverse transcription

[0031] Residual genomic DNA was removed from the RNA and cDNA was obtained by reverse transcription, following the instructions of TaKaRa's PrimeScript™ RTreagent Kit with gDNAeraser (Perfect Real Time).

[0032] The reaction conditions were: incubation at 42°C for 30 min in a PCR instrument, followed by heating at 85°C for 5 sec to inactivate Prime Script RTEnzyme Mix and gDNAEraser.

[0033] (3) Obtaining the OspPLAIIIγ gene

[0034] Primers were designed using Primer3 Plus software, controlling the GC content between 40% and 60%. Cloning primers OspPLAIIIγ-F and OspPLAIIIγ-R were designed for PCR amplification to obtain the full-length coding region of OspPLAIIIγ. The primer sequences were: OspPLAIIIγ-F: 5'ATGGAGCCGGCCGCCGCCGC 3'; OspPLAIIIγ-R: 5'CTACAGGATGGTGGTGAACA 3'. The success of the amplification was verified using 1% agarose gel electrophoresis. Finally, sequencing results showed that the OspPLAIIIγ coding region sequence was consistent with the OspPLAIIIγ coding region sequence annotated in the rice genome data.

[0035] Example 2: Construction of OspPLAIIIγ gene knockout expression vector

[0036] The CRISPR website (http: / / crispr.hzau.edu.cn / cgi-bin / CRISPR / CRISPR) was used to screen for exon sequences with high specificity for the OspPLAIIIγ gene as targets. The target sequences were then cloned into TKC (vector map see...). Figure 1 The TKC vector is disclosed in the following literature: He Y, Zhu M, Wang L, Wu J, Wang Q, Wang R, Zhao Y. Programmed Self-Elimination of the CRISPR / Cas9 Construct Greatly Accelerates the Isolation of Edited and Transgene-Free RicePlants. Mol Plant, 2018, 11(9): 1210-1213. The OspPLAIIIγ knockout vector was obtained by sequencing. The process is as follows:

[0037] (1) Primers were synthesized based on the target sequence. The sequence information is as follows:

[0038] Primer1 SEQ ID NO.3: 5'CGACGGCGCCACCCGCATCGCGG 3';

[0039] Primer2 SEQ ID NO. 4: 5'CCGCGATGCGGGTGGCGCCGTCG 3'.

[0040] (2) Dissolve the above primer sequences in 1×TE to prepare a 100μM stock solution. Use primer1 and primer2 as the front and back primers respectively, and add 1μL of each to 98μL of 0.5×TE solution to mix and dilute to 1μM.

[0041] (3) Hold at 95℃ for 3 minutes, then move to room temperature to cool and complete the annealing.

[0042] (4) The enzyme digestion and ligation system (Thermo Scientific) is as follows:

[0043]

[0044] The reaction program was as follows: incubation at 37℃ for 5 min, followed by incubation at 20℃ for 5 min. These two conditions were maintained for 10 cycles. The amplification reaction was performed using a BIO-RAD T100 thermal cycler. The product was transformed into *E. coli* DH5α competent cells (Beijing Tiangen CB101), and positive clones were selected for sequencing. Sequencing results showed that the obtained fragment was an OspPLAIIIγ knockout vector containing the target sequence, named pTKC-OspPLAIIIγ.

[0045] Example 3: Genetic transformation of rice

[0046] All rice transformations were performed using Agrobacterium-mediated genetic transformation (Agb. EHA105). The specific steps of the Agrobacterium-mediated genetic transformation method are as follows:

[0047] (1) Obtaining recombinant Agrobacterium

[0048] The pTKC-OspPLAIIIγ vector was transformed into Agrobacterium tumefaciens strain EHA105 (purchased from Ingenium Biotech, USA) using a freeze-thaw method to obtain a recombinant strain. The plasmid was extracted and identified by PCR. The correctly identified recombinant strain was named EH-pTKC-OspPLAIIIγ.

[0049] (2) Transformation of Agrobacterium

[0050] Seed treatment: Select mature and plump rice seeds, remove the husks, disinfect with 75% alcohol for 1-2 minutes, and discard the alcohol; add 0.15% mercuric chloride (containing 0.1% Tween 20) for 10 minutes and then discard the mercuric chloride; rinse 6 times with sterile distilled water. Inoculate the seeds into callus induction medium and culture at 28℃ under light for 20 days.

[0051] Agrobacterium preparation: Agrobacterium EHA105 transformed with pTKC-OspPLAIIIγ vector was streaked onto LB agar plates containing 20 mg / L LRif and 50 mg / L Kan, and cultured at 28°C for 2 days; single colonies were picked and cultured in LB liquid medium at 28°C and 200 rpm for 2 days; before infection, the bacterial culture was scraped into suspension medium and shaken at 28°C and 180 rpm for 3-3.5 h, and adjusted to OD600 = 0.1-0.15.

[0052] Callus infection: Rice callus with a diameter of 2-4 mm was immersed in bacterial solution for 20 min, the surface bacterial solution was blotted dry and covered with sterile filter paper, dried in a clean bench for 30 min, and then transferred to co-culture medium covered with sterile filter paper. It was incubated in the dark at 20℃ overnight, and then incubated in the dark at 25℃ for 2 days.

[0053] Cleaning and screening: After co-culturing, the callus was washed 7-8 times with sterile distilled water, and finally soaked in sterile water containing 500 mg / L carbenicillin for 30 min. The solution was discarded, and the surface moisture was blotted dry. The callus was then dried in a clean bench for 1 h. The cleaned callus was placed in a screening medium containing hygromycin and cultured at 32°C under light for 14 days.

[0054] (3) Differentiation and regeneration of callus tissue

[0055] After 14 days of selection, the resistant callus was transferred to differentiation medium and cultured at 28°C (photoperiod of 14h light / 10h dark). Once the resistant callus formed 3-4cm tall regenerated seedlings on the differentiation medium, it was transferred to rooting medium and cultured until complete transgenic rice plants were formed. Hygromycin was used to screen homozygous transgenic plants from the self-pollinated progeny of the transgenic rice. Example 4: Cold tolerance identification of wild-type and OspPLAIIIγ gene mutant plants.

[0056] Wild-type and OspPLAIIIγ mutant rice seeds were disinfected in a 2.5% sodium hypochlorite solution for 20 minutes (do not over-sterilize), followed by rinsing five times with sterile deionized water. After rinsing, the seeds were evenly spread on filter paper, an appropriate amount of sterile water was added, and the seeds were placed in an incubator at 28°C for germination. Three days later, the germinated seeds were transferred to 96-well hydroponic boxes, with 40 seeds of each variety (wild-type, OspPLAIIIγ mutants: OspPLAIIIγ-1 and OspPLAIIIγ-2) planted, and three biological replicates were set up. The growth conditions were: 13 hours of light, 11 hours of darkness, light intensity of 40,000 LUX, temperature of 28°C during light, temperature of 25°C during darkness, and relative humidity of 75%.

[0057] Two weeks after the seedlings reached maturity, they were transferred to an artificial climate chamber for cold tolerance assessment. The cold treatment conditions were: 13 hours of light followed by 11 hours of darkness, light intensity of 40,000 LUX, temperature of 4°C during light exposure and 4°C during darkness, and relative humidity of 70%. After 5 days of cold treatment, the seedlings were removed and restored to normal growth conditions: 13 hours of light followed by 11 hours of darkness, light intensity of 40,000 LUX, temperature of 28°C during light exposure and 25°C during darkness, and relative humidity of 70%. After 7 days of recovery, the survival rate was calculated by the ratio of surviving seedlings to the total number of seedlings, and the ion leakage rate was measured.

[0058] Figure 3 The study demonstrates the growth status and physiological responses of OspPLAIIIγ gene mutants and wild-type rice under low-temperature stress. Figure 3AD analysis showed that under normal growth conditions, the mutants ospplaIIIγ-1 and ospplaIIIγ-2 exhibited growth characteristics largely consistent with wild-type rice. However, after 5 days of cold treatment, the mutants showed significantly better growth performance than the wild type. Figure 4 AD analysis showed that after 5 days of cold stress, the survival rates of ospplaIIIγ-1 and ospplaIIIγ-2 were 61.25% and 69.55%, respectively, significantly higher than the wild-type's 37.58% and 44.36%. Furthermore, the ion leakage rates of the mutants ospplaIIIγ-1 and ospplaIIIγ-2 were 45.25% and 47.65%, respectively, significantly lower than the wild-type's 74.36% and 73.16%. These results indicate that the OspPLAIIIγ gene plays a crucial role in regulating cold tolerance in rice.

[0059] The cold-resistant gene and its application technology provided by this invention can significantly enhance the adaptability and resistance of rice to low-temperature environments, and are expected to improve rice yield and stability in the context of global climate change. Through gene editing technology, precision breeding can be achieved, thereby reducing reliance on traditional breeding methods and improving the sustainability of rice production. This innovative approach not only enhances rice's ability to cope with cold environments but also provides a more feasible solution for future agricultural production.

[0060] The present invention has been described in detail above with general descriptions and specific embodiments. However, modifications or improvements can be made to the present invention, which will be obvious to those skilled in the art. Therefore, all such modifications or improvements made without departing from the spirit of the present invention are within the scope of protection claimed by the present invention.

Claims

1. The application of the rice gene OspPLAIIIγ in regulating cold tolerance in rice, characterized in that, The nucleotide sequence of the rice gene OspPLAIIIγ is shown in SEQ ID NO.

1.

2. The application according to claim 1, characterized in that, Knocking out the rice gene OspPLAIIIγ can improve the cold tolerance of rice.

3. The application of the protein encoded by the rice gene OspPLAIIIγ in regulating cold tolerance in rice, characterized by: The amino acid sequence of the protein encoded by the rice gene OspPLAIIIγ is shown in SEQ ID NO.

2.

4. The application according to claim 3, characterized in that, Knocking out the rice gene OspPLAIIIγ, causing its encoded protein to be unexpressed or inactivated, can improve the cold tolerance of rice.

5. Gene knockout vector targeting the rice gene OspPLAIIIγ shown in SEQ ID NO.

1.

6. The gene knockout vector according to claim 5, characterized in that, The gene knockout vector is obtained by cloning the target sequence of the OspPLAIIIγ gene into a TKC vector. The target sequence of the OspPLAIIIγ gene is obtained by annealing with the primers shown in SEQ ID NO.3 and SEQ ID NO.

4.

7. The application of the gene knockout vector according to claim 5 or 6 in improving the cold resistance of rice.

8. The application of the gene knockout vector according to claim 5 or 6 in the construction of rice varieties with improved cold resistance.

9. A method for cultivating cold-resistant rice, characterized in that, Cold-resistant rice is obtained by inhibiting, reducing, or silencing the expression level of the rice gene OspPLAIIIγ as described in claim 1 in the target rice, or by inhibiting, reducing, or silencing the activity and / or content of the protein as described in claim 3.

Images