A SNP molecular marker related to salt and alkali tolerance of leymus chinensis in germination stage, amplification primer and application thereof
By developing a SNP molecular marker at base 184482188 of the 3Xm chromosome of Leymus chinensis and its detection primers, and combining PCR amplification and restriction endonuclease digestion, the problem of screening salt-alkali tolerance during the germination period in existing technologies has been solved, enabling early screening of salt-alkali tolerant materials and significantly accelerating the breeding process.
Patent Information
- Application Number
- CN202511358325.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-09-23
- Publication Date
- 2025-12-09
- Estimated Expiration
- 2045-09-23
AI Technical Summary
The lack of effective molecular markers in existing technologies for screening salt and alkali tolerance during the germination period of Leymus chinensis results in long breeding cycles and low efficiency. It is impossible to screen for salt and alkali tolerance during the germination period, and evaluation must be carried out after the material flowers and fruits.
A molecular marker for SNP located at base 184482188 on chromosome 3Xm of Leymus chinensis and its detection primers were developed. By PCR amplification combined with restriction endonuclease digestion, the C and T genotypes were distinguished and used for salt and alkali tolerance screening during germination, providing a rapid and accurate method for genotype identification.
This method enables direct screening of salt- and alkali-tolerant individuals during the vegetative growth period of Leymus chinensis, significantly shortening the breeding cycle and improving breeding efficiency.
Smart Images

Figure CN120843732B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the technical field of plant molecular markers, and particularly relates to a SNP molecular marker related to salt-alkali tolerance of Leymus chinensis at germination stage, an amplification primer and application thereof. BACKGROUND
[0002] Leymus chinensis (Trin.) Tzvel., also known as alkali grass, is a perennial rhizomatous plant of the genus Leymus in the family Poaceae, and is also an important constructive species of the meadow steppe and typical steppe in the eastern grassland region of Eurasia. It is widely distributed in Heilongjiang, Jilin, Liaoning, Inner Mongolia, Hebei and Shanxi, China. Leymus chinensis not only has high nutritional value, good palatability, strong rhizome penetration and expansion ability, and can bind and hold soil and maintain water and soil, but also has excellent traits such as cold tolerance, salt-alkali tolerance and drought tolerance. It is a forage grass with important economic and ecological values, and is often used for salt-alkali land improvement, desertification land management and degraded grassland restoration. Breeding new varieties of salt-alkali tolerant Leymus chinensis can not only effectively utilize salt-alkali land for forage production and relieve the pressure on arable land, but also improve salt-alkali land and restore grassland ecology.
[0003] In the existing breeding practice of Leymus chinensis, important agronomic traits are mostly selected indirectly through phenotypes, resulting in long breeding cycles, low efficiency and restricting the progress of Leymus chinensis breeding. Marker-assisted selection, especially the use of molecular markers associated with target traits for assisted selection, can change traditional phenotypic selection to direct genotypic selection, thereby greatly improving breeding efficiency and accelerating genetic improvement. Therefore, it is of great significance to develop molecular markers related to salt-alkali tolerance of Leymus chinensis and carry out assisted selection breeding research.
[0004] The seed germination stage is particularly sensitive to salt-alkali stress as the starting point of plant growth. Salt-alkali environment can inhibit normal respiration of seeds, reduce their activity, and even cause delayed germination or death. Therefore, screening of salt-alkali tolerant Leymus chinensis germplasm resources at the germination stage is crucial for breeding new varieties of salt-alkali tolerant Leymus chinensis. In breeding practice, germination rate is often used as an indicator to evaluate salt-alkali tolerance of Leymus chinensis at the germination stage, and molecular markers linked to germination rate under salt-alkali conditions still need to be explored. At present, there is no available molecular marker for assisted screening of salt-alkali tolerance of Leymus chinensis at the germination stage, and evaluation of salt-alkali tolerance at the germination stage has to wait until the material flowers and sets seeds. Therefore, selection of salt-alkali tolerant Leymus chinensis materials as breeding parents is limited by the problem of growth period, and screening has to wait until flowering and seed setting. SUMMARY
[0005] In view of the defects in the prior art, the present application provides a SNP molecular marker related to salt and alkali tolerance of L. chinensis at germination stage, an amplification primer and an application thereof. The present application develops a molecular marker related to salt and alkali tolerance at germination stage, so that the germplasm resources with salt and alkali tolerance at germination stage can be screened during the vegetative growth stage of L. chinensis, and the breeding process is greatly accelerated.
[0006] The present application provides a SNP molecular marker related to salt and alkali tolerance of L. chinensis at germination stage, wherein the SNP molecular marker is located at the 184482188 base of 3Xm chromosome of L. chinensis, and the polymorphism is C or T; the sequence of the C genotype is shown in SEQ ID NO. 3, and the sequence of the T genotype is shown in SEQ ID NO. 4.
[0007] In some embodiments, the L. chinensis with the C genotype has a significantly higher relative germination rate under salt and alkali conditions than the L. chinensis with the T genotype.
[0008] The present application also provides a detection primer of the SNP molecular marker, and the detection primer is shown in SEQ ID NO. 1-2.
[0009] The present application also provides a detection kit comprising the detection primer.
[0010] The present application also provides an application of any one of the SNP molecular marker, the detection primer and the detection kit in distinguishing the salt and alkali tolerance at germination stage of L. chinensis.
[0011] The present application also provides an application of any one of the SNP molecular marker, the detection primer and the detection kit in preparing a reagent for distinguishing the salt and alkali tolerance at germination stage of L. chinensis.
[0012] The present application also provides an application of any one of the SNP molecular marker, the detection primer and the detection kit in identifying an individual of L. chinensis with salt and alkali tolerance at germination stage, in population breeding or in maintaining a L. chinensis strain with salt and alkali tolerance at germination stage.
[0013] The present application also provides a breeding method of a L. chinensis variety, comprising the following steps:
[0014] (1) extracting genomic DNA of a L. chinensis individual at germination stage;
[0015] (2) performing PCR amplification on the genomic DNA by using the detection primer;
[0016] (3) performing restriction enzyme digestion and electrophoresis detection on the amplification product, and determining the genotype of the SNP molecular marker;
[0017] (4) selecting a L. chinensis individual with the C genotype as a backup parent for breeding a L. chinensis variety with salt and alkali tolerance at germination stage.
[0018] In some embodiments, the restriction enzyme is HindIII, and the C genotype and the T genotype are distinguished by recognition and cutting of the PCR amplification product by HindIII.
[0019] The application also provides a method for screening salt-tolerant Leymus chinensis in the germination stage, comprising using the SNP molecular marker to identify the genotype of the Leymus chinensis germplasm resource, so as to predict and screen Leymus chinensis individuals or populations with stronger salt-tolerance.
[0020] Compared with the prior art, the application has the following technical effects:
[0021] 1. The application first identifies a SNP site significantly related to salt-tolerance in the germination stage in Leymus chinensis, and determines the genotype-salt-tolerance phenotype correlation, thereby providing a reliable genetic marker for salt-tolerance molecular breeding of Leymus chinensis.
[0022] 2. The application designs specific primers based on the SNP site, and establishes a rapid and accurate genotype identification method. By PCR amplification combined with restriction enzyme HindIII cutting, the C homozygous and C / T heterozygous genotypes can be directly distinguished, and the operation is simple, and the result is stable and reliable.
[0023] 3. By using the molecular marker provided by the application, molecular marker-assisted selection of salt-tolerance in the germination stage can be realized in the early stage of Leymus chinensis breeding, and the breeding cycle is significantly shortened and the breeding efficiency is improved by avoiding relying on phenotype identification alone.
[0024] 4. The molecular marker, detection primer and detection kit of the application can be widely used in Leymus chinensis germplasm resource identification, salt-tolerant variety breeding, population improvement and excellent line maintenance, and have strong popularization and application value. BRIEF DESCRIPTION OF DRAWINGS
[0025] In order to more clearly illustrate the technical solutions of the embodiments of the application, the following will briefly introduce the drawings needed to be used in the embodiments. It should be understood that the following drawings only show some embodiments of the application, and therefore should not be regarded as a limitation to the scope, and for those skilled in the art, other related drawings can also be obtained without creative labor.
[0026] Figure 1 SNP index and related statistical results of the embodiments of the application.
[0027] Figure 2 Electrophoresis results of genotype identification of 200 Leymus chinensis germplasm resources by using the molecular marker of the embodiments of the application.
[0028] Figure 3Statistical analysis of the salt-alkali relative germination rate of two genotypes of Leymus chinensis in the embodiments of the present application. DETAILED DESCRIPTION
[0029] In order to make the persons skilled in the art better understand the present application, the technical solutions in the embodiments of the present application are described clearly and completely. Obviously, the described embodiments are only a part of the embodiments of the present application, not all the embodiments. Based on the embodiments in the present application, all other embodiments obtained by the persons skilled in the art without creative labor should belong to the protection scope of the present application.
[0030] Unless otherwise specified, the experimental methods used in the following embodiments are all conventional methods. The materials, reagents and the like used, unless otherwise specified, can be obtained from commercial channels.
[0031] Obtaining of SNP molecular markers related to salt-alkali tolerance of Leymus chinensis in the germination stage
[0032] The germination rate of 200 Leymus chinensis germplasm resources from the national cold zone crop and soybean germplasm resource medium-term bank under salt-alkali conditions was evaluated by using a culture dish germination experiment. A mixed salt-alkali solution (NaCl, Na2SO4, NaHCO3 and Na2CO3, molar ratio 1:9:9:1, total concentration 60 mM) was used to simulate the composition of soda saline soil, and the salt-alkali stress treatment was carried out during the seed germination process of Leymus chinensis. Each material was set with 3 groups of controls (distilled water) and 3 groups of salt-alkali treatments, 30 seeds in each group, which were germinated in a light incubator (light cycle 14h / 10h, temperature 25℃ / 16℃). The germination rate of each group was counted on the twentieth day, and the average germination rate of the salt-alkali group was divided by the average germination rate of the control group, that is, the salt-alkali relative germination rate of each Leymus chinensis resource.
[0033] The relative germination rates of the 200 Leymus chinensis germplasm resources were sorted, and the top 20 and the bottom 20 materials with the highest and lowest relative germination rates were selected, and the DNA was extracted, the specific method being as follows:
[0034] 0.1 g of fresh leaves was weighed, cut and put into a mortar, ground with liquid nitrogen, and then 500 μL of 2×CTAB solution was added.
[0035] The 2×CTAB solution formula is as follows: 2% CTAB, 0.1% PVP40, 20 mM EDTA (pH 8.0), 100 mM Tris-HCl (pH 8.0), 1.4 M NaCl, 1% β-mercaptoethanol.
[0036] The DNAs of the 20 materials with the highest relative germination rates were mixed in equal amounts, and the DNAs of the 20 materials with the lowest relative germination rates were mixed in equal amounts, and genome resequencing of 30-fold genome coverage was performed.
[0037] First, the sequencing data was filtered using the fastp software, and the software default filtering parameters were selected. After filtering, the cleaned data was aligned to the Leymus chinensis reference genome (Li et al., PNAS, 2023, PMID: 37874858) using the BWA software (v0.7.17-r1188). Then, the bcftools software was used to obtain variation information and perform SNP site filtering, and finally the MutMap software was used to calculate the SNP index and related statistical results.
[0038] The results are shown in Figure 1 There is a clear peak in the SNP index on chromosome 3Xm, indicating that this site may be related to the salt-tolerant ability of Leymus chinensis at the germination stage.
[0039] By analyzing the sequencing data of the two mixed pools, it was found that at the 184482188 site on chromosome 3Xm, the salt-tolerant pool was mainly C, while the salt-sensitive pool was C / T heterozygous. According to the sequence near this site, a pair of primers was designed, and the primer sequences are as follows:
[0040] Forward primer: SEQ ID NO. 1;
[0041] Reverse primer: SEQ ID NO. 2.
[0042] The above primers were used for PCR amplification of 200 Leymus chinensis germplasm resources, and the PCR reaction system was as follows: DNA template: 0.5 μL; Forward primer: 0.2 μL; Reverse primer: 0.2 μL; 2×Rapid Taq Master Mix (Novozyme, Catalog No. P222-01): 5 μL; ddH2O: 4.1 μL.
[0043] The PCR reaction program is as follows:
[0044] 95℃ pre-denaturation for 3 minutes; 95℃ denaturation for 15 seconds, 54℃ annealing for 15 seconds, 72℃ extension for 15 seconds, running for 35 cycles; finally 72℃ extension for 5 minutes. The PCR amplification product can be stored at 4℃.
[0045] The sequence of the homozygous genotype Leymus chinensis amplification product is as follows:
[0046] CTTCAGAGGTTGGATGATGGGAGTCAAGCT CAATGCATCCCTCAGCTTTTCATAAGCCTGCACACAATTCTTATCAAAGGAATATGGTACGTCTTTCTACAAAAGGTCAGTCAACGGTTTTGAGAGCTTGG (SEQ ID NO. 3).
[0047] The amplification product sequence of heterozygous Leymus chinensis is as follows:
[0048] CTTCAGAGGTTGGATGATGGGAGTCAAGCT T AATGCATCCCTCAGCTTTTCATAAGCCTGCACACAATTCTTATCAAAGGAATATGGTACGTCTTTCTACAAAAGGTCAGTCAACGGTTTTGAGAGCTTGG (SEQ ID NO. 4).
[0049] Add 0.2 μL of restriction endonuclease HindIII (NEB, catalog number R0104S) to the PCR amplification product, mix well, and digest at 37°C for 8-16 hours. Perform agarose gel electrophoresis on the reaction product.
[0050] The amplification product of homozygous Leymus chinensis could not be digested by HindIII restriction enzyme, and the band size remained at 131 bp. Half of the amplification product of heterozygous Leymus chinensis could be digested by HindIII into 26 bp and 105 bp bands. Since the 26 bp band is not easily distinguishable on agarose gel, the reaction product of heterozygous Leymus chinensis appeared as two bands of 131 bp and 105 bp on agarose gel. Figure 2 ).
[0051] The relative germination rates of two genotypes of Leymus chinensis in saline-alkali environments were statistically analyzed, and the results showed that there were significant differences in the relative germination rates of the two genotypes. Figure 3 This indicates that the molecular marker can be used for screening salt and alkali tolerance during the germination period of Leymus chinensis.
[0052] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.
[0053] sequence list
[0054] SEQ ID NO.1
[0055] CTTCAGAGGTTGGATGATGGGAGTCAAGCT
[0056] SEQ ID NO.2
[0057] CCAAGCTCTCAAAACCGTTGAC
[0058] SEQ ID NO. 3
[0059] CTTCAGAGGTTGGATGATGGGAGTCAAGCTCAATGCATCCCTCAGCTTTTCATAAGCCTGCACACAATTCTTATCAAAGGAATATGGTACGTCTTTCTACAAAAGGTCAGTCAACGGTTTTGAGAGCTTGG
[0060] SEQ ID NO. 4
[0061] CTTCAGAGGTTGGATGATGGGAGTCAAGCTTAATGCATCCCTCAGCTTTTCATAAGCCTGCACACAATTCTTATCAAAGGAATATGGTACGTCTTTCTACAAAAGGTCAGTCAACGGTTTTGAGAGCTTGG
Claims
1. A detection primer of a SNP molecular marker related to salt-tolerant ability of Leymus chinensis in germination stage is used in any one of the following: (a) identification of individuals, population breeding or maintenance of L. chinensis in germination stage with salt-tolerant ability; (b) distinguishing the salt-tolerant ability of L. chinensis in germination stage; (c) preparing a reagent for distinguishing the salt-tolerant ability of L. chinensis in germination stage. The nucleotide sequence of the SNP molecular marker is any one of the following: (1) the sequence of C genotype shown in SEQ ID NO. 3; (2) the sequence of T genotype shown in SEQ ID NO.
4. The SNP molecular marker is located at the 184482188th base of 3Xm chromosome of L. chinensis, and the polymorphism is C or T. The detection primer is shown in SEQ ID NO. 1-2.
2. Use according to claim 1, characterized in that, The L. chinensis with C genotype has a significantly higher relative germination rate under saline-alkaline conditions than that with T genotype.
3. A method for breeding a variety of Leymus chinensis, characterized in that, The method comprises the following steps: (1) extracting the genomic DNA of L. chinensis in germination stage; (2) performing PCR amplification on the genomic DNA by using the detection primer; (3) performing restriction enzyme digestion and electrophoresis detection on the amplification product to determine the genotype of the SNP molecular marker; (4) selecting the L. chinensis with C genotype as the reserve parent for breeding of L. chinensis in germination stage with salt-tolerant ability. The detection primer is shown in SEQ ID NO. 1-2. The nucleotide sequence of the SNP molecular marker is any one of the following: (1) the sequence of C genotype shown in SEQ ID NO. 3; (2) the sequence of T genotype shown in SEQ ID NO.
4. The SNP molecular marker is located at the 184482188th base of 3Xm chromosome of L. chinensis, and the polymorphism is C or T.
4. The method of breeding according to claim 3, wherein The restriction enzyme is HindIII, and the C genotype and the T genotype are distinguished by recognition and cutting of the PCR amplification product by HindIII.
5. A method for screening salt-tolerant and alkali-tolerant of leymus chinensis in germination stage, characterized in that, The method comprises genotype identification of L. chinensis germplasm resources by using the detection primer of the SNP molecular marker to predict and screen L. chinensis individuals or populations with stronger salt-tolerant ability. The detection primer is shown in SEQ ID NO. 1-2. The nucleotide sequence of the SNP molecular marker is any one of the following: (1) the sequence of C genotype shown in SEQ ID NO. 3; (2) the sequence of T genotype shown in SEQ ID NO.
4. The SNP molecular marker is located at the 184482188th base of 3Xm chromosome of L. chinensis, and the polymorphism is C or T.
Citation Information
Patent Citations
Saline-alkali tolerant major QTL site on brassica napus A04 chromosome, molecular marker and application
CN117965782A
SNP molecular marker related to drought resistance character of leymus chinensis and application
CN119120764A