Application of genetic marker associated with feed intake in laying period of chicken in genetic breeding of chicken
By applying the FI_chr27_1 genetic marker for early selection in chicken genetic breeding, the problem of difficulty in reducing feed intake of laying hens during the laying period was solved, feed utilization efficiency was improved, and breeding income was increased.
Patent Information
- Application Number
- CN202510925215.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-07-04
- Publication Date
- 2025-10-28
AI Technical Summary
Existing technologies make it difficult to effectively reduce the feed intake of laying hens during the laying period through genomic selection, resulting in high feed costs and difficulty in achieving efficient utilization.
The FI_chr27_1 genetic marker was used for early selection. The feed intake trait during the laying period was selected by detecting the genotype of the chickens. The genotype was determined using PCR amplification and sequencing technology to screen out chicken breeds with low feed intake.
This approach has enabled the reduction of feed intake during the egg-laying period in chickens through genetic breeding, thereby improving feed utilization efficiency and increasing farming profits.
Smart Images
Figure CN120843689A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the fields of animal genetics and breeding and biotechnology, and specifically relates to the application of genetic markers associated with feed intake during the egg-laying period of chickens in chicken genetics and breeding. Background Technology
[0002] Feed intake in laying hens is crucial to poultry farming profitability, animal welfare, and the sustainable development of chicken production. In recent years, the competition between humans and livestock for food has drawn widespread social attention, while also reflecting a new direction in laying hen genetic breeding research: "how to reduce feed intake while maintaining existing egg production performance." From a genetic breeding perspective, reducing feed intake while improving production performance is a sustainable breeding path because genetic progress is both permanent and cumulative. Based on microsatellite sequence polymorphism and linkage analysis methods, several QTLs (quantitative trait loci) linked to feed intake have been published. Due to the uneven distribution and limited number of microsatellite markers on the genome, the confidence intervals of QTLs for feed intake traits obtained through linkage analysis are often large, making them difficult to use in breeding practice. With the advancement of sequencing technology, genome-wide association studies (GWAS) have opened up new perspectives for elucidating the genetic structure of feed intake during the laying period in chickens. Feed intake in chickens is a quantitative trait regulated by multiple genes with minor effects. Conventional breeding methods are unlikely to make effective progress in terms of genetics. Only by clarifying the genetic structure of feed intake during the laying period and improving the accuracy of breeding through genomic selection can we obtain new chicken breeds or breeding lines that utilize feed efficiently and meet the needs of the egg-laying hen industry. Summary of the Invention
[0003] To address the problem of excessively high feed costs in chicken production, this invention provides the application of genetic markers associated with feed intake during the egg-laying period in chicken genetic breeding. The genetic markers associated with feed intake during the egg-laying period include FI_chr27_1. FI_chr27_1 can assist in the selection of chicken breeds that utilize feed efficiently, thereby reducing feed intake and increasing the profitability of chicken farming.
[0004] This invention is achieved through the following technical solution: This invention provides the application of genetic markers associated with feed intake during the egg-laying period in chicken genetic breeding. The genetic markers associated with feed intake during the egg-laying period include FI_chr27_1, which is numbered rs316307809 and corresponds to the sequence information of chromosome 27, position 3236986, of the chicken reference genome bGalGal1.mat.broiler.GRCg7b version published in NCBI. It belongs to the upstream sequence of gene MPP3, and the bases here are G or C.
[0005] Based on the same inventive concept, the present invention provides a method for early selection of chicken feed intake traits during the egg-laying period, the early selection method comprising early selection of chicken feed intake traits during the egg-laying period based on the genotype of the genetic marker FI_chr27_1; The FI_chr27_1 corresponds to the sequence information of the chicken reference genome version bGalGal1.mat.broiler.GRCg7b published in NCBI, position 3236986 on chromosome 27, belonging to the upstream sequence of gene MPP3, where the base is G or C.
[0006] Furthermore, the early selection method specifically includes: The genotype of the FI_chr27_1 strain in the test chickens was detected; Early selection of feed intake during the laying period of the test chickens was carried out based on the genotype of FI_chr27_1. Among them, the feed intake during the egg-laying period of the CC genotype individuals of FI_chr27_1 is greater than that of the GC genotype individuals, and the feed intake during the egg-laying period of the GC genotype individuals is greater than that of the GG genotype individuals.
[0007] Furthermore, the detection of the FI_chr27_1 genotype in the test chicken specifically includes: Using P27_FI1f and P27_FI1r as primers, PCR amplification was performed on the genomic DNA of the chickens to be tested; The PCR amplification products were sequenced to obtain the genotype at position 3236986 on chromosome 27 of the chicken to be tested; The nucleotide sequence of P27_FI1f is shown in SEQ ID NO.1; the nucleotide sequence of P27_FI1r is shown in SEQ ID NO.2.
[0008] Furthermore, the breeds of chickens to be tested include Dongxiang Green-shelled Egg Chicken and / or White Leghorn Chicken.
[0009] Based on the same inventive concept, the present invention provides detection primers for genetic markers associated with feed intake during the laying period of chickens, said detection primers including P27_FI1f and P27_FI1r; The nucleotide sequence of P27_FI1f is shown in SEQ ID NO.1, and the nucleotide sequence of P27_FI1r is shown in SEQ ID NO.2.
[0010] Based on the same inventive concept, this invention provides the application of detection primers for genetic markers associated with feed intake during the egg-laying period of chickens in chicken genetic breeding.
[0011] Based on the same inventive concept, the present invention provides a kit containing detection primers for the genetic markers associated with feed intake during the egg-laying period of chickens.
[0012] Based on the same inventive concept, the present invention also provides an application of a reagent kit in chicken genetic breeding.
[0013] One or more technical solutions in the embodiments of the present invention have at least the following technical effects or advantages: This invention relates to the application of genetic markers associated with feed intake during the egg-laying period in chicken genetic breeding. The genetic marker associated with feed intake during the egg-laying period is FI_chr27_1. FI_chr27_1 is associated with feed intake during the egg-laying period, and populations with favorable genotypes have lower average feed intake, which helps to genetically reduce feed intake during the egg-laying period. Applying FI_chr27_1 to chicken genetic breeding is beneficial to obtaining chicken breeds with higher feed utilization efficiency, thereby increasing breeding profits by reducing feed intake. Attached Figure Description
[0014] In order to more clearly illustrate the technical solutions in the embodiments of the present invention, the following is a brief introduction to the drawings required for use in the description of the embodiments. Obviously, the drawings described below are some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.
[0015] Figure 1 Manhattan plot of GWAS analysis of bi-weekly feed intake during the egg-laying period of the resource population in Embodiment 2 of the present invention; Figure 2 This is a GWAS analysis QQ plot of feed intake during the egg-laying period of the resource population in Embodiment 2 of the present invention. Figure 3 This is a graph showing the association between the genotype of the genetic marker FI_chr27_1 of this invention and food intake. Detailed Implementation
[0016] The present invention will be described in detail below in conjunction with specific embodiments and examples, and the advantages and various effects of the present invention will be more clearly presented. It should be understood by those skilled in the art that these specific embodiments and examples are for illustrating the present invention, rather than for limiting the present invention.
[0017] Throughout this specification, unless otherwise specified, the terms used herein should be understood as having the same meaning as commonly used in the art. Therefore, unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In the event of any conflict, the present specification shall take precedence.
[0018] Unless otherwise specified, various raw materials, reagents, instruments and equipment used in the present invention can be purchased from the market or prepared by existing methods.
[0019] The following will provide a detailed description of the application of the genetic markers associated with feed intake during the egg-laying period in chicken genetic breeding, in conjunction with embodiments and experimental data.
[0020] Example 1 Resource population construction and data processing of feed intake during the egg-laying period Feed intake data during the laying period were collected from the laying hen population of Jiangsu Provincial Institute of Poultry Science. For details on population construction, please refer to the literature already published by our research team (Guo Jun et al. Analysis of genetic parameters of egg yolk quality using random regression model [J]. Journal of Nanjing Agricultural University, 2016, 39(1): 145-149.). In short, Dongxiang green-shelled chickens and white Leghorn chickens were used as parents, and F1 and F2 generations were obtained through reciprocal crosses. The experimental chickens were housed individually in traditional A-type cages, cooled by fans and evaporative cooling pads, and fed and cleaned mechanically. Feed was supplied by COFCO, and the feed composition for laying hens included 16.5% crude protein and 11,511 kJ / kg metabolizable energy. During the laying period, chickens had free access to feed and were provided with water via nipple drinkers. Routine immunization was performed according to the immunization program established by Jiangsu Provincial Institute of Poultry Science. Feed intake data were collected from F2 generation experimental chickens at 57 to 60 weeks of age. During the trial, feed consumption was measured weekly and body weight was measured every four weeks.
[0021] After initial screening of pedigree records and production data to remove obvious errors and duplicates, outliers were removed, and the data was organized into a tabular format. Following data cleaning, the feed intake dataset for the resource population contained 7142 records from 1786 chickens. Then, WOMBAT software was used to analyze the covariance components of feed intake and genetic parameters.
[0022] Example 2 GWAS analysis of feed intake during egg production Approximately 2 ml of blood was collected from the wing vein of experimental chickens using a disposable syringe, placed in an EDTA anticoagulant tube, and stored at -70 ℃. Genomic DNA was extracted from the blood sample, and detected by 0.8% agarose gel electrophoresis and ultraviolet spectrophotometry. After passing the tests, the DNA sample was diluted to 50±5 ng / μl for gene chip typing.
[0023] Genotyping was performed using the Affymetrix® Axiom® 600K Chicken Genotyping Array from Affymetrix. Data quality control was performed according to the array's instruction manual, including: pre-genotyping quality control using APT software; PLINK quality control to remove SNPs with a detection rate below 0.97 and those deviating from Hardy-Weinberg equilibrium; SNP screening using metrics.R, SNP_filter.R, and SNP, CR, and FLD information analysis; and genotyping using BEAGLE. After quality control, 435,867 SNPs and 1,512 samples remained for subsequent analysis.
[0024] Prior to genome-wide association analysis, multidimensional principal component analysis was performed to eliminate false positives. The first five principal components were added as covariate parameters to the genetic model, and the coop effect and body weight at 60 weeks of age were included as model fixation effects. Gemma software was used to analyze bi-weekly feed intake during the laying period using a two-trait model, and the p-values for the significance tests of each SNP marker were obtained. The matrix expression of the linear model is as follows:
[0025] Where y represents the phenotypic value vector of the sample feed intake; W represents the covariance matrix; α is the intercept vector; x is the genotype vector of the marker; u is the random effects vector; and ε is the residual.
[0026] The independence test estimate for each SNP was calculated using the "simpleM" method in R scripts, yielding 59,308 independent markers. After Bonferroni correction, the genomic significance threshold was determined to be 8.43 × 10⁻⁶. -7 The suggested threshold for genome sequencing is 1.69 × 10⁻⁶. -5 GWAS analysis revealed the genetic marker FI_chr27_1, associated with feed intake during the egg-laying period (Table 1). Figure 1 It is known that significant genomic markers exist on chicken chromosome 27. Furthermore, significant genomic markers were also detected on chromosomes 1 and 24. (Appendix) Figure 2 The QQ graph was analyzed using GWAS, further validating the GWAS analysis results.
[0027] Table 1. SNP genetic markers associated with feed intake during egg production in chickens
[0028] Wherein: the physical location of the marker chromosome is referenced to the whole chicken genome (bGalGal1.mat.broiler.GRCg7b).
[0029] Example 3 Detection and validation of genetic markers Candidate gene association analysis was performed on the Dongxiang Green-shelled Egg Chicken-Leihun Chicken resource population using the aforementioned SNP genetic markers. The specific steps are as follows: 1) PCR primers: DNA template sequence information was downloaded from the NCBI website, and PCR amplification primers were designed using Primer Premier 6.0 software. Primer information is shown in Table 2. PCR primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd.
[0030] Table 2. Amplification primers used to detect genetic markers of feed intake during egg production in chickens.
[0031] 2) Genomic DNA extraction: Genomic DNA was extracted from 1512 blood samples using the CTAB method. After passing the tests by UV spectrophotometer and agarose electrophoresis, PCR amplification was performed.
[0032] 3) PCR amplification process: ① Reaction system: The 10μl system includes 50ng of DNA template for identification, 10ng each of forward and reverse primers, 5μL of 2×power Taq MasterMix, and the remaining volume is made up with ultrapure water.
[0033] ②Reaction procedure: First, denature at 94℃ for 30s, anneal at 56.3℃ for 30s, extend at 72℃ for 30s, for a total of 5 cycles; then, denature at 94℃ for 30s, anneal at 56.3℃ for 30s, extend at 72℃ for 30s, for a total of 30 cycles; extend at 72℃ for 5min, and store at 4℃.
[0034] 4) The amplified product was sent to a sequencing company for sequence polymorphism detection. The nucleotide sequence of the amplified fragment is as follows: FI_chr27_1 GCAATTAGCAGCCATTACAGCCTCGCTGGGAGCAGCACAGGGATTAATGCAGCTGCTTTTAGCCTGCTGTTCTCTGCCACCGAGGAGGAAACTTTGTTAAGCAGCGATAAGCATCGAGAGC[C / G]GCATCCAGAC CAGCAGAGCCAGCCTGGCCCCGGTGCCCGCGGCTCTGCCGGACTCCGGGAAGTCCATTGCTTCCAATTCCAGCCACATGGGTGGCTGCTACAAGCAGCTTCACCCCAAAATAGTGCCTGTTGGGATTAGGTATAATC ACAGCTTTCCCAAACCCCCCCAGGATTTTCCAGTCTCAGACTCAGCACAGCTGTGCCAGGCGGGTTTGCTTCCCCAGGGTGAGTCAGGTGAAGTTGCCCAAATGAAAGACAGGCTCAATTTTAAAGCAGATTAAT TAAACTGCATTAAGGCCCTGTGTGGACAGAGTTCAGAATGAAAACAGCCTTTAACTCGATTTCTCTGACTTGCAAATTGTGGCAGGGAAGTCAGCTGAAATCACATTAAGGCCGTTTCCACTCTGAACCGTGTCCTC In the above sequences, [ ] indicates mutation sites, parentheses indicate allele variations, and the underlined parts at the beginning and end of the sequence indicate primer sequences.
[0035] 5) Association analysis: The genotypes of the subjects were obtained using the plink software, and a one-way ANOVA was performed on them and their bi-weekly feed intake during the laying period of 57-58 weeks.
[0036] The results of the association analysis between the genetic marker FI_chr27_1 and feed intake are as follows: Figure 3 As shown, the average feed intake during the egg-laying period was 1405.65 ±119.21 (GG genotype), 1429.25 ±109.39 (GC genotype), and 1441.53 ±107.55 (CC genotype).
[0037] In summary, GG is the favorable genotype for the genetic marker FI_chr27_1.
[0038] Finally, it should be noted that the terms "comprises," "includes," or any other variations thereof are intended to cover non-exclusive inclusion, such that a process, method, article, or apparatus that includes a list of elements includes not only those elements, but also other elements not expressly listed, or elements inherent to such process, method, article, or apparatus.
[0039] Although the preferred embodiments of the present invention have been described, those skilled in the art may make additional changes and modifications to these embodiments once they have learned the basic creative concept. Therefore, the appended claims are intended to be interpreted as including the preferred embodiments and all changes and modifications that fall within the scope of the present invention.
[0040] Obviously, those skilled in the art can make various modifications and variations to this invention without departing from its spirit and scope. Therefore, if these modifications and variations fall within the scope of the claims of this invention and their equivalents, this invention also intends to include these modifications and variations.
Claims
1. The application of genetic markers associated with feed intake during the egg-laying period in chicken genetic breeding, characterized in that, The genetic marker associated with feed intake during the egg-laying period includes FI_chr27_1, which is numbered rs316307809. It corresponds to the sequence information of chromosome 27, position 3236986, of the chicken reference genome bGalGal1.mat.broiler.GRCg7b version published in NCBI. It belongs to the upstream sequence of gene MPP3, and the bases here are G or C.
2. An early selection method for feed intake traits during the laying period in chickens, characterized in that, The early selection method includes early selection of feed intake traits during the egg-laying period of chickens based on the genotype of the genetic marker FI_chr27_1; The FI_chr27_1 corresponds to the sequence information of the chicken reference genome version bGalGal1.mat.broiler.GRCg7b published in NCBI, position 3236986 on chromosome 27, belonging to the upstream sequence of gene MPP3, where the base is G or C.
3. The method for early selection of chickens regarding feed intake traits during the egg-laying period according to claim 2, characterized in that, The early selection method specifically includes: The genotype of the FI_chr27_1 strain in the test chickens was detected; Early selection of feed intake during the laying period of the test chickens was carried out based on the genotype of FI_chr27_1. Among them, the feed intake during the egg-laying period of the CC genotype individuals of FI_chr27_1 is greater than that of the GC genotype individuals, and the feed intake during the egg-laying period of the GC genotype individuals is greater than that of the GG genotype individuals.
4. The method for early selection of chickens regarding feed intake traits during the egg-laying period according to claim 3, characterized in that, The detection of the FI_chr27_1 genotype in the test chicken specifically includes: Using P27_FI1f and P27_FI1r as primers, PCR amplification was performed on the genomic DNA of the chickens to be tested; The PCR amplification products were sequenced to obtain the genotype at position 3236986 on chromosome 27 of the chicken to be tested; The nucleotide sequence of P27_FI1f is shown in SEQ ID NO.1; the nucleotide sequence of P27_FI1r is shown in SEQ ID NO.
2.
5. The method for early selection of chickens regarding feed intake traits during the egg-laying period according to claim 2, characterized in that, The breeds of chickens to be tested include Dongxiang Green-shelled Egg Chicken and / or White Leghorn Chicken.
6. Primers for detecting genetic markers associated with feed intake during the egg-laying period in chickens, characterized in that, The detection primers include P27_FI1f and P27_FI1r; The nucleotide sequence of P27_FI1f is shown in SEQ ID NO.1, and the nucleotide sequence of P27_FI1r is shown in SEQ ID NO.
2.
7. The application of the detection primers for genetic markers associated with feed intake during the egg-laying period of chickens as described in claim 6 in chicken genetic breeding.
8. A reagent kit, characterized in that, The kit contains the detection primers for the genetic markers associated with feed intake during the egg-laying period of chickens as described in claim 6.
9. The application of the kit as described in claim 8 in chicken genetic breeding.