DNA compositions comprising modified cytosine

Abstract

The present disclosure provides, for example, double stranded DNA (dsDNA) molecules comprising chemically modified cytosine nucleotides. In some embodiments, the dsDNA molecules comprise a therapeutic load sequence. In some embodiments, the dsDNA molecules are resistant to endonuclease digestion and / or to immunosensor recognition, and support the expression of a therapeutic load encoded in the dsDNA molecules. The present disclosure also provides, for example, pharmaceutical compositions comprising dsDNA molecules comprising chemically modified cytosine nucleotides.

Description

[0001] Related applications

[0002] This application claims priority to U.S. Serial No. 63 / 485,787, filed February 17, 2023, and U.S. Serial No. 63 / 594,806, filed October 31, 2023, the entire contents of each of which are incorporated herein by reference.

[0003] sequence list

[0004] This application contains a sequence list, which has been electronically submitted in XML format and is hereby incorporated by reference in its entirety. The XML copy created on February 6, 2024, is named F2128-7007WO_SL.xml and has a size of 73,983 bytes. Background Technology

[0005] Novel treatments are needed to address unmet medical needs. Summary of the Invention

[0006] This article describes pharmaceutical DNA compositions, constructs, formulations, methods of using such compositions, constructs and formulations, and methods of their preparation.

[0007] Listed Examples

[0008] 1. A double-stranded DNA (dsDNA) molecule comprising a chemically modified cytosine nucleotide having a substitution other than hydrogen at the carbon 5 of cytosine.

[0009] 2. The dsDNA molecule as described in Example 1, wherein the chemically modified cytosine nucleotide comprises a structure of formula I:

[0010]

[0011] R1 is selected from the group consisting of: –OH; -aldehyde; -carboxylic acid; -alkyl; -(CH2). m OR2, m = 1-3 and R2 = H or sugar molecule; and -propyne amino.

[0012] 3. A dsDNA molecule comprising:

[0013] A promoter sequence and a therapeutic payload sequence operatively connected to the promoter sequence, and

[0014] The chemically modified cytosine nucleotide located in this therapeutic loading sequence comprises a structure of formula I:

[0015]

[0016] R1 is selected from the group consisting of: –OH; -aldehyde; -carboxylic acid; -alkyl; -(CH2). m OR2, m = 1-3 and R2 = H or sugar molecule; and -propyne amino.

[0017] 4. The dsDNA molecule as described in Example 2 or 3, wherein R1 is selected from the group consisting of: -OH; -CHO; -COOH; -alkyl; -(CH2). m OR2, m = 1-3 and R2 = H or a sugar molecule; and -propynylamino, wherein the alkyl group contains one to six carbons.

[0018] 5. The dsDNA molecule as described in any one of Examples 2-4, wherein R1 is selected from the group consisting of: -OH; -CHO; -COOH; -CH2OR3, R3 = H or glucose; -methyl; and -propynylamino.

[0019] 6. The dsDNA molecule as described in any of the foregoing embodiments, wherein the chemically modified cytosine nucleotide comprises 5-formylcytosine, 5-hydroxycytosine, 5-carboxycytosine, 5-propyneaminocytosine, 5-methylcytosine, 5-hydroxymethylcytosine, or glucosyl-5-hydroxymethylcytosine.

[0020] 7. The dsDNA molecule as described in any one of Examples 1-6, wherein the chemically modified cytosine nucleotide comprises 5-formylcytosine.

[0021] 8. The dsDNA molecule as described in any one of Examples 1-6, wherein the chemically modified cytosine nucleotide comprises 5-hydroxycytosine.

[0022] 9. A double-stranded DNA (dsDNA) molecule comprising a chemically modified cytosine nucleotide, wherein the chemically modified cytosine nucleotide comprises 5-hydroxycytosine.

[0023] 10. The dsDNA molecule as described in any one of Examples 1-6, wherein the chemically modified cytosine nucleotide comprises 5-carboxycytosine.

[0024] 11. The dsDNA molecule as described in any one of Examples 1-6, wherein the chemically modified cytosine nucleotide comprises 5-propynylaminocytosine.

[0025] 12. A double-stranded DNA (dsDNA) molecule comprising a chemically modified cytosine nucleotide, wherein the chemically modified cytosine nucleotide comprises 5-propynylaminocytosine.

[0026] 13. The dsDNA molecule as described in any one of Examples 1-6, wherein the chemically modified cytosine nucleotide comprises 5-methylcytosine.

[0027] 14. The dsDNA molecule as described in any one of Examples 1-6, wherein the chemically modified cytosine nucleotide comprises 5-hydroxymethylcytosine.

[0028] 15. The dsDNA molecule as described in any one of Examples 1-6, wherein the chemically modified cytosine nucleotide comprises glucosyl-5-hydroxymethylcytosine.

[0029] 16. A double-stranded DNA (dsDNA) molecule comprising a chemically modified cytosine nucleotide, wherein the chemically modified cytosine nucleotide comprises glucosyl-5-hydroxymethylcytosine.

[0030] 17. A double-stranded DNA (dsDNA) molecule comprising:

[0031] Chemically modified cytosine nucleotides, wherein the chemically modified cytosine nucleotides are selected from 5-hydroxycytosine or glucosyl-5-hydroxymethylcytosine.

[0032] The dsDNA molecule is a closed-terminal linear DNA.

[0033] 18. A double-stranded DNA (dsDNA) molecule comprising:

[0034] A promoter sequence and a therapeutic payload sequence operatively connected to the promoter sequence, and

[0035] A chemically modified cytosine nucleotide, specifically 5-hydroxycytosine, is located in the therapeutic loading sequence.

[0036] The dsDNA molecule is a closed-terminal linear DNA.

[0037] 19. The dsDNA molecule as described in any one of Examples 1-18, wherein the dsDNA molecule is circular or linear.

[0038] 20. The dsDNA molecule as described in any of the foregoing embodiments, wherein the dsDNA molecule is circular.

[0039] 21. The dsDNA molecule as described in any one of Examples 1-19, wherein the dsDNA molecule is linear.

[0040] 22. The dsDNA molecule as described in any one of Examples 1-19 or 21, wherein the dsDNA molecule is linear with closed ends.

[0041] 23. The dsDNA molecule as described in any of the preceding embodiments, wherein at least 1%, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 50%, or at least 75% of the cytosine positions in the dsDNA molecule contain the chemically modified cytosine nucleotide.

[0042] 24. A double-stranded DNA (dsDNA) molecule comprising a chemically modified cytosine nucleotide, wherein at least 1%, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 50%, or at least 75% of the cytosine positions in the dsDNA molecule contain the chemically modified cytosine nucleotide.

[0043] 25. The dsDNA molecule as described in any of the preceding embodiments, wherein 1% to 75% (e.g., 1-5%, 5-10%, 10-15%, 15-20%, 20-25%, 25-30%, 30-35%, 35-40%, 40-45%, 45-50%, 50-55%, 55-60%, 60-65%, 65-70%, or 70-75%) of the cytosine positions in the dsDNA molecule contain the chemically modified cytosine nucleotide.

[0044] 26. A double-stranded DNA (dsDNA) molecule comprising a chemically modified cytosine nucleotide, wherein 1% to 75% (e.g., 1-5%, 5-10%, 10-15%, 15-20%, 20-25%, 25-30%, 30-35%, 35-40%, 40-45%, 45-50%, 50-55%, 55-60%, 60-65%, 65-70%, or 70-75%) of the cytosine positions in the dsDNA molecule contain the chemically modified cytosine nucleotide.

[0045] 27. The dsDNA molecule as described in any one of Examples 1-26, wherein 1%-75% (e.g., 1-5%, 5-10%, 10-15%, 15-20%, 20-25%, 25-30%, 30-35%, 35-40%, 40-45%, 45-50%, 50-55%, 55-60%, 60-65%, 65-70%, or 70-75%) of the cytosine positions in the dsDNA molecule contain the chemically modified cytosine nucleotide, wherein the chemically modified cytosine nucleotide contains 5-formylcytosine.

[0046] 28. The dsDNA molecule as described in any one of Examples 1-27, wherein at least 1%, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 50%, or at least 75% of the cytosine positions in the dsDNA molecule contain the chemically modified cytosine nucleotide, wherein the chemically modified cytosine nucleotide contains 5-formylcytosine.

[0047] 29. The dsDNA molecule as described in any one of Examples 1-26, wherein 1%-75% (e.g., 1-5%, 5-10%, 10-15%, 15-20%, 20-25%, 25-30%, 30-35%, 35-40%, 40-45%, 45-50%, 50-55%, 55-60%, 60-65%, 65-70%, or 70-75%) of the cytosine positions in the dsDNA molecule contain the chemically modified cytosine nucleotide, wherein the chemically modified cytosine nucleotide contains 5-hydroxycytosine.

[0048] 30. The dsDNA molecule as described in any one of Examples 1-26 or 28, wherein at least 1%, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 50%, or at least 75% of the cytosine positions in the dsDNA molecule contain the chemically modified cytosine nucleotide, wherein the chemically modified cytosine nucleotide contains 5-hydroxycytosine.

[0049] 31. The dsDNA molecule as described in any one of Examples 1-26, wherein 1%-75% (e.g., 1-5%, 5-10%, 10-15%, 15-20%, 20-25%, 25-30%, 30-35%, 35-40%, 40-45%, 45-50%, 50-55%, 55-60%, 60-65%, 65-70%, or 70-75%) of the cytosine positions in the dsDNA molecule contain the chemically modified cytosine nucleotide, wherein the chemically modified cytosine nucleotide contains 5-carboxycytosine.

[0050] 32. The dsDNA molecule as described in any one of Examples 1-26 or 31, wherein at least 1%, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 50%, or at least 75% of the cytosine positions in the dsDNA molecule contain the chemically modified cytosine nucleotide, wherein the chemically modified cytosine nucleotide contains 5-carboxycytosine.

[0051] 33. The dsDNA molecule as described in any one of Examples 1-26, wherein 1%-75% (e.g., 1-5%, 5-10%, 10-15%, 15-20%, 20-25%, 25-30%, 30-35%, 35-40%, 40-45%, 45-50%, 50-55%, 55-60%, 60-65%, 65-70%, or 70-75%) of the cytosine positions in the dsDNA molecule contain the chemically modified cytosine nucleotide, wherein the chemically modified cytosine nucleotide contains 5-propynylaminocytosine.

[0052] 34. The dsDNA molecule as described in any one of Examples 1-26 or 33, wherein at least 1%, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 50%, or at least 75% of the cytosine positions in the dsDNA molecule comprise the chemically modified cytosine nucleotide, wherein the chemically modified cytosine nucleotide comprises 5-propynylaminocytosine.

[0053] 35. The dsDNA molecule as described in any one of Examples 1-26, wherein 1%-75% (e.g., 1-5%, 5-10%, 10-15%, 15-20%, 20-25%, 25-30%, 30-35%, 35-40%, 40-45%, 45-50%, 50-55%, 55-60%, 60-65%, 65-70%, or 70-75%) of the cytosine positions in the dsDNA molecule contain the chemically modified cytosine nucleotide, wherein the chemically modified cytosine nucleotide contains 5-methylcytosine.

[0054] 36. The dsDNA molecule as described in any one of Examples 1-26 or 35, wherein at least 1%, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 50%, or at least 75% of the cytosine positions in the dsDNA molecule contain the chemically modified cytosine nucleotide, wherein the chemically modified cytosine nucleotide contains 5-methylcytosine.

[0055] 37. The dsDNA molecule as described in any one of Examples 1-26, wherein 1%-75% (e.g., 1-5%, 5-10%, 10-15%, 15-20%, 20-25%, 25-30%, 30-35%, 35-40%, 40-45%, 45-50%, 50-55%, 55-60%, 60-65%, 65-70%, or 70-75%) of the cytosine positions in the dsDNA molecule contain the chemically modified cytosine nucleotide, wherein the chemically modified cytosine nucleotide contains 5-hydroxymethylcytosine.

[0056] 38. The dsDNA molecule as described in any one of Examples 1-26 or 37, wherein at least 1%, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 50%, or at least 75% of the cytosine positions in the dsDNA molecule contain the chemically modified cytosine nucleotide, wherein the chemically modified cytosine nucleotide contains 5-hydroxymethylcytosine.

[0057] 39. The dsDNA molecule as described in any one of Examples 1-26, wherein 1%-75% (e.g., 1-5%, 5-10%, 10-15%, 15-20%, 20-25%, 25-30%, 30-35%, 35-40%, 40-45%, 45-50%, 50-55%, 55-60%, 60-65%, 65-70%, or 70-75%) of the cytosine positions in the dsDNA molecule contain the chemically modified cytosine nucleotide, wherein the chemically modified cytosine nucleotide contains glucosyl-5-hydroxymethylcytosine.

[0058] 40. The dsDNA molecule as described in any one of Examples 1-26 or 39, wherein at least 1%, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 50%, or at least 75% of the cytosine positions in the dsDNA molecule comprise the chemically modified cytosine nucleotide, wherein the chemically modified cytosine nucleotide comprises glucosyl-5-hydroxymethylcytosine.

[0059] 41. The dsDNA molecule as described in any one of Examples 1-40, comprising a continuous region of 200 nucleotides, wherein at least 1%, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 50%, or at least 75% of the cytosine positions in the continuous region contain the chemically modified cytosine nucleotide.

[0060] 42. The dsDNA molecule as described in any one of Examples 1-41, comprising a continuous region of 500 nucleotides, wherein at least 1%, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 50%, or at least 75% of the cytosine positions in the continuous region contain the chemically modified cytosine nucleotide.

[0061] 43. The dsDNA molecule as described in any one of Examples 1-42, comprising a continuous region of 1000 nucleotides, wherein at least 1%, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 50%, or at least 75% of the cytosine positions in the continuous region contain the chemically modified cytosine nucleotide.

[0062] 44. The dsDNA molecule as described in any one of Examples 1-43, comprising a continuous region of 200 nucleotides, wherein 1%-75% (e.g., 1-5%, 5-10%, 10-15%, 15-20%, 20-25%, 25-30%, 30-35%, 35-40%, 40-45%, 45-50%, 50-55%, 55-60%, 60-65%, 65-70%, or 70-75%) of the cytosine positions in the continuous region contain the chemically modified cytosine nucleotide.

[0063] 45. The dsDNA molecule as described in any one of Examples 1-44, comprising a continuous region of 500 nucleotides, wherein 1%-75% (e.g., 1-5%, 5-10%, 10-15%, 15-20%, 20-25%, 25-30%, 30-35%, 35-40%, 40-45%, 45-50%, 50-55%, 55-60%, 60-65%, 65-70%, or 70-75%) of the cytosine positions in the continuous region contain the chemically modified cytosine nucleotide.

[0064] 46. ​​The dsDNA molecule as described in any one of Examples 1-45, comprising a continuous region of 1000 nucleotides, wherein 1%-75% (e.g., 1-5%, 5-10%, 10-15%, 15-20%, 20-25%, 25-30%, 30-35%, 35-40%, 40-45%, 45-50%, 50-55%, 55-60%, 60-65%, 65-70%, or 70-75%) of the cytosine positions in the continuous region contain the chemically modified cytosine nucleotide.

[0065] 47. The dsDNA molecule as described in any one of Examples 1-46, wherein the dsDNA molecule comprises a sense strand and an antisense strand, and wherein the antisense strand comprises fewer chemically modified cytosine nucleotides than the sense strand.

[0066] 48. The dsDNA molecule as described in any one of Examples 1-47, wherein the dsDNA molecule comprises a sense strand and an antisense strand, and wherein the antisense strand is substantially free of chemically modified cytosine nucleotides.

[0067] 49. The dsDNA molecule as described in any of the foregoing embodiments, wherein the dsDNA molecule further comprises a second chemically modified cytosine nucleotide.

[0068] 50. The dsDNA molecule as described in Example 49, wherein:

[0069] i) The chemically modified cytosine nucleotide contains 5-formylcytosine and the second chemically modified cytosine nucleotide contains 5-hydroxycytosine;

[0070] ii) The chemically modified cytosine nucleotide contains 5-formylcytosine and the second chemically modified cytosine nucleotide contains 5-carboxycytosine;

[0071] iii) The chemically modified cytosine nucleotide contains 5-formylcytosine and the second chemically modified cytosine nucleotide contains 5-propynylaminocytosine;

[0072] iv) The chemically modified cytosine nucleotide contains 5-formylcytosine and the second chemically modified cytosine nucleotide contains 5-methylcytosine;

[0073] v) The chemically modified cytosine nucleotide contains 5-formylcytosine and the second chemically modified cytosine nucleotide contains 5-hydroxymethylcytosine;

[0074] vi) The chemically modified cytosine nucleotide contains 5-formylcytosine and the second chemically modified cytosine nucleotide contains glucosyl-5-hydroxymethylcytosine;

[0075] vii) The chemically modified cytosine nucleotide contains 5-hydroxycytosine and the second chemically modified cytosine nucleotide contains 5-carboxycytosine;

[0076] viii) The chemically modified cytosine nucleotide contains 5-hydroxycytosine and the second chemically modified cytosine nucleotide contains 5-propynylaminocytosine;

[0077] ix) The chemically modified cytosine nucleotide contains 5-hydroxycytosine and the second chemically modified cytosine nucleotide contains 5-methylcytosine;

[0078] x) The chemically modified cytosine nucleotide contains 5-hydroxycytosine and the second chemically modified cytosine nucleotide contains 5-hydroxymethylcytosine;

[0079] xi) The chemically modified cytosine nucleotide contains 5-hydroxycytosine and the second chemically modified cytosine nucleotide contains glucosyl-5-hydroxymethylcytosine;

[0080] xii) The chemically modified cytosine nucleotide contains 5-carboxycytosine and the second chemically modified cytosine nucleotide contains 5-propynylaminocytosine;

[0081] xiii) The chemically modified cytosine nucleotide contains 5-carboxycytosine and the second chemically modified cytosine nucleotide contains 5-methylcytosine;

[0082] xiv) The chemically modified cytosine nucleotide contains 5-carboxycytosine and the second chemically modified cytosine nucleotide contains 5-hydroxymethylcytosine;

[0083] xv) The chemically modified cytosine nucleotide contains 5-carboxycytosine and the second chemically modified cytosine nucleotide contains glucosyl-5-hydroxymethylcytosine;

[0084] xvi) The chemically modified cytosine nucleotide contains 5-propynylaminocytosine and the second chemically modified cytosine nucleotide contains 5-methylcytosine;

[0085] xvii) The chemically modified cytosine nucleotide contains 5-propynylaminocytosine and the second chemically modified cytosine nucleotide contains 5-hydroxymethylcytosine;

[0086] xviii) The chemically modified cytosine nucleotide contains 5-propynylaminocytosine and the second chemically modified cytosine nucleotide contains glucosyl-5-hydroxymethylcytosine;

[0087] (xix) The chemically modified cytosine nucleotide contains 5-methylcytosine and the second chemically modified cytosine nucleotide contains 5-hydroxymethylcytosine;

[0088] xx) The chemically modified cytosine nucleotide contains 5-methylcytosine and the second chemically modified cytosine nucleotide contains glucosyl-5-hydroxymethylcytosine; or

[0089] (xxi) The chemically modified cytosine nucleotide contains 5-hydroxymethylcytosine and the second chemically modified cytosine nucleotide contains glucosyl-5-hydroxymethylcytosine.

[0090] 51. The dsDNA molecule as described in any of the preceding embodiments, wherein at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% of the sugars in the dsDNA molecule are deoxyribose.

[0091] 52. The dsDNA molecule as described in any of the preceding embodiments, wherein at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% of the sugars in the modified pyrimidine nucleotides of the dsDNA molecule are deoxyribose.

[0092] 53. The dsDNA molecule as described in any of the foregoing embodiments, wherein all positions in the dsDNA molecule contain deoxyribose.

[0093] 54. The dsDNA molecule as described in any of the foregoing embodiments, comprising a chemical modification of a phosphate group.

[0094] 55. The dsDNA molecule described in any one of the preceding embodiments, comprising a chemical modification of a sugar, such as a 2'-deoxy-2'-fluoro(2'-F) nucleotide or a 2'-O-methyl(2'-O-Me) nucleotide.

[0095] 56. The dsDNA molecule as described in any of the foregoing embodiments, comprising one or more of the following:

[0096] i) A promoter sequence (wherein, optionally, the promoter sequence is located in a double-stranded region);

[0097] ii) A load sequence (e.g., a therapeutic load sequence) operatively connected to the promoter sequence;

[0098] iii) Heterogeneous functional sequences, such as nuclear targeting sequences or regulatory sequences;

[0099] iv) Maintain the sequence; and / or

[0100] v) Copy the starting point.

[0101] 57. The dsDNA molecule as described in any of the foregoing embodiments, comprising one, two, or all of the following:

[0102] i) Heterogeneous functional sequences, such as nuclear targeting sequences or regulatory sequences;

[0103] ii) Maintain the sequence; or

[0104] iii) Copying origin.

[0105] 58. The dsDNA molecule as described in any of the foregoing embodiments, comprising a therapeutic loading sequence.

[0106] 59. The dsDNA molecule as described in Example 58, wherein the chemically modified cytosine nucleotide is located in the sense strand of the therapeutic loading sequence.

[0107] 60. The dsDNA molecule as described in any one of Examples 1-20 or 21-59, wherein the dsDNA molecule is linear and comprises:

[0108] a) The end form of upstream exonuclease-resistant DNA;

[0109] b) The double-stranded region; and

[0110] c) Downstream exonuclease-resistant DNA terminal form.

[0111] 61. The dsDNA molecule described in any one of the preceding embodiments, when contacted with HEKa cells, for example, in the assays described herein, results in one or more of the following:

[0112] IFNβ mRNA at levels lower than control DNA molecules (e.g., at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90% lower).

[0113] CXCL10 mRNA at levels lower than control DNA molecules (e.g., at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or at least 95% lower), or

[0114] IL6 mRNA at lower levels (e.g., at least 10%, at least 20%, or at least 30% lower) compared to control DNA molecules.

[0115] The control DNA molecule contains the same sequence, the same strand state, and the same circular or linear features as the dsDNA molecule, but contains unmodified cytosine nucleotides instead of these chemically modified cytosine nucleotides.

[0116] 62. The dsDNA molecule described in any one of the preceding examples, when contacted with HEKa cells, for example, in the assays described herein, results in one or both of the following:

[0117] (i) A reduction in the measured value of interferon signaling relative to the control DNA molecule, for example, a reduction of at least 2-fold, at least 4-fold, at least 5-fold, or at least 6-fold, wherein the measured value of interferon signaling is the mean fold change of IFNβ mRNA and CXCL10 mRNA relative to the control DNA molecule; or

[0118] (ii) A decrease in the measurement of inflammatory cytokine signaling relative to the control DNA molecule, for example, a decrease of at least 2-fold or at least 3-fold, wherein the measurement of inflammatory cytokine signaling is the mean fold change of IL6 mRNA and TNFα mRNA relative to the control DNA molecule.

[0119] The control DNA molecule contains the same sequence, the same strand state, and the same circular or linear features as the dsDNA molecule, but contains unmodified cytosine nucleotides instead of these chemically modified cytosine nucleotides.

[0120] 63. The dsDNA molecule as described in any of the foregoing embodiments, which encodes a protein and, when contacted with HepG2 cells, for example, in the assay described herein, results in an expression level of at least 50%, at least 60%, at least 70%, or at least 75% of that of a control DNA molecule, wherein the control DNA molecule contains the same sequence, the same strand state, and the same circular or linear features as the dsDNA molecule, but contains unmodified cytosine nucleotides in place of these chemically modified cytosine nucleotides.

[0121] 64. The dsDNA molecule as described in any one of the preceding embodiments, comprising a therapeutic load sequence, which, when contacted with HepG2 cells, causes the expression level of the therapeutic load sequence to be at least 50%, at least 60%, at least 70%, or at least 75% of the expression of the therapeutic load sequence in a control DNA, wherein the control DNA molecule comprises the same sequence, the same strand state, and the same circular or linear features as the dsDNA molecule, but comprises unmodified cytosine nucleotides in place of these chemically modified cytosine nucleotides.

[0122] 65. A dsDNA molecule as described in any of the foregoing embodiments, encoding a protein, and when contacted with HEKa cells, for example, in the assay described herein, resulting in an expression level of at least 20%, at least 30%, at least 40%, at least 50%, or at least 55% of that of a control DNA molecule, wherein the control DNA molecule contains the same sequence, the same strand state, and the same circular or linear features as the dsDNA molecule, but contains unmodified cytosine nucleotides in place of these chemically modified cytosine nucleotides.

[0123] 66. The dsDNA molecule as described in any one of the preceding embodiments, comprising a therapeutic loading sequence, which, when contacted with HEKa cells, causes the expression level of the therapeutic loading sequence to be at least 20%, at least 30%, at least 40%, at least 50%, or at least 55% of the expression of the therapeutic loading sequence in a control DNA, wherein the control DNA molecule comprises the same sequence, the same strand state, and the same circular or linear features as the dsDNA molecule, but comprises unmodified cytosine nucleotides instead of these chemically modified cytosine nucleotides.

[0124] 67. The dsDNA molecule as described in any of the foregoing embodiments, wherein the dsDNA molecule is a TDSC.

[0125] 68. The dsDNA molecule as described in Example 67, wherein the TDSC comprises:

[0126] a) The end form of upstream exonuclease-resistant DNA;

[0127] b) The double-stranded region; and

[0128] c) Downstream exonuclease-resistant DNA terminal form.

[0129] 69. The dsDNA molecule as described in Example 68, wherein one or both of the upstream exonuclease-resistant DNA end form and the downstream exonuclease-resistant DNA end form are open ends.

[0130] 70. The dsDNA molecule as described in Example 67, wherein the TDSC comprises:

[0131] a) Upstream DNA end forms containing Y-adaptor conformations (e.g., upstream exonuclease-resistant DNA end forms);

[0132] b) The double-stranded region; and

[0133] c) Downstream DNA end forms containing Y-adaptor conformations (e.g., downstream exonuclease-resistant DNA end forms).

[0134] 71. The dsDNA molecule as described in Example 68 or 69, wherein one or both of the upstream exonuclease-resistant DNA end form and the downstream exonuclease-resistant DNA end form are blunt ends or sticky ends.

[0135] 72. The dsDNA molecule as described in Example 67, wherein the TDSC comprises:

[0136] a) Upstream double-stranded blunt-ended DNA terminal form (e.g., upstream exonuclease-resistant DNA terminal form with double-stranded blunt ends), which contains phosphate thioester modification on each strand;

[0137] b) The double-stranded region; and

[0138] c) Downstream double-stranded blunt-ended DNA end forms (e.g., downstream exonuclease-resistant DNA end forms with double-stranded blunt ends) containing phosphate thioester modifications on each strand.

[0139] 73. The dsDNA molecule as described in Example 68, wherein one or both of the upstream exonuclease-resistant DNA end form and the downstream exonuclease-resistant DNA end form are closed ends.

[0140] 74. The dsDNA molecule as described in any one of Examples 68, 69 or 71-73, wherein one or both of the upstream exonuclease-resistant DNA end form and the downstream exonuclease-resistant DNA end form contain a loop.

[0141] 75. The dsDNA molecule as described in Example 67, wherein the TDSC comprises:

[0142] a) Upstream DNA terminal form (e.g., upstream exonuclease-resistant DNA terminal form), which is a closed end;

[0143] b) Double-chain region;

[0144] c) Downstream DNA end forms (e.g., downstream exonuclease-resistant DNA end forms), which are closed ends.

[0145] 76. The dsDNA molecule as described in any one of Examples 67-75, wherein the upstream DNA end form (e.g., the upstream exonuclease-resistant DNA end form) comprises one or more chemically modified nucleotides.

[0146] 77. The dsDNA molecule as described in any one of Examples 67-76, wherein the downstream DNA terminal form (e.g., the downstream exonuclease-resistant DNA terminal form) comprises one or more chemically modified nucleotides.

[0147] 78. The dsDNA molecule as described in any one of Examples 67-77, wherein the dsDNA molecule further comprises one or more chemically modified nucleotides, the one or more chemically modified nucleotides comprising modifications in the backbone, sugar or nucleobases.

[0148] 79. The dsDNA molecule as described in any of the foregoing embodiments, wherein the one or more chemically modified nucleotides are conjugated to a peptide or protein.

[0149] 80. The dsDNA molecule as described in any of the foregoing embodiments, wherein the one or more chemically modified nucleotides comprise phosphate thioester bonds.

[0150] 81. The dsDNA molecule as described in any of the foregoing embodiments, wherein the first and second strands of the dsDNA molecule each contain one or more chemically modified nucleotides.

[0151] 82. The dsDNA molecule as described in any of the foregoing embodiments, wherein the first and second strands of the dsDNA molecule each contain one or more phosphate thioester bonds.

[0152] 83. The dsDNA molecule as described in any one of Examples 68-82, wherein the upstream exonuclease-resistant DNA terminal form comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 phosphate-thioester bonds (e.g., between the 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 terminal nucleotides of the upstream exonuclease-resistant DNA terminal form, for example, on the first strand, on the second strand, or on both the first strand and the second strand).

[0153] 84. The dsDNA molecule as described in any one of Examples 68-83, wherein the upstream exonuclease-resistant DNA terminal form comprises at least three phosphate-thioester bonds (e.g., between 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 terminal nucleotides of the upstream exonuclease-resistant DNA terminal form, for example, on the first strand, on the second strand, or on both the first strand and the second strand).

[0154] 85. The dsDNA molecule as described in any one of Examples 68-84, wherein the upstream exonuclease-resistant DNA terminal form comprises at least six phosphate-thioester bonds (e.g., between 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 terminal nucleotides of the upstream exonuclease-resistant DNA terminal form, for example, on the first strand, on the second strand, or on both the first strand and the second strand).

[0155] 86. The dsDNA molecule as described in any one of Examples 68-85, wherein the downstream exonuclease-resistant DNA terminal form comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 phosphate-thioester bonds (e.g., between the 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 terminal nucleotides of the downstream exonuclease-resistant DNA terminal form, for example, on the first strand, on the second strand, or on both the first strand and the second strand).

[0156] 87. The dsDNA molecule as described in any one of Examples 68-86, wherein the downstream exonuclease-resistant DNA terminal form comprises at least three phosphate-thioester bonds (e.g., between 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 terminal nucleotides of the downstream exonuclease-resistant DNA terminal form, for example, on the first strand, on the second strand, or on both the first strand and the second strand).

[0157] 88. The dsDNA molecule as described in any one of Examples 68-87, wherein the downstream exonuclease-resistant DNA terminal form comprises at least six phosphate-thioester bonds (e.g., between 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 terminal nucleotides of the downstream exonuclease-resistant DNA terminal form, for example, on the first strand, on the second strand, or on both the first strand and the second strand).

[0158] 89. The dsDNA molecule as described in any one of Examples 68-88, wherein the upstream and downstream exonuclease-resistant DNA terminal forms each comprise at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 phosphate-thioester bonds (e.g., between the 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 terminal nucleotides of the upstream and downstream exonuclease-resistant DNA terminal forms, for example, on the first strand, on the second strand, or on both the first strand and the second strand).

[0159] 90. The dsDNA molecule as described in any one of Examples 68-89, wherein the upstream and downstream exonuclease-resistant DNA terminal forms each contain at least three phosphate-thioester bonds (e.g., between 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 terminal nucleotides of the upstream and downstream exonuclease-resistant DNA terminal forms, for example, on the first strand, on the second strand, or on both the first and second strands).

[0160] 91. The dsDNA molecule as described in any one of Examples 68-90, wherein the upstream and downstream exonuclease-resistant DNA terminal forms comprise at least six phosphate-thioester bonds (e.g., between 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 terminal nucleotides of the upstream and downstream exonuclease-resistant DNA terminal forms, for example, on the first strand, on the second strand, or on both the first strand and the second strand).

[0161] 92. The dsDNA molecule as described in any of the foregoing embodiments, wherein the one or more chemically modified nucleotides contain a methyl group.

[0162] 93. The dsDNA molecule as described in Example 67, wherein the TDSC comprises:

[0163] a) The end form of upstream exonuclease-resistant DNA;

[0164] b) Double-chain region;

[0165] c) Downstream exonuclease-resistant DNA terminal form

[0166] One or both of the upstream exonuclease-resistant DNA terminal forms and the downstream exonuclease-resistant DNA terminal forms contain a Y-adaptor configuration.

[0167] 94. The dsDNA molecule as described in Example 93, wherein each nucleotide in the Y-adaptor is a chemically modified nucleotide.

[0168] 95. The dsDNA molecule as described in Example 67, wherein the TDSC comprises:

[0169] a) The end form of upstream exonuclease-resistant DNA;

[0170] b) Double-chain region;

[0171] c) Downstream exonuclease-resistant DNA terminal form

[0172] The upstream exonuclease-resistant DNA terminal form and the downstream exonuclease-resistant DNA terminal form, or both of them, contain one or more of the following: nuclear targeting sequence, maintenance sequence, or sequence that binds to endogenous polypeptides in target cells.

[0173] 96. The dsDNA molecule as described in Example 67, wherein the TDSC comprises:

[0174] a) The end form of upstream exonuclease-resistant DNA;

[0175] b) Double-chain region;

[0176] c) Downstream exonuclease-resistant DNA terminal form

[0177] The upstream exonuclease-resistant DNA terminal form and the downstream exonuclease-resistant DNA terminal form, or both of them, have one or more of the following characteristics:

[0178] i) Nucleic acid sequences that do not contain the nucleic acid sequences TATCAGCACACAATTGCCCATTATACGC (SEQ ID NO:55) and GCGTATAATGGGCAATTGTGTGCTGATA (SEQ ID NO:56), or nucleic acid sequences that have at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with these nucleic acid sequences; and / or nucleic acid sequences TATCAGCACACAATAGTCCATTATACGC (SEQ ID NO:57) and GCGTATAATGGACTATTGTGTGCTGATA (SEQ ID NO:58);

[0179] ii) Each nucleotide in the TDSC binds to another nucleotide in the TDSC;

[0180] iii) The upstream exonuclease-resistant DNA ends have a loop size of less than about 28 or 56 nucleotides or greater than about 28 or 56 nucleotides; or

[0181] iv) The downstream exonuclease-resistant DNA ends have a loop size of less than about 28 or 56 nucleotides or greater than about 28 or 56 nucleotides.

[0182] 97. The dsDNA molecule as described in any of the foregoing embodiments, comprising one or more of the following:

[0183] i) A promoter sequence (wherein, optionally, the promoter sequence is located in a double-stranded region);

[0184] ii) A load sequence (e.g., a therapeutic load sequence) operatively connected to the promoter sequence (wherein, optionally, the load sequence is located in a double-stranded region);

[0185] iii) Heterogeneous functional sequences, such as nuclear targeting sequences or regulatory sequences;

[0186] iv) Maintain the sequence; and / or

[0187] v) Copy the starting point.

[0188] 98. The dsDNA molecule as described in Example 78, comprising:

[0189] i, ii and iii;

[0190] i, ii and iv;

[0191] i, ii and v;

[0192] i, ii, iii and iv;

[0193] i, ii, iii and v;

[0194] i, ii, iv, and v; or

[0195] i, ii, iii, iv and v.

[0196] 99. The dsDNA molecule as described in any of the foregoing embodiments, wherein the dsDNA molecule comprises a nuclear targeting sequence comprising a CT3 sequence (e.g., the sequence AATTCTCCTCCCCACCTTCCCCACCCTCCCCA (SEQ ID NO: 59)), or a nucleic acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with it.

[0197] 100. The dsDNA molecule as described in any of the foregoing embodiments, wherein the dsDNA molecule contains a nuclear targeting sequence that binds to hnRNPK protein (e.g., human hnRNPK protein).

[0198] 101. The dsDNA molecule as described in any of the foregoing embodiments, comprising a load sequence wherein the load sequence encodes a polypeptide (e.g., a protein).

[0199] 102. The dsDNA molecule as described in any one of Examples 97-101, comprising a load sequence wherein the load sequence encodes a functional RNA (e.g., miRNA, siRNA, or tRNA).

[0200] 103. The dsDNA molecule as described in any of the preceding embodiments, comprising a therapeutic load sequence, wherein at least 1%, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 50%, or at least 75% of the cytosine positions in the therapeutic load sequence contain the chemically modified cytosine nucleotide.

[0201] 104. The dsDNA molecule as described in any one of the preceding embodiments, comprising a therapeutic loading sequence wherein 1%-75% (e.g., 1-5%, 5-10%, 10-15%, 15-20%, 20-25%, 25-30%, 30-35%, 35-40%, 40-45%, 45-50%, 50-55%, 55-60%, 60-65%, 65-70%, or 70-75%) of the cytosine positions in the therapeutic loading sequence contain the chemically modified cytosine nucleotide.

[0202] 105. The dsDNA molecule as described in any of the foregoing embodiments, comprising a load sequence wherein the load sequence is heterologous to the target cell.

[0203] 106. The dsDNA molecule as described in any of the foregoing embodiments, wherein the double-stranded region comprises a sense strand and an antisense strand.

[0204] 107. The dsDNA molecule as described in Example 106, wherein the antisense strand comprises one or more chemically modified nucleotides.

[0205] 108. The dsDNA molecule as described in Examples 106 or 107, wherein the sense strand does not contain any chemically modified nucleotides.

[0206] 109. The dsDNA molecule as described in Examples 106 or 107, wherein the sense strand comprises one or more chemically modified nucleotides.

[0207] 110. The dsDNA molecule as described in any one of Examples 68-109, wherein the upstream exonuclease-resistant DNA end form is resistant to endonuclease digestion.

[0208] 111. The dsDNA molecule as described in any one of Examples 68-110, wherein the upstream exonuclease-resistant DNA end form is resistant to recognition by an immune sensor.

[0209] 112. The dsDNA molecule as described in any one of Examples 68-111, wherein the downstream exonuclease-resistant DNA end form is resistant to endonuclease digestion.

[0210] 113. The dsDNA molecule as described in any one of Examples 68-112, wherein the downstream exonuclease-resistant DNA end form is resistant to recognition by an immune sensor.

[0211] 114. The dsDNA molecule as described in any one of Examples 68-113, wherein the double-stranded region is resistant to endonuclease digestion.

[0212] 115. The dsDNA molecule as described in any one of Examples 68-114, wherein the double-stranded region is resistant to recognition by an immune sensor.

[0213] 116. The dsDNA molecule as described in any one of Examples 68-115, wherein the upstream DNA end form and the downstream DNA end form have the same nucleotide sequence.

[0214] 117. The dsDNA molecule as described in any one of Examples 68-115, wherein the upstream DNA end form and the downstream DNA end form have different nucleotide sequences.

[0215] 118. The dsDNA molecule as described in any one of Examples 68-117, wherein the upstream exonuclease-resistant DNA end form and the downstream exonuclease-resistant DNA end form have the same structure.

[0216] 119. The dsDNA molecule as described in any one of Examples 68-117, wherein the upstream exonuclease-resistant DNA end form and the downstream exonuclease-resistant DNA end form have different structures.

[0217] 120. The dsDNA molecule as described in any one of Examples 68-119, wherein one or both of the upstream exonuclease-resistant DNA end form and the downstream exonuclease-resistant DNA end form are open ends (e.g., blunt ends, sticky ends, or Y-adaptors).

[0218] 121. The dsDNA molecule as described in any one of Examples 68-120, wherein one or both of the upstream exonuclease-resistant DNA end form and the downstream exonuclease-resistant DNA end form are closed ends (e.g., hairpins).

[0219] 122. The dsDNA molecule as described in any one of Examples 73-121, wherein the closed end comprises one or more (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 40 or 50) unhybridized (e.g., not part of a double-stranded region) nucleotides.

[0220] 123. The dsDNA molecule as described in any one of Examples 73-121, wherein the closed end does not contain any unhybridized nucleotides (e.g., wherein all nucleotides at the closed end are hybridized to another nucleotide).

[0221] 124. The dsDNA molecule as described in any one of Examples 68-123, wherein the upstream DNA end form, the downstream DNA end form, or both contain at least one chemically modified nucleotide.

[0222] 125. The dsDNA molecule as described in any one of Examples 68-124, wherein both the upstream DNA terminal form and the downstream DNA terminal form comprise at least one chemically modified nucleotide on the sense strand and at least one chemically modified nucleotide on the antisense strand.

[0223] 126. The dsDNA molecule as described in any one of Examples 68-125, wherein both the upstream DNA end form and the downstream DNA end form contain chemically modified nucleotides at each sense strand position and each antisense strand position.

[0224] 127. The dsDNA molecule as described in any one of Examples 68-126, wherein the upstream DNA end form, the downstream DNA end form, or both contain an inverted terminal repeat (ITR) sequence.

[0225] 128. The dsDNA molecule as described in any one of Examples 68-127, wherein the upstream DNA end form, the downstream DNA end form, or both contain a protelomerase sequence.

[0226] 129. The dsDNA molecule as described in Example 128, wherein one or more of these protein telomerases comprise (e.g., in 5' to 3' order) the nucleic acid sequences TATCAGCACACAATTGCCCATTATACGC (SEQ ID NO: 55) and GCGTATAATGGGCAATTGTGTGCTGATA (SEQ ID NO: 56), or nucleic acid sequences having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with these nucleic acid sequences.

[0227] 130. The dsDNA molecule as described in Examples 128 or 129, wherein one or more of these protein telomerases comprise (e.g., in 5' to 3' order) the nucleic acid sequences TATCAGCACACAATAGTCCATTATACGC (SEQ ID NO: 57) and GCGTATAATGGACTATTGTGTGCTGATA (SEQ ID NO: 58), or nucleic acid sequences having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with these nucleic acid sequences.

[0228] 131. The dsDNA molecule as described in Example 128, wherein one or more of these protein telomerases comprise (e.g., in 5' to 3' order) the nucleic acid sequences ACCTATTTCAGCATACTACGC (SEQ ID NO: 60) and GCGTAGTATGCTGAAATAGGT (SEQ ID NO: 61), or nucleic acid sequences having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with these nucleic acid sequences.

[0229] 132. The dsDNA molecule as described in Example 128, wherein one or more of these protein telomerases contain (e.g., in 5' to 3' order) the nucleic acid sequence CACACAATTGCCCATTATACGCGCGTATAATGGGCAATTGTGTG (SEQ ID NO: 62), or a nucleic acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with it.

[0230] 133. The dsDNA molecule as described in Example 128, wherein one or more of these protein telomerase sequences comprise (e.g., in 5' to 3' order) the following nucleic acid sequences:

[0231] (i)TAAATATAATTTAA (SEQ ID NO:63) and TTAAATTATATTTA (SEQ ID NO:64),

[0232] (ii) AATATTAATCTAA (SEQ ID NO: 65) and TTAGATTATATATT (SEQ ID NO: 66),

[0233] (iii) TATTTATTATCTTT (SEQ ID NO:67) and AAAGATAATAAATA (SEQ ID NO:68),

[0234] (iv) ATATAATTTTTAATTAGTATAGAATATGTTAA (SEQ ID NO: 69) and TTAACATACTCTATACTAATTAAAAATTATAT (SEQ ID NO: 70),

[0235] (v) TATAATTTGATATTAGTACAAATCCC (SEQ ID NO:71) and GGGATTTGTACTAATATCAAATTATA (SEQ ID NO:72),

[0236] (vi) ATATAATATTTATTTAGTACAAAGTTC (SEQ ID NO:73) and GAACTTTGTACTAAATAAATATTATAT (SEQ ID NO:74),

[0237] (vii)ATATAATTTTTTATTAGTATAGAGTAT (SEQ ID NO:75) and ATACTCTATACTAATAAAAAATTATAT (SEQ ID NO:76), or

[0238] (viii) TAAATATAATTTAA (SEQ ID NO: 63) and TTAAATTATATTTA (SEQ ID NO: 64);

[0239] Or nucleic acid sequences that have at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with these nucleic acid sequences.

[0240] 134. The dsDNA molecule as described in Example 133, wherein one or more of these protein telomerase sequences further comprise (e.g., in a 5' to 3' sequence) the following nucleic acid sequences:

[0241] (i)TAGTATAAAAAACTGT (SEQ ID NO:77) and ACAGTTTTTTATACTA (SEQ ID NO:78),

[0242] (ii) TAGATACAAAAGATT (SEQ ID NO:79) and AATCTTTTTGTATACTA (SEQ ID NO:80),

[0243] (iii) TAGTATATATATCTCT (SEQ ID NO:81) and AGAGATATATATACTA (SEQ ID NO:82), or

[0244] (iv)TAGTATAAAAAAAATT (SEQ ID NO:83) and AATTTTTTTTTATACTA (SEQ ID NO:84);

[0245] Or nucleic acid sequences that have at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with these nucleic acid sequences.

[0246] 135. The dsDNA molecule as described in any one of Examples 128-134, wherein the protein telomerase sequence is generated by digestion with TelN telomerase, ResT telomerase, Tel PY54 telomerase or TelK telomerase.

[0247] 136. The dsDNA molecule as described in any one of Examples 128-134, wherein the protein telomerase sequence is not generated by TelN protein telomerase digestion.

[0248] 137. The dsDNA molecule as described in any one of Examples 128-134 or 136, wherein the protein telomerase sequence is not generated by Tel PY54 protein telomerase digestion.

[0249] 138. The dsDNA molecule as described in any one of Examples 128-134, 136 or 137, wherein the protein telomerase sequence is not generated by TelK protein telomerase digestion.

[0250] 139. The dsDNA molecule as described in any one of Examples 128-134 or 136-138, wherein the protein telomerase sequence is not generated by ResT protein telomerase digestion.

[0251] 140. The dsDNA molecule as described in any one of Examples 128-139, wherein the length of the telomerase sequence of these proteins is about 28 or 56 nucleotides.

[0252] 141. The dsDNA molecule as described in any one of Examples 128-140, wherein the length of the telomerase sequence of these proteins is less than 28 (e.g., less than 15, 20, 25, 26, 27 or 28) nucleotides.

[0253] 142. The dsDNA molecule as described in any one of Examples 128-141, wherein the length of the telomerase sequences of these proteins is between about 28 (e.g., 25, 26, 27, 28, 29, 30, 31, 32, 33, 34 or 35) nucleotides and about 56 (e.g., 50, 51, 52, 53, 54, 55, 56, 57, 58, 59 or 60) nucleotides.

[0254] 143. The dsDNA molecule as described in any one of Examples 128-140 or 142, wherein the length of the telomerase sequence of these proteins is greater than about 56 (e.g., greater than 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 65, 70, 75, 80, 90 or 100) nucleotides.

[0255] 144. The dsDNA molecule as described in any one of Examples 68-143, wherein the upstream DNA end form, the downstream DNA end form, or both contain a Y-adaptor.

[0256] 145. The dsDNA molecule as described in any one of Examples 128-135, wherein these protein telomerase sequences are generated from a first protein telomerase recognition sequence (PRS) and a second PRS recognized by TelN protein telomerase or ResT protein telomerase.

[0257] 146. The dsDNA molecule as described in any one of Examples 128-135, wherein these protein telomerase sequences are generated from a first protein telomerase recognition sequence (PRS) and a second PRS recognized by Tel PY54 protein telomerase or TelK protein telomerase.

[0258] 147. The dsDNA molecule as described in any one of Examples 68-146, wherein one or both of the upstream exonuclease-resistant DNA terminal form and the downstream exonuclease-resistant DNA terminal form contain at least one chemically modified nucleotide (e.g., chemical modification is contained on each sense nucleotide and each antisense nucleotide).

[0259] 148. The dsDNA molecule as described in any one of Examples 68-147, wherein one or both of the upstream exonuclease-resistant DNA end form and the downstream exonuclease-resistant DNA end form comprise one or more chemically modified nucleotides (e.g., phosphate thioester-modified nucleotides).

[0260] 149. The dsDNA molecule as described in any of the foregoing embodiments, wherein the double-stranded region comprises one or more chemically modified nucleotides.

[0261] 150. The dsDNA molecule as described in any of the preceding embodiments, wherein the double-stranded region encodes a load sequence, and wherein the antisense strand of the load sequence comprises one or more chemically modified nucleotides.

[0262] 151. The dsDNA molecule as described in any of the foregoing embodiments, wherein the double-stranded region encodes a load sequence, and wherein the sense strand of the load sequence comprises one or more chemically modified nucleotides.

[0263] 152. The dsDNA molecule as described in any of the preceding embodiments, wherein the dsDNA molecule encodes a sequence that encodes RNA (e.g., mRNA, siRNA, or miRNA).

[0264] 153. The dsDNA molecule as described in any one of Examples 1-151, wherein the dsDNA molecule does not contain a sequence encoding RNA.

[0265] 154. The dsDNA molecule as described in any of the preceding embodiments, wherein the dsDNA molecule can be replicated (e.g., by a cell-native DNA polymerase containing the dsDNA molecule).

[0266] 155. The dsDNA molecule as described in any one of Examples 1-153, wherein the dsDNA molecule cannot replicate.

[0267] 156. The dsDNA molecule as described in any of the foregoing embodiments, wherein the dsDNA molecule is linear and can be circularized.

[0268] 157. The dsDNA molecule as described in any one of Examples 1-155, wherein the dsDNA molecule is linear and cannot be circularized.

[0269] 158. The dsDNA molecule as described in any of the foregoing embodiments, wherein the dsDNA molecule or a portion thereof can be integrated into the genome.

[0270] 159. The dsDNA molecule as described in any one of Examples 1-157, wherein the dsDNA molecule or a portion thereof cannot be integrated into the genome.

[0271] 160. The dsDNA molecule as described in any of the foregoing embodiments, wherein the dsDNA molecule is capable of multiplication.

[0272] 161. The dsDNA molecule as described in any one of Examples 1-160, wherein the dsDNA molecule cannot be multiplied.

[0273] 162. The dsDNA molecule as described in any of the preceding embodiments, wherein 1%-100% (e.g., 1-5%, 5-10%, 10-15%, 15-20%, 20-25%, 25-30%, 30-35%, 35-40%, 40-45%, 45-50%, 50%-55%, 55-60%, 60-65%, 65-70%, 70-75%, 75-80%, 80-85%, 85-90%, 90-95%, or 95-100%) of the cytosine positions in the sense strand of the dsDNA molecule comprise chemically modified cytosine nucleotides, wherein the chemically modified cytosine nucleotides comprise 5-hydroxycytosine.

[0274] 163. The dsDNA molecule as described in any of the preceding embodiments, wherein at least 1%, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 50%, at least 75%, or at least 90% of the cytosine positions in the sense strand of the dsDNA molecule comprise chemically modified cytosine nucleotides, wherein the chemically modified cytosine nucleotides comprise 5-hydroxycytosine.

[0275] 164. The dsDNA molecule as described in any of the foregoing embodiments, which encodes a protein and, when contacted with HEKa cells, for example, in the assay described herein, results in an expression level of at least 60%, at least 70%, at least 80%, at least 90%, at least 100%, or at least 125% of the expression of a control DNA molecule, wherein the control DNA molecule contains the same sequence, the same strand state, and the same circular or linear features as the dsDNA molecule, but contains unmodified cytosine nucleotides in place of these chemically modified cytosine nucleotides.

[0276] 165. The dsDNA molecule described in any of the preceding examples is not generated by nick translation.

[0277] 166. The dsDNA molecule described in any of the preceding examples is not produced in a microorganism.

[0278] 167. The dsDNA molecule as described in any of the preceding embodiments, which is produced in a cell-free system.

[0279] 168. The dsDNA molecule as described in any of the preceding embodiments, which is generated by PCR.

[0280] 169. The dsDNA molecule as described in any of the foregoing embodiments does not encode viral proteins.

[0281] 170. The dsDNA molecule described in any of the preceding examples encodes only mammalian proteins, such as human proteins.

[0282] 171. A pharmaceutical composition comprising a dsDNA molecule as described in any of the foregoing embodiments.

[0283] 172. The pharmaceutical composition as described in Example 171, wherein the dsDNA molecule lacks a portion of the carrier backbone material, for example, lacks the carrier backbone, or does not contain a non-human (e.g., bacterial) origin of replication.

[0284] 173. The pharmaceutical composition as described in Examples 171 or 172, wherein the dsDNA molecule is not capsidated.

[0285] 174. The pharmaceutical composition as described in any one of Examples 171-173, wherein the dsDNA molecule does not contain viral packaging signals.

[0286] 175. The pharmaceutical composition as described in any one of Examples 171-174, wherein the dsDNA molecule does not contain viral ITR.

[0287] 176. The pharmaceutical composition as described in any one of Examples 171-175, which is substantially free of viral proteins.

[0288] 177. The pharmaceutical composition as described in any one of Examples 171-176, which is substantially free of RNA.

[0289] 178. The pharmaceutical composition as described in any one of Examples 171-177, which is substantially free of single-stranded DNA.

[0290] 179. The pharmaceutical composition as described in any one of Examples 171-178, which is substantially free of DNA fragments.

[0291] 180. The pharmaceutical composition as described in any one of Examples 171-179, which is substantially free of open-terminated double-stranded DNA.

[0292] 181. The pharmaceutical composition as described in any one of Examples 171-180, which is substantially free of microorganisms.

[0293] 182. The pharmaceutical composition as described in any one of Examples 171-181, which is substantially free of bacterial proteins.

[0294] 183. The pharmaceutical composition as described in any one of Examples 171-182, which is substantially free of bacterial DNA.

[0295] 184. The pharmaceutical composition of any one of Examples 171-183, wherein the pharmaceutical composition comprises a plurality of dsDNA molecules, and wherein all dsDNA molecules in the pharmaceutical composition have substantially the same nucleotide length (e.g., all dsDNA molecules in the pharmaceutical composition have the same nucleotide length).

[0296] 185. The pharmaceutical composition of any one of Examples 171-183, wherein the pharmaceutical composition comprises a plurality of dsDNA molecules, and wherein at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% of the dsDNA molecules in the pharmaceutical composition have the same nucleotide length.

[0297] 186. The pharmaceutical composition of any one of Examples 171-185, wherein the pharmaceutical composition comprises a plurality of dsDNA molecules, wherein the dsDNA molecules comprise a therapeutic loading sequence, and wherein the therapeutic loading sequences of the dsDNA molecules in the pharmaceutical composition have substantially the same nucleotide length (e.g., the therapeutic loading sequences of the dsDNA molecules in the pharmaceutical composition have the same nucleotide length).

[0298] 187. The pharmaceutical composition of any one of Examples 171-186, wherein the pharmaceutical composition comprises a plurality of dsDNA molecules, and wherein all the dsDNA molecules in the pharmaceutical composition have a length between 100, 200, 500 or 1000 nucleotides.

[0299] 188. The pharmaceutical composition of any one of Examples 171-187, wherein the pharmaceutical composition comprises a plurality of dsDNA molecules, and wherein all dsDNA molecules in the pharmaceutical composition have a length between 500-1000, 1000-2000, 2000-3000, 3000-4000, 4000-5000, 5000-6000, 6000-7000, 7000-8000, 8000-9000, 9000-10000, 10000-11000, or 11000-12000 nucleotides.

[0300] 189. The pharmaceutical composition as described in any one of Examples 171-188, wherein the pharmaceutical composition comprises a plurality of dsDNA molecules, and wherein all dsDNA molecules in the pharmaceutical composition encode substantially the same effector (e.g., all dsDNA molecules in the pharmaceutical composition encode the same effector).

[0301] 190. The pharmaceutical composition as described in any one of Examples 171-189, wherein the pharmaceutical composition comprises a plurality of dsDNA molecules, and wherein all dsDNA molecules in the pharmaceutical composition have substantially the same sequence (e.g., all dsDNA molecules in the pharmaceutical composition have the same sequence).

[0302] 191. The pharmaceutical composition as described in any one of Examples 171-190, wherein the dsDNA molecule is contained in lipid nanoparticles (LNPs).

[0303] 192. The pharmaceutical composition as described in any one of Examples 171-191, further comprising an electroporation buffer.

[0304] 193. The pharmaceutical composition as described in any one of Examples 171-192, further comprising a transfection reagent.

[0305] 194. A pharmaceutical composition comprising a plurality of dsDNA molecules as described in any one of Examples 1-170.

[0306] 195. The pharmaceutical composition as described in Example 194, wherein the plurality of dsDNA molecules comprise:

[0307] a) A first subgroup of dsDNA molecules as described in any one of Examples 1-170, wherein all dsDNA molecules in the first subgroup have the same DNA sequence, and

[0308] b) At least one additional dsDNA molecule as described in any one of Examples 1-170, wherein the additional dsDNA molecule has a DNA sequence different from that of the dsDNA molecules in the first subgroup.

[0309] 196. The pharmaceutical composition as described in Example 195, wherein the first subgroup of the dsDNA molecule has the desired DNA sequence.

[0310] 197. The pharmaceutical composition as described in Example 196, wherein the additional dsDNA molecule has one or more errors relative to the desired DNA sequence.

[0311] 198. The pharmaceutical composition as described in Example 197, wherein one or more errors include one or more of substitution, insertion, or deletion.

[0312] 199. The pharmaceutical composition as described in any one of Examples 195-198, wherein at least 20% or at least 30% of the dsDNA molecules in the pharmaceutical composition are part of the first subgroup.

[0313] 200. The pharmaceutical composition as described in any one of Examples 195-199, wherein 10%-15%, 15%-20%, 20%-25%, or 25%-30% of the dsDNA molecules in the pharmaceutical composition are part of the first subgroup.

[0314] 201. The pharmaceutical composition of any one of Examples 194-200, wherein the dsDNA molecules of the plurality of dsDNA molecules contain an amplicon region that originates from the start codon of the polypeptide encoded by the dsDNA molecules and extends in the transcriptional direction for at least 200 base pairs, at least 210 base pairs, at least 220 base pairs, at least 230 base pairs, at least 240 base pairs, or at least 250 base pairs.

[0315] 202. The pharmaceutical composition of any one of Examples 194-201, wherein the dsDNA molecules of the plurality of dsDNA molecules contain an amplicon region that originates from the start codon of the polypeptide encoded by the dsDNA molecules and extends in the transcriptional direction for 200 to 210 base pairs, 210 to 220 base pairs, 220 to 230 base pairs, 230 to 240 base pairs, or 240 to 250 base pairs.

[0316] 203. The pharmaceutical composition of any one of Examples 194-202, wherein the dsDNA molecules of the plurality of dsDNA molecules contain an amplicon region that originates from the start codon of the polypeptide encoded by the dsDNA molecules and extends for 230 base pairs in the transcriptional direction.

[0317] 204. The pharmaceutical composition as described in any one of Examples 201-203, wherein the plurality of dsDNA molecules comprise:

[0318] a) A first subgroup of dsDNA molecules as described in any one of Examples 1-170, wherein each amplicon region in the first subgroup has the same DNA sequence, and

[0319] b) At least one additional dsDNA molecule as described in any one of Examples 1-170, wherein the amplicon region of the additional dsDNA molecule has a DNA sequence different from that of the amplicon region in the first subgroup.

[0320] 205. The pharmaceutical composition as described in Example 204, wherein the amplicon region of the first subgroup of the dsDNA molecule has the desired DNA sequence.

[0321] 206. The pharmaceutical composition as described in Example 205, wherein the amplicon region of the additional dsDNA molecule has one or more errors relative to the desired DNA sequence.

[0322] 207. The pharmaceutical composition as described in Example 206, wherein one or more errors include one or more of substitution, insertion, or deletion.

[0323] 208. The pharmaceutical composition of any one of Examples 204-207, wherein at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, or at least 75% of the dsDNA molecules in the pharmaceutical composition are part of the first subgroup.

[0324] 209. The pharmaceutical composition of any one of Examples 204-208, wherein 30%-75%, for example 30%-40%, 40%-50%, 50%-60%, 60%-65%, 65%-70%, or 70%-75% of the dsDNA molecules in the pharmaceutical composition are part of the first subgroup.

[0325] 210. The pharmaceutical composition of any one of Examples 196-209, wherein the dsDNA molecule in the pharmaceutical composition has an average of less than 5, less than 3, less than 2, less than 1.5 or less than 1.13 substitutions / kilobases relative to the desired DNA sequence.

[0326] 211. The pharmaceutical composition of any one of Examples 196-210, wherein the dsDNA molecule in the pharmaceutical composition has an average of 1-5, for example 1-2, 2-3, 3-4, 4-5 or 1.13-2 or 1.13-3 substitutions / kilobases relative to the desired DNA sequence.

[0327] 212. The pharmaceutical composition of any one of Examples 196-211, wherein the dsDNA molecule in the pharmaceutical composition has an average of less than 0.1, less than 0.05, less than 0.04, or less than 0.03 insertions / kilobases relative to the desired DNA sequence.

[0328] 213. The pharmaceutical composition of any one of Examples 196-212, wherein the dsDNA molecules in the pharmaceutical composition have an average of 0.01-0.1, for example 0.01-0.05, 0.05-0.1 or 0.02-0.04 inserts / kilobases relative to the desired DNA sequence.

[0329] 214. The pharmaceutical composition of any one of Examples 196-213, wherein the dsDNA molecules in the pharmaceutical composition have an average of less than 0.5, less than 0.25, less than 0.2, or less than 0.17 deletions / kilobases relative to the desired DNA sequence.

[0330] 215. The pharmaceutical composition of any one of Examples 196-214, wherein the dsDNA molecules in the pharmaceutical composition have an average of 0.1-0.5 deletions / kbps relative to the desired DNA sequence, for example 0.1-0.3, 0.3-0.5, 0.15-0.25, or 0.1-0.2 deletions / kbps.

[0331] 216. The pharmaceutical composition of any one of Examples 196-215, wherein the dsDNA molecule in the pharmaceutical composition has an average of less than 4, less than 3, less than 2, or less than 1.33 errors per kilobase relative to the desired DNA sequence.

[0332] 217. The pharmaceutical composition as described in any one of Examples 196-216, wherein the dsDNA molecule in the pharmaceutical composition has an average of 1-4, for example 1-2, 2-3, 3-4 or 1.33-3 errors / kbps relative to the desired DNA sequence.

[0333] 218. The pharmaceutical composition of any one of Examples 205-217, wherein in the amplicon region, at least 98%, at least 99%, at least 99.5%, at least 99.8%, or at least 99.845% of the adenine positions in the desired DNA sequence are adenine in the dsDNA molecule of the pharmaceutical composition.

[0334] 219. The pharmaceutical composition of any one of Examples 205-218, wherein in the amplicon region, an average of 98%-99.85%, for example 98%-99%, 99%-99.5%, 99.5%-99.85%, or 99%-99.85% of the adenine position in the desired DNA sequence is adenine in the dsDNA molecule of the pharmaceutical composition.

[0335] 220. The pharmaceutical composition of any one of Examples 205-219, wherein in the amplicon region, the adenine position in the desired DNA sequence is cytosine at an average of less than 0.05%, less than 0.03%, less than 0.02%, or less than 0.017% on average in the dsDNA molecule of the pharmaceutical composition.

[0336] 221. The pharmaceutical composition of any one of Examples 205-220, wherein in the amplicon region, an average of 0.015%-0.05%, for example 0.015%-0.03%, 0.03%-0.05%, or 0.015%-0.02% of the adenine position in the desired DNA sequence is cytosine in the dsDNA molecule of the pharmaceutical composition.

[0337] 222. The pharmaceutical composition of any one of Examples 205-221, wherein in the amplicon region, the adenine position in the desired DNA sequence is guanine at an average of less than 0.5%, less than 0.3%, less than 0.2%, less than 0.15%, or less than 0.102% on average in the dsDNA molecule of the pharmaceutical composition.

[0338] 223. The pharmaceutical composition of any one of Examples 205-222, wherein in the amplicon region, an average of 0.1%-0.5%, for example 0.1%-0.3%, 0.3%-0.5%, 0.1%-0.2%, or 0.1%-0.15% of the adenine position in the desired DNA sequence is guanine.

[0339] 224. The pharmaceutical composition of any one of Examples 205-223, wherein in the amplicon region, the adenine position in the desired DNA sequence is thymine at an average of less than 0.1%, less than 0.05%, less than 0.03%, less than 0.025%, or less than 0.022% on average in the dsDNA molecule of the pharmaceutical composition.

[0340] 225. The pharmaceutical composition of any one of Examples 205-224, wherein in the amplicon region, an average of 0.02%-0.1%, for example 0.02%-0.05%, 0.05%-0.1%, 0.02-0.03%, or 0.02-0.025% of the adenine position in the dsDNA molecule of the pharmaceutical composition is thymine.

[0341] 226. The pharmaceutical composition of any one of Examples 205-225, wherein in the amplicon region, an average of less than 0.1%, less than 0.05%, less than 0.03%, less than 0.02%, less than 0.015%, or less than 0.013% of the adenine sites in the desired DNA sequence are absent in the dsDNA molecule of the pharmaceutical composition.

[0342] 227. The pharmaceutical composition of any one of Examples 205-226, wherein, in the amplicon region, an average of 0.01%-0.1%, for example 0.01%-0.05%, 0.05%-0.1%, 0.01%-0.03%, 0.01%-0.02%, or 0.01%-0.015% of the adenine position in the desired DNA sequence is absent in the dsDNA molecule of the pharmaceutical composition.

[0343] 228. The pharmaceutical composition of any one of Examples 205-227, wherein in the amplicon region, an average of less than 0.01%, less than 0.005%, less than 0.003%, less than 0.0025%, or less than 0.002% of the adenine position in the desired DNA sequence comprises one or more inserted nucleotides at the 5' or 3' position of the adenine in the dsDNA molecule of the pharmaceutical composition.

[0344] 229. The pharmaceutical composition of any one of Examples 205-228, wherein in the amplicon region, an average of 0.0015%-0.01%, for example 0.0015%-0.005%, 0.005%-0.01%, 0.0015%-0.003%, or 0.0015%-0.0025% of the adenine position in the desired DNA sequence comprises one or more inserted nucleotides at the 5' or 3' position of the adenine in the dsDNA molecule of the pharmaceutical composition.

[0345] 230. The pharmaceutical composition of any one of Examples 205-229, wherein in the amplicon region, at least 98%, at least 99%, at least 99.5%, at least 99.8%, or at least 99.874% of the cytosine positions in the desired DNA sequence are cytosine in the dsDNA molecule of the pharmaceutical composition.

[0346] 231. The pharmaceutical composition as described in any one of Examples 205-230, wherein in the amplicon region, an average of 98%-99.88%, for example 98%-99%, 99%-99.88%, 99.5%-99.88%, or 99.8%-99.88% of the cytosine positions in the desired DNA sequence are cytosine.

[0347] 232. The pharmaceutical composition of any one of Examples 205-231, wherein in the amplicon region, the cytosine positions in the dsDNA molecule of the desired DNA sequence, on average, are adenine at a rate of less than 0.1%, less than 0.05%, less than 0.03%, or less than 0.029%.

[0348] 233. The pharmaceutical composition of any one of Examples 205-232, wherein in the amplicon region, an average of 0.025%-0.1%, for example 0.025%-0.05%, 0.05%-0.1%, or 0.025%-0.03% of the cytosine positions in the desired DNA sequence are adenine in the dsDNA molecule of the pharmaceutical composition.

[0349] 234. The pharmaceutical composition of any one of Examples 205-233, wherein in the amplicon region, the cytosine positions in the desired DNA sequence at an average of less than 0.02%, less than 0.015%, less than 0.01%, less than 0.009%, or less than 0.008% are guanine in the dsDNA molecule of the pharmaceutical composition.

[0350] 235. The pharmaceutical composition of any one of Examples 205-234, wherein in the amplicon region, an average of 0.005%-0.02%, for example 0.005%-0.015%, 0.015%-0.02%, 0.005%-0.01%, or 0.005%-0.009% of the cytosine position in the desired DNA sequence is guanine.

[0351] 236. The pharmaceutical composition of any one of Examples 205-235, wherein in the amplicon region, the cytosine positions in the dsDNA molecule of the desired DNA sequence, which are less than 0.1%, less than 0.08%, less than 0.07%, or less than 0.066% on average, are thymine.

[0352] 237. The pharmaceutical composition of any one of Examples 205-236, wherein, in the amplicon region, an average of 0.06%-0.1%, for example 0.06%-0.08%, 0.08%-0.1%, or 0.06%-0.07% of the cytosine position in the desired DNA sequence is thymine.

[0353] 238. The pharmaceutical composition of any one of Examples 205-237, wherein, in the amplicon region, cytosine positions in the desired DNA sequence at an average of less than 0.1%, less than 0.05%, less than 0.03%, less than 0.025%, or less than 0.02% are absent in the dsDNA molecule of the pharmaceutical composition.

[0354] 239. The pharmaceutical composition of any one of Examples 205-238, wherein, in the amplicon region, an average of 0.01%-0.1%, for example 0.01%-0.05%, 0.05%-0.1%, 0.01%-0.03%, or 0.01%-0.025% of the cytosine positions in the desired DNA sequence are absent in the dsDNA molecule of the pharmaceutical composition.

[0355] 240. The pharmaceutical composition of any one of Examples 205-239, wherein in the amplicon region, less than 0.01%, less than 0.005%, less than 0.004%, less than 0.0035%, or less than 0.003% of the cytosine position in the desired DNA sequence on average comprises one or more inserted nucleotides at the 5' or 3' position of the cytosine in the dsDNA molecule of the pharmaceutical composition.

[0356] 241. The pharmaceutical composition of any one of Examples 205-240, wherein in the amplicon region, an average of 0.0025%-0.01%, for example 0.0025%-0.005%, 0.005%-0.01%, 0.0025%-0.004%, or 0.0025%-0.0035% of the cytosine position in the desired DNA sequence comprises one or more inserted nucleotides at the 5' or 3' position of the cytosine in the dsDNA molecule of the pharmaceutical composition.

[0357] 242. The pharmaceutical composition of any one of Examples 205-241, wherein in the amplicon region, at least 98%, at least 99%, at least 99.5%, at least 99.8%, or at least 99.875% of the guanine positions in the desired DNA sequence are guanine in the dsDNA molecule of the pharmaceutical composition.

[0358] 243. The pharmaceutical composition as described in any one of Examples 205-242, wherein in the amplicon region, an average of 98%-99.88%, for example 98%-99%, 99%-99.88%, 99.5%-99.88%, or 99.8%-99.88% of the guanine positions in the dsDNA molecule of the pharmaceutical composition are guanine.

[0359] 244. The pharmaceutical composition of any one of Examples 205-243, wherein in the amplicon region, the guanine positions in the desired DNA sequence at an average of less than 0.1%, less than 0.08%, less than 0.07%, or less than 0.065% are adenine in the dsDNA molecule of the pharmaceutical composition.

[0360] 245. The pharmaceutical composition of any one of Examples 205-244, wherein, in the amplicon region, an average of 0.06%-0.1%, for example 0.06%-0.08%, 0.08%-0.1%, or 0.06%-0.07% of the guanine position in the desired DNA sequence is adenine in the dsDNA molecule of the pharmaceutical composition.

[0361] 246. The pharmaceutical composition of any one of Examples 205-245, wherein in the amplicon region, the guanine positions in the desired DNA sequence at an average of less than 0.1%, less than 0.05%, less than 0.03%, less than 0.02%, or less than 0.01% are cytosine in the dsDNA molecule of the pharmaceutical composition.

[0362] 247. The pharmaceutical composition of any one of Examples 205-246, wherein in the amplicon region, the guanine position in the desired DNA sequence is cytosine at an average of 0.009%-0.1%, such as 0.009%-0.05%, 0.05%-0.1%, 0.009%-0.03%, or 0.009%-0.02%.

[0363] 248. The pharmaceutical composition of any one of Examples 205-247, wherein in the amplicon region, the guanine position in the desired DNA sequence is thymine at an average of less than 0.1%, less than 0.05%, less than 0.03%, less than 0.025%, or less than 0.024% on average in the dsDNA molecule of the pharmaceutical composition.

[0364] 249. The pharmaceutical composition of any one of Examples 205-248, wherein in the amplicon region, the guanine position in the desired DNA sequence is thymine at an average of 0.02%-0.1%, for example 0.02%-0.05%, 0.05%-0.1%, 0.02%-0.03%, or 0.02%-0.025% on average.

[0365] 250. The pharmaceutical composition of any one of Examples 205-249, wherein, in the amplicon region, less than 0.1%, less than 0.05%, less than 0.03%, less than 0.025%, or less than 0.021% of the guanine positions in the desired DNA sequence on average are absent in the dsDNA molecule of the pharmaceutical composition.

[0366] 251. The pharmaceutical composition of any one of Examples 205-250, wherein, in the amplicon region, an average of 0.02%-0.1%, for example 0.02%-0.05%, 0.05%-0.1%, 0.02%-0.03%, or 0.02%-0.025% of the guanine position in the desired DNA sequence is absent in the dsDNA molecule of the pharmaceutical composition.

[0367] 252. The pharmaceutical composition of any one of Examples 205-251, wherein in the amplicon region, less than 0.01%, less than 0.007%, less than 0.006%, less than 0.005%, or less than 0.004% of the guanine position in the desired DNA sequence comprises one or more inserted nucleotides at the 5' or 3' position of the guanine in the dsDNA molecule of the pharmaceutical composition.

[0368] 253. The pharmaceutical composition of any one of Examples 205-252, wherein in the amplicon region, an average of 0.0035%-0.01%, for example 0.0035%-0.007%, 0.007%-0.01%, 0.0035%-0.006%, or 0.0035%-0.005% of the guanine position in the desired DNA sequence comprises one or more inserted nucleotides at the 5' or 3' position of the guanine in the dsDNA molecule of the pharmaceutical composition.

[0369] 254. The pharmaceutical composition of any one of Examples 205-253, wherein in the amplicon region, at least 98%, at least 99%, at least 99.5%, at least 99.8%, or at least 99.865% of the thymine positions in the desired DNA sequence are thymine in the dsDNA molecule of the pharmaceutical composition.

[0370] 255. The pharmaceutical composition as described in any one of Examples 205-254, wherein in the amplicon region, an average of 98%-99.87%, for example 98%-99%, 99%-99.87%, 99.5%-99.87%, or 99.8%-99.87% of the thymine position in the dsDNA molecule of the pharmaceutical composition is thymine.

[0371] 256. The pharmaceutical composition of any one of Examples 205-255, wherein, in the amplicon region, the thymine positions in the desired DNA sequence at an average of less than 0.1%, less than 0.05%, less than 0.04%, less than 0.03%, or less than 0.025% are adenine in the dsDNA molecule of the pharmaceutical composition.

[0372] 257. The pharmaceutical composition of any one of Examples 205-256, wherein in the amplicon region, the thymine position in the desired DNA sequence is adenine at an average of 0.02%-0.1%, for example 0.02%-0.05%, 0.05%-0.1%, 0.02%-0.04%, or 0.02%-0.03% on average.

[0373] 258. The pharmaceutical composition of any one of Examples 205-257, wherein in the amplicon region, the thymine position in the dsDNA molecule of the desired DNA sequence is cytosine at an average of less than 0.1%, less than 0.09%, less than 0.08%, less than 0.07%, or less than 0.069%.

[0374] 259. The pharmaceutical composition of any one of Examples 205-258, wherein in the amplicon region, the thymine position in the desired DNA sequence is cytosine at an average of 0.06%-0.1%, such as 0.06%-0.08%, 0.08%-0.1%, 0.06%-0.09%, or 0.06%-0.07%.

[0375] 260. The pharmaceutical composition of any one of Examples 205-259, wherein, in the amplicon region, the thymine position in the desired DNA sequence is guanine at an average of less than 0.1%, less than 0.05%, less than 0.04%, less than 0.03%, or less than 0.028% on average in the dsDNA molecule of the pharmaceutical composition.

[0376] 261. The pharmaceutical composition of any one of Examples 205-260, wherein in the amplicon region, the thymine position in the desired DNA sequence is guanine at an average of 0.02%-0.1%, for example 0.02%-0.05%, 0.05%-0.1%, 0.02%-0.04%, or 0.02%-0.03% on average.

[0377] 262. The pharmaceutical composition of any one of Examples 205-261, wherein, in the amplicon region, thymine positions in the desired DNA sequence at an average of less than 0.1%, less than 0.05%, less than 0.02%, less than 0.015%, or less than 0.011% are absent in the dsDNA molecule of the pharmaceutical composition.

[0378] 263. The pharmaceutical composition of any one of Examples 205-262, wherein, in the amplicon region, an average of 0.01%-0.1%, for example 0.01%-0.05%, 0.05%-0.1%, 0.01%-0.02%, or 0.01%-0.015% of the thymine position in the desired DNA sequence is absent in the dsDNA molecule of the pharmaceutical composition.

[0379] 264. The pharmaceutical composition of any one of Examples 205-263, wherein in the amplicon region, less than 0.01%, less than 0.005%, less than 0.003%, less than 0.0025%, or less than 0.002% of the thymine position in the desired DNA sequence comprises one or more inserted nucleotides at the 5' or 3' position of the thymine in the dsDNA molecule of the pharmaceutical composition.

[0380] 265. The pharmaceutical composition of any one of Examples 205-264, wherein in the amplicon region, an average of 0.0015%-0.01%, for example 0.0015%-0.005%, 0.005%-0.01%, 0.0015%-0.003%, or 0.0015%-0.0025% of the thymine position in the desired DNA sequence comprises one or more inserted nucleotides at the 5' or 3' position of the thymine in the dsDNA molecule of the pharmaceutical composition.

[0381] 266. The pharmaceutical composition as described in any one of Examples 194-265, wherein when the plurality of dsDNA molecules are introduced into a cell, the cell transcribes the dsDNA molecules to produce a plurality of RNA molecules comprising:

[0382] a) A first subgroup of RNA molecules, wherein all RNA molecules in this first subgroup have the same RNA sequence, and

[0383] b) At least one additional RNA molecule, wherein the additional RNA molecule has an RNA sequence different from that of the RNA molecules in the first subgroup.

[0384] 267. The pharmaceutical composition as described in Example 266, wherein the first subgroup of the RNA molecule has the desired RNA sequence.

[0385] 268. The pharmaceutical composition as described in Example 267, wherein the additional RNA molecule has one or more errors relative to the desired RNA sequence.

[0386] 269. The pharmaceutical composition as described in Example 268, wherein one or more errors include one or more of substitution, insertion, or deletion.

[0387] 270. The pharmaceutical composition as described in any one of Examples 266-268, wherein at least 20% or at least 30% of the plurality of RNA molecules are part of the first subgroup.

[0388] 271. The pharmaceutical composition as described in any one of Examples 266-269, wherein 10%-15%, 15%-20%, 20%-25%, or 25%-30% of the RNA molecules in the pharmaceutical composition are part of the first subgroup.

[0389] 272. The pharmaceutical composition of any one of Examples 194-271, wherein when the plurality of dsDNA molecules are introduced into a cell, the cell transcribes the dsDNA molecules to produce a plurality of RNA molecules comprising: an amplicon region that originates from the start codon of the polypeptide encoded by the dsDNA molecules and extends in the transcriptional direction for at least 200 base pairs, at least 210 base pairs, at least 220 base pairs, at least 230 base pairs, at least 240 base pairs, or at least 250 base pairs.

[0390] 273. The pharmaceutical composition of any one of Examples 194-272, wherein when the plurality of dsDNA molecules are introduced into a cell, the cell transcribes the dsDNA molecules to produce a plurality of RNA molecules comprising: an amplicon region that originates from the start codon of the polypeptide encoded by the dsDNA molecules and extends in the transcriptional direction for 200 to 210 base pairs, 210 to 220 base pairs, 220 to 230 base pairs, 230 to 240 base pairs, or 240 to 250 base pairs.

[0391] 274. The pharmaceutical composition of any one of Examples 194-273, when the plurality of dsDNA molecules are introduced into a cell, the cell transcribes the dsDNA molecules to produce a plurality of RNA molecules comprising: an amplicon region that originates from the start codon of the polypeptide encoded by the dsDNA molecules and extends for 230 base pairs along the transcription direction.

[0392] 275. The pharmaceutical composition as described in any one of Examples 272-274, wherein the plurality of RNA molecules comprise:

[0393] a) The first subgroup of RNA molecules, wherein each amplicon region in the first subgroup has the same RNA sequence, and

[0394] b) At least one additional RNA molecule, wherein the amplicon region of the additional RNA molecule has an RNA sequence different from that of the amplicon region in the first subgroup.

[0395] 276. The pharmaceutical composition as described in Example 275, wherein the amplicon region of the first subgroup of the RNA molecule has the desired RNA sequence.

[0396] 277. The pharmaceutical composition as described in Example 276, wherein the amplicon region of the additional RNA molecule has one or more errors relative to the desired RNA sequence.

[0397] 278. The pharmaceutical composition as described in Example 277, wherein one or more errors include one or more of substitution, insertion, or deletion.

[0398] 279. The pharmaceutical composition as described in any one of Examples 275-278, wherein at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 75%, or at least 80% of the RNA molecules are part of the first subgroup.

[0399] 280. The pharmaceutical composition as described in any one of Examples 275-279, wherein 10%-20%, 20%-30%, 30%-40%, 40%-50%, 50%-60%, 60%-70%, 70%-75%, or 75%-80% of these RNA molecules are part of the first subgroup.

[0400] 281. The pharmaceutical composition as described in any one of Examples 267-280, wherein the RNA molecules in the plurality of RNA molecules have an average of less than 5, less than 4, less than 3, less than 2, less than 1.5 or less than 1.1 substitutions / kilobases relative to the desired RNA sequence.

[0401] 282. The pharmaceutical composition as described in any one of Examples 267-281, wherein the RNA molecules in the plurality of RNA molecules have an average of 1-5, for example 1-3, 3-5 or 1.1-3 substitutions / kilobases relative to the desired RNA sequence.

[0402] 283. The pharmaceutical composition as described in any one of Examples 267-282, wherein the RNA molecules in the plurality of RNA molecules have an average of less than 0.5, less than 0.2, less than 0.1, less than 0.08, or less than 0.07 inserts / kilobases relative to the desired RNA sequence.

[0403] 284. The pharmaceutical composition of any one of Examples 267-283, wherein the RNA molecules in the plurality of RNA molecules have an average of 0.06-0.5, for example 0.06-0.1, 0.1-0.5, or 0.07-0.2 inserts / kilobases relative to the desired RNA sequence.

[0404] 285. The pharmaceutical composition as described in any one of Examples 267-284, wherein the RNA molecules in the plurality of RNA molecules have an average of less than 1, less than 0.5, less than 0.4, or less than 0.3 deletions / kilobases relative to the desired RNA sequence.

[0405] 286. The pharmaceutical composition of any one of Examples 267-285, wherein the RNA molecules in the plurality of RNA molecules have an average of 0.29-1, for example 0.29-0.5, 0.5-1, or 0.3-0.5 deletions / kilobases relative to the desired RNA sequence.

[0406] 287. The pharmaceutical composition as described in any one of Examples 267-286, wherein the RNA molecules in the plurality of RNA molecules have an average of less than 5, less than 3, less than 2, less than 1.5, or less than 1.47 errors per kilobase relative to the desired RNA sequence.

[0407] 288. The pharmaceutical composition as described in any one of Examples 267-287, wherein the RNA molecules in the plurality of RNA molecules have an average of 1.46-5, for example 1.46-2, 2-3, 3-5 or 1.46-3 errors / kbps relative to the desired RNA sequence.

[0408] 289. The pharmaceutical composition as described in any one of Examples 266-288, wherein the cell type is HEKa.

[0409] 290. The pharmaceutical composition of any one of Examples 194-289, wherein at least 80% of the plurality of dsDNA molecules have chemically modified cytosine nucleotides at at least 1%, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 50%, or at least 75% of the cytosine positions in the dsDNA molecules.

[0410] 291. The pharmaceutical composition of any one of Examples 194-289, wherein at least 80% of the plurality of dsDNA molecules have chemically modified cytosine nucleotides at 1%-75% (e.g., 1-5%, 5-10%, 10-15%, 15-20%, 20-25%, 25-30%, 30-35%, 35-40%, 40-45%, 45-50%, 50-55%, 55-60%, 60-65%, 65-70%, or 70-75%) of the cytosine positions in the dsDNA molecules.

[0411] 292. The pharmaceutical composition of any one of Examples 194-289, wherein at least 50% of the plurality of dsDNA molecules have chemically modified cytosine nucleotides at at least 1%, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 50%, or at least 75% of the cytosine positions in the dsDNA molecules.

[0412] 293. The pharmaceutical composition of any one of Examples 194-289, wherein at least 50% of the plurality of dsDNA molecules have chemically modified cytosine nucleotides at 1%-75% (e.g., 1-5%, 5-10%, 10-15%, 15-20%, 20-25%, 25-30%, 30-35%, 35-40%, 40-45%, 45-50%, 50-55%, 55-60%, 60-65%, 65-70%, or 70-75%) of the cytosine positions in the dsDNA molecules.

[0413] 294. The pharmaceutical composition of any one of Examples 194-289, wherein at least 90% of the plurality of dsDNA molecules have chemically modified cytosine nucleotides at at least 1%, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 50%, or at least 75% of the cytosine positions in the dsDNA molecules.

[0414] 295. The pharmaceutical composition of any one of Examples 194-289, wherein at least 90% of the plurality of dsDNA molecules have chemically modified cytosine nucleotides at 1%-75% (e.g., 1-5%, 5-10%, 10-15%, 15-20%, 20-25%, 25-30%, 30-35%, 35-40%, 40-45%, 45-50%, 50-55%, 55-60%, 60-65%, 65-70%, or 70-75%) of the cytosine positions in the dsDNA molecules.

[0415] 296. A method for preparing or manufacturing double-stranded DNA (dsDNA) molecules, the method comprising:

[0416] (a) Providing a composition comprising a DNA template (e.g., a plasmid), a forward primer, a reverse primer, a DNA polymerase, an unmodified deoxyribonucleotide, and a chemically modified cytosine nucleotide having a substitution other than hydrogen at the 5-carbon position of the cytosine; and

[0417] (b) Perform a polymerase chain reaction on the composition of (a).

[0418] Thus, the dsDNA molecule is prepared or manufactured, wherein optionally, the dsDNA molecule is the dsDNA molecule as described in any one of Examples 1-170.

[0419] 297. The method as described in Example 296, wherein the method further comprises purifying the dsDNA molecule, for example, wherein purification comprises using a DNA purification column or agarose gel purification.

[0420] 298. The method as described in Examples 296 or 297, wherein the DNA polymerase comprises KOD polymerase, KODXtreme polymerase, Deep Vent polymerase, or KOD Multi&Epi polymerase.

[0421] 299. The method as described in any one of Examples 296-298, wherein the unmodified deoxyribonucleotide comprises dATP, dCTP, dTTP and dGTP.

[0422] 300. A method for preparing or manufacturing a double-stranded DNA (dsDNA) molecule comprising a chemically modified cytosine nucleotide having a substitution other than hydrogen at the carbon 5 position of cytosine, the method comprising:

[0423] (a) Provide input dsDNA containing cytosine nucleotides, such as modified or unmodified cytosine nucleotides; and

[0424] (b) Incubate the input dsDNA from (a) with an enzyme that chemically modifies cytosine (e.g., 5-hmC glucosyltransferase).

[0425] Thus, dsDNA molecules comprising chemically modified cytosine nucleotides are prepared or manufactured, wherein optionally, the dsDNA molecule comprises the dsDNA molecule as described in any one of Examples 1-170.

[0426] 301. The method as described in Example 300, wherein (a) further comprises performing a polymerase chain reaction on a composition comprising a DNA template (e.g., a plasmid), a forward primer, a reverse primer, a DNA polymerase, and deoxyribonucleotides (e.g., unmodified or modified deoxyribonucleotides).

[0427] 302. The method as described in Example 300 or 301, wherein the chemically modified cytosine nucleotide comprises glucosyl-5-hydroxymethylcytosine.

[0428] 303. The method as described in any one of Examples 296-302, wherein the percentage of cytosine nucleotides as chemically modified cytosine nucleotides in the composition of (a) is 10%-20%, 20%-30%, 30%-40%, 40%-50%, 50%-60%, 60%-70%, or 70%-80%.

[0429] 304. The method as described in any one of Examples 296-299 or 301-303, wherein the forward primer, the reverse primer, or both contain a protein telomerase recognition sequence, such as the TelN protein telomerase recognition sequence.

[0430] 305. The method as described in any one of Examples 296-304, wherein the method further comprises (e.g., after step (b)):

[0431] (c) Incubate the dsDNA molecule with a protein telomerase, such as TelN protein telomerase.

[0432] 306. The method as described in any one of Examples 296-299 or 301-305, wherein the forward primer, the reverse primer, or both contain a restriction enzyme recognition sequence.

[0433] 307. The method as described in Example 306, wherein the method further comprises:

[0434] (i) The dsDNA molecule is incubated with a restriction enzyme that cleaves the restriction enzyme recognition sequence to prepare the cleaved dsDNA molecule;

[0435] (ii) Incubate the cut dsDNA molecule with a DNA ligase, such as T3 DNA ligase, to prepare ligated dsDNA molecules; and / or

[0436] (iii) Optionally, the linked dsDNA molecule is incubated with an exonuclease such as T5 exonuclease.

[0437] 308. The method as described in any one of Examples 296-307, further comprising:

[0438] (d) Connection:

[0439] dsDNA molecules to

[0440] A hairpin DNA molecule comprises a circular region and a double-stranded region containing one or more chemically modified nucleotides.

[0441] 309. The method as described in any one of Examples 296-308, further comprising connecting:

[0442] dsDNA molecules to

[0443] A self-annealed DNA molecule comprising a first region and a second region, wherein the first region hybridizes with the second region.

[0444] 310. The method as described in Example 309, wherein the self-annealed DNA molecule further comprises a loop between the first region and the second region.

[0445] 311. The method as described in Example 310, wherein the loop comprises a heterologous functional sequence, such as a nuclear targeting sequence (e.g., a CT3 sequence); or a regulatory sequence.

[0446] 312. The method as described in Example 309, wherein the self-annealed DNA molecule does not contain any unhybridized nucleotides (e.g., wherein all nucleotides of the self-annealed DNA molecule are hybridized with another nucleotide).

[0447] 313. The method of any one of Examples 308-312, further comprising linking a second hairpin DNA molecule to the dsDNA molecule, wherein the second hairpin DNA molecule comprises a loop region and a double-stranded region, wherein optionally the second hairpin DNA molecule comprises one or more chemically modified nucleotides of one or both of the loop region and the double-stranded region.

[0448] 314. A dsDNA molecule produced by any one of Examples 296-313.

[0449] 315. A method for preparing or manufacturing TDSC, the method comprising:

[0450] a) Provides a dsDNA molecule prepared by the method described in any one of Examples 296-313, wherein the dsDNA molecule comprises closed ends;

[0451] b) Incubate the TDSC with a double-stranded DNA exonuclease, such as exonuclease III, for example, 1 μL of exonuclease III / 5 μg DNA in 50 μL at 37°C for 1 hour, for example, as described in Example 2;

[0452] c) Optionally, for example, purifying the TDSCs treated in step b) via a silica membrane column, such as as described in Example 2.

[0453] Thus, the TDSC is prepared or manufactured.

[0454] 316. A method for expressing a heterologous load in target cells, the method comprising:

[0455] (i) Introducing a dsDNA molecule as described in any one of Examples 1-170 or 314 into a target cell, wherein the dsDNA molecule encodes a heterologous load; and

[0456] (ii) Maintain (e.g., incubate) the cell under conditions suitable for expressing the heterologous load from the dsDNA molecule;

[0457] This allows the heterologous load to be expressed in the target cell.

[0458] 317. A method for regulating (e.g., increasing or decreasing) biological activity in target cells, the method comprising:

[0459] (i) Introducing a dsDNA molecule as described in any one of Examples 1-170 or 314 into a target cell, wherein the dsDNA molecule encodes a heterologous load that regulates biological activity in the target cell; and

[0460] (ii) Maintain (e.g., incubate) the cell under conditions suitable for expressing the heterologous load from the dsDNA molecule;

[0461] This regulates the biological activity of the target cells.

[0462] 318. A method for expressing a heterologous load in target cells, the method comprising:

[0463] (i) A dsDNA molecule as described in any one of Examples 1-170 or 314 is provided to a target cell, wherein the dsDNA molecule encodes a heterologous load; and

[0464] (ii) Maintain (e.g., incubate) the cell under conditions suitable for expressing the heterologous load from the dsDNA molecule;

[0465] This allows the heterologous load to be expressed in the target cell.

[0466] 319. A method for expressing a therapeutic load in target cells, the method comprising:

[0467] (i) Introducing a dsDNA molecule as described in any one of Examples 1-170 or 314 into target cells, wherein the dsDNA molecule contains a therapeutically loaded sequence; and

[0468] (ii) Maintain (e.g., incubate) the cell under conditions suitable for expressing a therapeutic load from the therapeutic load sequence of the dsDNA molecule;

[0469] This allows the therapeutic load to be expressed in the target cells.

[0470] 320. A method for delivering a heterologous payload to target cells, the method comprising:

[0471] A dsDNA molecule as described in any one of Examples 1-170 or 314 is introduced into a target cell, wherein the double-stranded region of the dsDNA molecule contains a sequence encoding a heterologous load; thereby delivering the heterologous load to the target cell.

[0472] 321. A method for delivering a therapeutic load to target cells, the method comprising:

[0473] The dsDNA molecule as described in any one of Examples 1-170 or 314 is introduced into the target cell, wherein the dsDNA molecule contains a therapeutic load sequence encoding a therapeutic load.

[0474] This allows the therapeutic load to be delivered to the target cell.

[0475] 322. A method for regulating (e.g., increasing or decreasing) biological activity in target cells, the method comprising:

[0476] (i) A dsDNA molecule as described in any one of Examples 1-170 or 314 is provided to a target cell, wherein the dsDNA molecule encodes a heterologous load that regulates biological activity in the target cell; and

[0477] (ii) Maintain (e.g., incubate) the cell under conditions suitable for expressing the heterologous load from the dsDNA molecule;

[0478] This regulates the biological activity of the target cells.

[0479] 323. The method as described in Example 322, wherein the heterologous load increases the biological activity in the target cells.

[0480] 324. The method as described in Example 322, wherein the heterologous load reduces biological activity in the target cells.

[0481] 325. A method for regulating (e.g., increasing or decreasing) biological activity in target cells, the method comprising:

[0482] (i) A dsDNA molecule as described in any one of Examples 1-170 or 314 is provided to a target cell, wherein the dsDNA molecule contains a therapeutic load sequence encoding a therapeutic load that regulates biological activity in the target cell; and

[0483] (ii) Maintain (e.g., incubate) the cell under conditions suitable for expressing the therapeutic load from the dsDNA molecule;

[0484] This regulates the biological activity of the target cells.

[0485] 326. The method as described in Example 325, wherein the therapeutic load increases the bioactivity in the target cells.

[0486] 327. The method as described in Example 325, wherein the therapeutic load reduces biological activity in the target cells.

[0487] 328. The method as described in any one of Examples 317 or 322-327, wherein the biological activity includes cell growth, cell metabolism, cell signaling, cell movement, specialization, interaction, division, transport, homeostasis, permeation or diffusion.

[0488] 329. The method as described in any one of Examples 316-328, wherein the cell is an animal cell, such as a mammalian cell, such as a human cell.

[0489] 330. The method as described in any one of Examples 316-329, performed in vitro or in vivo.

[0490] 331. A method for treating cells, tissues, or subjects in need, the method comprising:

[0491] The dsDNA molecule as described in any one of Examples 1-170 or 314 or the pharmaceutical composition as described in any one of Examples 171-295 is administered to the cell, tissue or subject, wherein the double-stranded region of the dsDNA molecule encodes a heterologous load;

[0492] This allows for the treatment of the cell, tissue, or subject.

[0493] 332. A method for treating cells, tissues, or subjects in need, the method comprising:

[0494] The dsDNA molecule as described in any one of Examples 1-170 or 314 or the pharmaceutical composition as described in any one of Examples 171-295 is administered to the cell, tissue or subject.

[0495] This allows for the treatment of the cell, tissue, or subject.

[0496] On one hand, the present invention is characterized by dsDNA molecules, such as therapeutic double-stranded constructs (“TDSC”).

[0497] In the embodiments, the dsDNA molecule has at least 15 nucleotides, at least 30 nucleotides, at least 50 nucleotides, at least 75 nucleotides, 100 nucleotides, at least 200 nucleotides, at least 300 nucleotides, at least 500 nucleotides, at least 750 nucleotides, at least 1,000 nucleotides, at least 2,000 nucleotides, at least 3,000 nucleotides, at least 4,000 nucleotides, at least 5,000 nucleotides, at least 6,000 nucleotides, at least 7,000 nucleotides, etc. At least 8,000 nucleotides, at least 9,000 nucleotides, at least 10,000 nucleotides, at least 11,000 nucleotides, at least 12,000 nucleotides, at least 15,000 nucleotides, at least 20,000 nucleotides, at least 25,000 nucleotides, at least 30,000 nucleotides, at least 35,000 nucleotides, at least 40,000 nucleotides, at least 45,000 nucleotides, at least 50,000 nucleotides, at least 60,000 nucleotides or more.

[0498] In the embodiments, the dsDNA molecule has between 20 and 1000 nucleotides, between 20 and 50 nucleotides, between 100 and 500 nucleotides, between 500 and 50,000 nucleotides, between 1,000 and 50,000 nucleotides, between 2,000 and 40,000 nucleotides, between 5,000 and 50,000 nucleotides, between 500 and 50,000 nucleotides, between 500 and 25,000 nucleotides, between 1,000 and 20,000 nucleotides, between 1,000 and 10,000 nucleotides, between 10,000 and 60,000 nucleotides, and between 1,000 and 20,000 nucleosides. Acids, nucleotides between 1,000 and 40,000, nucleotides between 500 and 1,000, nucleotides between 1,000 and 2,000, nucleotides between 2,000 and 3,000, nucleotides between 3,000 and 4,000, nucleotides between 4,000 and 5,000, nucleotides between 5,000 and 6,000, nucleotides between 6,000 and 7,000, nucleotides between 7,000 and 8,000, nucleotides between 8,000 and 9,000, nucleotides between 9,000 and 10,000, nucleotides between 10,000 and 11,000, or nucleotides between 11,000 and 12,000.

[0499] In the embodiments, the dsDNA molecule contains at least one nucleotide modification, such as a covalent nucleotide modification, selected from: 5-formylcytosine (5-formyl-2'-deoxycytosine, 5fC, f5C); 5-hydroxy-2'-deoxycytosine (5-hydroxycytosine, 5hC, h5C); 5-carboxy-2'-deoxycytosine (5-carboxycytosine, 5-carboxycytosine, 5-carboxycytosine). 5-Prolylamino-2'-deoxycytosine (5-Prolylaminocytosine); 5-Hydroxymethyl-2'-deoxycytosine (5-Hydroxymethylcytosine, 5hmC, hm5C); Glucosyl-5-hydroxymethyl-2'-deoxycytosine (Glucosyl-5-hydroxymethylcytosine); 5-Methyl-2'-deoxycytosine (5-Methylcytosine, 5mC, m5C); Phosphothiophosphate; or S and R phosphate thiophosphate linkages. In some embodiments, the nucleotide modification is a base modification. In some embodiments, the nucleotide modification is a backbone modification. In some embodiments, the nucleotide modification is a sugar modification. In some embodiments, the nucleotide modification comprises a peptide conjugate. In some embodiments, the nucleotide modification comprises a protein conjugate.

[0500] In this embodiment, the effector sequence is a DNA sequence encoding a therapeutic RNA (e.g., mRNA or regulatory RNA) operatively linked to a promoter. In this embodiment, the RNA may be, for example, mRNA, tRNA, lncRNA, miRNA, rRNA, snRNA, microRNA, siRNA, piRNA, snoRNA, snRNA, exRNA, scaRNA, Y RNA, or hnRNA.

[0501] In the embodiments, the effector sequence is a DNA sequence encoding a therapeutic peptide or polypeptide that is operatively linked to a promoter. Therapeutic peptides or polypeptides can be, for example, DNA-binding proteins; RNA-binding proteins; transport proteins; transcription factors; translation factors; ribosomal proteins; chromatin remodeling factors; epigenetic modifying factors; antigens; hormones; enzymes (e.g., nucleases, such as endonucleases, such as nuclease elements of the CRISPR system, such as Cas9, dCas9, Cas9 nickase, Cpf / Cas12a); CRISPR-linked enzymes, such as base editors or prime editors; mobile genetic element proteins (e.g., transposases, reverse transposases, recombinases, integrases); gene writer polypeptides; polymerases; methyltransferases; demethylases; acetyltransferases; deacetylases; kinases; phosphatases; ligases; deubiquitinases; proteases; integrases; recombinases; topoisomerases; gyrases; helicases; lysosomal acid hydrolases); antibodies (e.g., intact antibodies, fragments thereof, or nanobodies); signal transduction peptides; receptor ligands; receptors; clotting factors. Factors; coagulation factors; structural proteins; caspases; membrane proteins; mitochondrial proteins; nucleoproteins; or engineered binders such as centyrin, darpin, or adnectin. In the embodiments, the effector sequence is a DNA sequence encoding a reporter protein.

[0502] In embodiments, a dsDNA molecule may include multiple effector sequences. These multiple effector sequences may be of the same or different types. For example, a dsDNA molecule may include an effector sequence as structural DNA and a second effector sequence as a DNA sequence encoding a functional RNA or polypeptide. The multiple effector sequences may be the same or different sequences of the same type.

[0503] In the embodiments, the dsDNA molecules are not placed in a carrier; for example, they are formulated for naked application.

[0504] In the embodiments, dsDNA molecules are formulated together with a carrier, such as a lipid-based carrier, like LNP.

[0505] In the examples, dsDNA molecules were formulated together with pharmaceutical excipients.

[0506] In this embodiment, the dsDNA molecule was formulated for parenteral administration.

[0507] In the examples, the pharmaceutical composition was formulated for topical application.

[0508] In the embodiments, the pharmaceutical composition is substantially free of impurities or process byproducts selected from the group consisting of endotoxins, mononucleotides, chemically modified mononucleotides, DNA fragments or truncated segments, and proteins (e.g., enzymes, such as ligases, restriction enzymes). In some embodiments, the pharmaceutical composition is substantially free of circular DNA.

[0509] On the other hand, the present invention includes a method of delivering effectors to a subject, such as a subject in need. This method includes administering to the subject a composition described herein, such as any of the compositions described in the examples. In the examples, the subject has or has been diagnosed with a condition treatable with effectors.

[0510] On the other hand, the present invention includes a method for regulating (e.g., increasing or decreasing) biological parameters in cells, tissues, or a subject. This method includes administering to a subject a composition described herein, such as any of the compositions described in the examples above. In the examples, the biological parameter is an increase or decrease in gene expression of a subject gene in target cells, tissues, or the subject, which is achieved through an effector sequence described herein. In the examples, the subject has or has been diagnosed with a condition treatable with the effector.

[0511] On the other hand, the present invention includes methods for treating cells, tissues, or subjects. These methods include administering, to cells, tissues, or subjects in need, the dsDNA molecules or constructs described herein, such as those described in any of the foregoing embodiments. In the embodiments, the subject has or has been diagnosed with a condition treatable with effectors.

[0512] This disclosure also provides a method for preparing the dsDNA molecules described herein. In an example, the method includes performing golden gate assembly.

[0513] In an embodiment, the method further includes enriching or purifying dsDNA molecules.

[0514] In the embodiments, enrichment or purification includes substantially removing from dsDNA molecules one or more impurities selected from: endotoxins, mononucleotides, chemically modified mononucleotides, single-stranded DNA, DNA fragments or truncations, and proteins (e.g., enzymes, such as ligases, restriction enzymes).

[0515] In an embodiment, the method further includes formulating enriched or purified dsDNA molecules for pharmaceutical use, for example, by formulating dsDNA molecules with pharmaceutically acceptable excipients and / or with a carrier such as LNP.

[0516] definition

[0517] As used herein, the term "alkyl" refers to a branched or straight-chain saturated hydrocarbon chain having 1 to 20 carbon atoms, or 1 to 15 carbon atoms, or 1 to 10 carbon atoms, or 1 to 7 carbon atoms, or 1 to 5 carbon atoms, or 1 to 3 carbon atoms. In some embodiments, the alkyl group is a methyl group. The alkyl chain may be cyclic, in which case it is referred to as a "cycloalkyl" group.

[0518] As used herein, the term "amplifier region" refers to a specific, contiguous region of a DNA or RNA molecule. In some embodiments, the amplicon region can be used as a template for PCR using a first PCR primer and a second PCR primer located flanking the amplicon region. For clarity, in this case, the region of the PCR template to which the first and second PCR primers bind is not included in the amplicon region. The length of an amplicon is typically given in base pairs, but the amplicon region can be found in single-stranded or double-stranded nucleic acid molecules. Thus, an amplicon region of 200 base pairs in length can be used to refer to a double-stranded region of 200 base pairs or a single-stranded region of 200 nucleotides.

[0519] As used herein, the term "antibody" refers to a molecule that specifically binds to or responds to an immune response to a particular antigen and includes at least a variable domain of the heavy chain, and typically includes at least variable domains of both the heavy and light chains of an immunoglobulin. Antibodies and their antigen-binding fragments, variants, or derivatives include, but are not limited to, polyclonal antibodies, monoclonal antibodies, multispecific antibodies, human antibodies, humanized antibodies, primate-derived antibodies or chimeric antibodies, heteroconjugated antibodies (e.g., bispecific, trispecific, and tetraspecific antibodies, biantibodies, triantibodies, and tetraantibodies), single-domain antibodies (sdAbs), epitope-binding fragments (e.g., Fab, Fab', and F(ab')2, Fd, Fv, single-chain Fv (scFv), rIgG, single-chain antibodies, disulfide-linked Fv (sdFv), nanobodies, fragments including VL or VH domains, and fragments expressed by Fab. This includes fragments generated from the library and anti-idiotype (anti-Id) antibodies. The antibodies described herein can be any type (e.g., IgG, IgE, IgM, IgD, IgA, and IgY), class (e.g., IgG1, IgG2, IgG3, IgG4, IgA1, and IgA2), or subclass of immunoglobulin molecules. Furthermore, unless otherwise stated, the term "clonal antibody" (mAb) is intended to include both the complete molecule and antibody fragments capable of specifically binding to target proteins (e.g., Fab and F(ab')2 fragments). Fab and F(ab')2 fragments lack the Fc fragment of the complete antibody.

[0520] As used herein, the term "carrier" means a compound, composition, reagent, or molecule that facilitates or promotes the transport or delivery of a composition (e.g., the TDSC or dsDNA molecule described herein) into a cell. For example, a carrier can be a partial or complete encapsulating agent.

[0521] As used herein, the term "chemically modified nucleotide," as used herein with respect to DNA, refers to a nucleotide that contains one or more structural differences relative to a canonical deoxyribonucleotide (i.e., G, T, C, and A). A chemically modified nucleotide may have (relative to a canonical nucleotide) chemically modified nucleobases, chemically modified sugars, chemically modified phosphodiester bonds, or combinations thereof. No specific preparation process is implied; for example, chemically modified nucleotides can be produced directly by chemical synthesis or by covalently modifying a canonical nucleotide.

[0522] As used herein, the term "chemically modified cytosine nucleotide," as used herein with respect to DNA, refers to a chemically modified nucleotide in which the nucleobase comprises a monocyclic 6-membered ring, wherein carbon 4 is covalently bonded to a nitrogen atom that is not one of the six members of the ring, and wherein the nucleobase of the chemically modified cytosine nucleotide contains one or more structural differences relative to the canonical cytosine nucleobase. In some embodiments, the C-5 position of the nucleobase may have a substitution other than H. For example, the C-5 position of the nucleobase may have the following substitutions: -OH; -aldehyde; -carboxylic acid; -alkyl; -(CH2). m OR3, m = 1-3 and R3 = H or a sugar molecule; or -propynylamino. In some embodiments, the chemically modified cytosine nucleotide further comprises chemical modifications on the sugar or phosphodiester bond. No specific preparation process is implied.

[0523] As used herein, the term "closed end" refers to a portion of a DNA molecule located at one end of a double-stranded region, wherein all nucleotides within that portion of the DNA molecule are covalently attached to adjacent nucleotides on either side. In some embodiments, the closed end may include a loop containing one or more nucleotides that do not hybridize with another nucleotide. In some embodiments, each nucleotide of the closed end hybridizes with another nucleotide. In some embodiments, a dsDNA molecule (e.g., TDSC) includes a first closed end (e.g., upstream of a heterologous target sequence) and a second closed end (e.g., downstream of a heterologous target sequence).

[0524] As used herein, the term "open end" refers to a portion of a DNA molecule located at one end of a double-stranded region, wherein at least one nucleotide ("terminal nucleotide") is covalently attached to only one other nucleotide. In some embodiments, the terminal nucleotide comprises a free 5' phosphate. In some embodiments, the terminal nucleotide comprises a free 3' OH. In some embodiments, in a dsDNA molecule comprising a first DNA strand and a second DNA strand, the open end comprises a first terminal nucleotide on the first DNA strand and a second terminal nucleotide on the second DNA strand. In some embodiments, the dsDNA molecule comprises a first open end (e.g., upstream of a heterologous target sequence) and a second open end (e.g., downstream of a heterologous target sequence). In some embodiments, the open end comprises a blunt end, a sticky end, or a Y-adaptor.

[0525] As used herein, the term "desired DNA sequence" refers to the DNA sequence that the user wants to generate. In some embodiments, the desired DNA sequence is the sequence of an amplicon region in a PCR template. It will be clear from the context that in some embodiments (e.g., when all dsDNA molecules in a subpopulation have the same DNA sequence as the desired DNA sequence), the DNA molecule has the desired DNA sequence along its entire length. In other embodiments, the DNA molecule may have the desired DNA sequence in a designated region of the DNA molecule (e.g., an amplicon region) and one or more errors outside that region.

[0526] As used herein, the term "desired RNA sequence" refers to the RNA sequence that the user wants to generate. In some embodiments, the desired RNA sequence is a sequence generated by error-free transcription of a desired DNA sequence. As will be clear from the context, in some embodiments, the RNA molecule has the desired RNA sequence along its entire length, while in other embodiments, the RNA molecule may have the desired RNA sequence in a designated region of the RNA molecule (e.g., an amplicon region) and have one or more errors outside that region.

[0527] As used herein, the term "DNA" refers to any compound and / or substance comprising at least two (e.g., at least 10, at least 20, at least 50, at least 100) covalently linked deoxyribonucleotides. In some embodiments, DNA is a single oligonucleotide chain, while in other embodiments, DNA comprises multiple oligonucleotide chains, and in still other embodiments, DNA is a portion of an oligonucleotide chain. In some embodiments, DNA is a compound and / or substance incorporated into or potentially incorporated into oligonucleotide chains via phosphodiester bonds. In some embodiments, DNA comprises only canonical nucleotides. In some embodiments, DNA comprises one or more chemically modified nucleotides. In some embodiments, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% of the sugars in DNA are deoxyribose. In some embodiments, DNA is prepared by one or more of the following methods: isolation from natural sources, enzymatic synthesis (in vivo or in vitro) via polymerization based on complementary templates, replication in recombinant cells or systems, and chemical synthesis.

[0528] As used herein, the term "DNA end form" refers to a structure comprising DNA located at the end of a dsDNA molecule (e.g., TDSC). In some embodiments, the DNA end form comprises a closed end. In other embodiments, the DNA end form comprises an open end. In some embodiments, the DNA end form comprises a hairpin, loop, Y-adaptor, blunt end, or sticky end. The DNA end form may comprise one or both of a single-stranded and a double-stranded region. The DNA end form may comprise a canonical nucleotide, a chemically modified nucleotide, or a combination thereof. In some embodiments, the DNA end form comprises 3-100 nucleotides. In some embodiments, the dsDNA molecule comprises a first DNA end form at a first end and a second DNA end form at a second end. In some embodiments, the first and second DNA end forms of the dsDNA molecule are of the same type. In some embodiments, the first and second DNA end forms of the dsDNA molecule are of different types.

[0529] As used herein, with respect to nucleic acid sequences, the term "error" refers to a difference in the nucleotide sequence of a nucleic acid sequence relative to the expected RNA or DNA sequence. In some embodiments, an error is a substitution, insertion, or deletion. In some embodiments, an error can be introduced by PCR. In some embodiments, an error can be introduced by a polymerase (e.g., DNA polymerase or RNA polymerase). For the avoidance of ambiguity, replacing canonical cytosine with a chemically modified cytosine nucleotide is not considered an error.

[0530] As used herein, the term “exonuclease resistance” when used to describe DNA means that the DNA is resistant to the exonuclease assay described in Example 2 if it contains closed ends, and resistant to the exonuclease assay described in Example 3 if it contains open ends (e.g., two open ends).

[0531] As used herein, when referring to a second element to describe a first element, the term "heterogeneous" means that the first and second elements do not exist in nature in the arrangement described. For example, a heterologous polypeptide, nucleic acid molecule, construct, or sequence refers to (a) a polypeptide, nucleic acid molecule, or part of a polypeptide or nucleic acid molecule sequence that is not native to the cell expressing it, (b) a polypeptide or nucleic acid molecule, or part of a polypeptide or nucleic acid molecule, that has been altered or mutated relative to its native state, or (c) a polypeptide or nucleic acid molecule having altered expression compared to its native expression level under similar conditions. For example, heterologous regulatory sequences (e.g., promoters, enhancers) can be used to regulate the expression of a gene or nucleic acid molecule in a manner different from how the gene or nucleic acid molecule is normally expressed in nature. In another instance, a heterologous domain of a polypeptide or nucleic acid sequence (e.g., the DNA-binding domain of the polypeptide or a nucleic acid encoding the DNA-binding domain of the polypeptide) may be arranged relative to other domains, or may be a different sequence or may originate from a different source relative to other domains or portions of the polypeptide or its encoding nucleic acid. In certain embodiments, the heterologous nucleic acid molecule may be present in the native host cell genome, but may have an altered expression level or a different sequence, or both. In other embodiments, the heterologous nucleic acid molecule may not be endogenous to the host cell or host genome, but may be introduced into the host cell by transformation (e.g., transfection, electroporation), wherein the added molecule may be integrated into the host genome, or may exist transiently (e.g., mRNA) or semi-stably for more than one generation (e.g., episomal viral vectors, plasmids, or other self-replicating vectors) as extrachromosomal genetic material.

[0532] As used herein, the term "heterologous functional sequence" refers to a nucleic acid sequence that is heterologous to an adjacent (e.g., directly adjacent) nucleic acid sequence and has one or more biological functions. In some embodiments, the biological function includes targeting organelles, such as nuclear targeting. In some embodiments, the heterologous functional sequence comprises a nuclear targeting sequence or a regulatory sequence.

[0533] As used herein, the terms “increase” and “decrease” refer to the amount by which the function, expression, or activity of the respective indicator is adjusted to be greater or less than that of a reference. For example, following administration of a dsDNA molecule as described herein, the amount measured herein (e.g., the level of gene expression or a marker of innate immunity) may be increased or decreased in subjects by at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 98% or more, relative to the amount of the marker before administration, or relative to the administration of a control dsDNA molecule, which is, for example, a dsDNA molecule containing chemically modified nucleotides compared to a control dsDNA molecule containing only unmodified nucleotides. Typically, the indicator is measured post-administration at the time when the effect has been achieved, such as at least one day, one week, one month, three months, or six months after the start of a treatment regimen.

[0534] As used herein, the term "linear" in dsDNA molecules (such as TDSC) refers to a nucleic acid comprising two DNA strands or portions thereof that hybridize with each other (thus forming a double-stranded region), wherein the structure includes two ends. The ends may be closed ends or open ends. The two strands that hybridize with each other may be partially or completely complementary. In some embodiments, the linear dsDNA molecule consists of a single strand of DNA that is circular under denaturing conditions, wherein under physiological conditions, a first portion of this strand hybridizes with a second portion of the strand (thus forming a double-stranded region), and the linear dsDNA molecule comprises a first closed end containing a first loop and a second closed end containing a second loop.

[0535] As used in this article, the term "loop" refers to a single-stranded nucleic acid sequence. The two ends of the loop are connected by a double-stranded region called the "stem," forming a "stem-loop."

[0536] As used herein, the term "maintenance sequence" is a DNA sequence or motif that enables or facilitates the retention of DNA molecules in the cell nucleus through cell division. Maintenance sequences typically enable DNA replication and / or transcription in the cell nucleus by interacting with proteins that promote chromatin circularization. An example of a maintenance sequence is a scaffold / matrix attachment region (S / MAR element).

[0537] As used in this article, a “nuclear-targeting sequence” is a DNA sequence that enables or facilitates the entry of DNA into the nucleus of a target cell.

[0538] As used herein, "pharmaceutical composition" or "pharmaceutical formulation" means a composition or formulation intended for use in animals (e.g., humans) or veterinary medicine, such as for preventive or therapeutic purposes in non-human animals or humans. A pharmaceutical formulation comprises an active agent, in combination with pharmaceutically acceptable excipients or diluents, that has a biological effect on the cells or tissues of a subject (e.g., has pharmacological activity or an effect of alleviating, treating, or preventing disease). A pharmaceutical composition also refers to a finished dosage form or formulation of a preventive or therapeutic composition.

[0539] As used herein, the terms “peptide,” “polypeptide,” and “protein” are used interchangeably and refer to compounds comprising amino acid residues covalently linked by peptide bonds or other means. A protein or peptide must contain at least two amino acids, and there is no limit to the maximum number of amino acids that can comprise a protein or peptide sequence. A polypeptide includes any peptide or protein comprising two or more amino acids linked together by peptide bonds or other means. As used herein, the term refers to both short chains and long chains, the short chains being commonly referred to in the art, for example, as peptides, oligopeptides, and oligomers, and the long chains being commonly referred to in the art, as proteins, which come in many types. In some embodiments, polypeptides comprise non-canonical amino acid residues.

[0540] As used in this article, the term "propynylamino" refers to the functional group of -C≡CCH2NH2.

[0541] As used herein, the term "protein telomerase sequence" refers to a nucleotide sequence capable of being produced by a protein telomerase that links a first protein telomerase recognition sequence (PRS) to a second PRS. In some embodiments, the protein telomerase sequence is produced by a method involving protein telomerase, and in other embodiments, the protein telomerase sequence is produced by a method not involving protein telomerase (e.g., by solid-phase synthesis).

[0542] As used herein, the “sense strand” of dsDNA is a strand that has the same sequence as the mRNA or pre-mRNA encoding a functional protein and is not used as a transcription template. The “antisense strand” of dsDNA is a strand that has a sequence complementary to the mRNA or pre-mRNA encoding a functional protein and / or can be used as a transcription template.

[0543] As used herein, the term "double-stranded DNA molecule" or dsDNA molecule refers to a DNA composition comprising two complementary deoxyribonucleotide chains that are base-paired with each other. The two complementary strands may be perfectly complementary or may have one or more mismatches, such as forming protrusions. In some embodiments, either of the two strands may have paired self-complementary regions that fold into intramolecular / intrastrand double-stranded motifs, such as hairpin loops, junctions, protrusions, or inner loops. In some embodiments, the dsDNA molecule is circular or linear. In some embodiments, the dsDNA molecule contains one or two closed ends. In some embodiments (e.g., in a dsDNA molecule with closed ends), the two complementary strands of the deoxyribonucleotides are covalently linked. In some embodiments, the dsDNA molecule is a TDSC.

[0544] As used herein, the term "therapeutic double-stranded construct" ("TDSC") refers to a linear construct containing DNA, wherein the construct is at least partially double-stranded. TDSCs do not contain a plasmid backbone sequence (e.g., do not contain a bacterial origin of replication). TDSCs do not contain a viral capsid or viral envelope. In some embodiments, TDSCs contain closed or open ends (e.g., blunt or sticky ends). In some embodiments, TDSCs are suitable for administration to human subjects.

[0545] As used herein, the term "terminal nucleotide" refers to a nucleotide that is covalently attached to only one other nucleotide. In some embodiments, the terminal nucleotide comprises a free 5' phosphate. In some embodiments, the terminal nucleotide comprises a free 3' OH group.

[0546] As used herein, “treatment” refers to the medical management of a subject aimed at improving, alleviating, stabilizing (i.e., preventing deterioration), preventing, or curing a disease, pathological condition, or disorder. This term includes active treatment (treatment aimed at improving a disease, pathological condition, or disorder), etiological treatment (treatment addressing the cause of the related disease, pathological condition, or disorder), palliative treatment (treatment aimed at relieving symptoms), preventive treatment (treatment aimed at minimizing or partially or completely suppressing the development of the related disease, pathological condition, or disorder), and supportive treatment (treatment used to complement another therapy). Treatment also includes reducing the severity of a disease or symptom; preventing the spread of a disease or symptom; delaying or slowing the progression of a disease or symptom; improving or alleviating a disease or symptom; and remission (whether partial or complete), whether detectable or undetectable. Improving or alleviating a disease or symptom means a reduction in the severity and / or duration of adverse clinical manifestations of the disease, disorder, or symptom compared to the severity or duration without treatment. “Treatment” can also mean prolonged survival compared to expected survival without treatment. Those who need treatment include those who already have a condition or disability, those who are susceptible to a condition or disability, or those for whom prevention of a condition or disability is necessary.

[0547] As used herein, the term "Y-adaptor" refers to a nucleic acid structure comprising a first and second nucleic acid region that are complementary to each other (e.g., completely complementary); the first and second regions can hybridize to form a double-stranded region. The first nucleic acid region is covalently linked to a third nucleic acid region, and the second nucleic acid region is covalently linked to a fourth nucleic acid region, and the third and fourth nucleic acid regions are substantially non-complementary to each other; the third and fourth regions can be single-stranded. The first nucleic acid region is at the 3' end of the third nucleic acid region and the second nucleic acid region is at the 5' end of the fourth nucleic acid region. As a result, the third and fourth regions can be located on the same side of the double-stranded region. The Y-adaptor can be part of a dsDNA molecule. Attached Figure Description

[0548] Figure 1A-1BA series of figures illustrates exemplary covalently closed DNA end forms that can be included in dsDNA molecules (e.g., therapeutic double-stranded constructs (TDSCs), as described herein (e.g., at one or both ends of the dsDNA molecule)). (A) shows an exemplary dsDNA molecule, such as a TDSC, that does not contain loop ends (e.g., protein telomerase sequences), inverted terminal repeat sequences (ITRs), or terminal hairpins, and may consist of unmodified nucleotides (white symbols) or may contain chemically modified nucleotides (grey symbols). Chemically modified nucleotides may include, for example, nucleotides modified in the backbone, sugar, or bases, or nucleotides conjugated to peptides or proteins. In some cases, both DNA strands are unmodified. In some cases, both DNA strands are chemically modified. In some cases, the antisense strand is chemically modified. In some cases, the sense strand is chemically modified. Solid boxes indicate dsDNA molecules with hairpin-coated ends, such as linearly covalently closed dsDNA molecules having end forms containing phosphate thioester modifications. The dashed box represents a covalently closed dsDNA molecule without a circular end, such as a linearly covalently closed dsDNA molecule with a TelN-terminus.

[0549] Figure 2 A series of diagrams illustrate double-stranded DNA constructs, including exemplary dsDNA molecules such as TDSC, which contain exemplary DNA end forms that are not covalently closed (e.g., at one or both ends). Such exemplary dsDNA molecules, such as TDSC, may contain Y-termini (e.g., Y-adaptors, as described herein). In some cases, the DNA end forms may consist of unmodified nucleotides (white symbols). In some cases, the DNA end forms contain chemically modified nucleotides (grey symbols). Chemically modified nucleotides may include, for example, nucleotides modified in the backbone, sugar, or bases, or nucleotides conjugated to peptides or proteins. In some cases, neither DNA strand is modified. In some cases, both DNA strands are chemically modified. In some cases, the antisense strand is chemically modified. In some cases, the sense strand is chemically modified. Exemplary DNA constructs lacking DNA end forms or chemical modifications (i.e., unmodified double-stranded DNA molecules) are also shown in the upper right corner.

[0550] Figure 3A and 3B The following gel electrophoresis images depict PCR products from reactions using unmodified dCTP (indicated as "0%"), or when 5-formyl-dCTP was added to the PCR mixture at a ratio of 1:3 to unmodified dCTP (indicated as "25%"). Deep Vent polymerase was used. Figure 3A ) or KOD Xtreme polymerase ( Figure 3BPerform PCR. The arrow indicates the desired product.

[0551] Figure 4 The figure depicts the generation of covalently blocked linear dsDNA molecules with end forms containing thiophosphate modifications. Figure 4 SEQ ID NOs 86-87 are disclosed in the order of their appearance.

[0552] Figure 5 The figure depicts the generation of covalently blocked linear dsDNA molecules with TelN-terminal forms. Figure 5 SEQ ID NOs 88-89, 58, and 57 are disclosed in the order of their appearance.

[0553] Figure 6 The figure depicts circular dsDNA molecules with or without chemical modifications.

[0554] Figure 7 The figure illustrates an exemplary method for generating circular dsDNA molecules. Linear dsDNA molecules can be contacted with a restriction enzyme (e.g., KpnI) to produce compatible sticky ends, which can then be joined together to generate circular dsDNA. Figure 7 SEQ ID NOs 90, 92, 91 and 93 are disclosed in the order of their appearance.

[0555] Figure 8 These are gel electrophoresis images of chemically modified DNA molecules (including modifications at the C-5 position of cytosine). Lane 1 shows unmodified control dsDNA molecules. Lane 2 shows dsDNA molecules produced in the reaction using 25% 5-formyl-dCTP. Lane 3 shows dsDNA molecules produced in the reaction using 50% 5-hydroxy-dCTP.

[0556] Figure 9 The fragment trace of circular dsDNA generated in the reaction using 25% 5-formyl-dCTP is shown.

[0557] Figure 10 The fragment analyzer trace of a linear covalently blocked dsDNA molecule with thiophosphate-modified ends, generated in a reaction using 25% 5-formyl-dCTP, is shown.

[0558] Figure 11 Fragment analyzer traces of linear covalently blocked dsDNA molecules with TelN ends, generated in a reaction using 25% 5-formyl-dCTP, are shown.

[0559] Figure 12The fragment analyzer trace of a linear covalently blocked dsDNA molecule with thiophosphate-modified ends, produced in a reaction using 50% 5-hydroxy-dCTP, is shown.

[0560] Figure 13 The figure shows the proportion of HepG2, HEKa, or U937 cells expressing mCherry after lipid transfection with a circular dsDNA construct containing 5-formylcytosine-modified dsDNA generated in a reaction using 25% 5-formyl-dCTP, relative to cells transfected with unmodified dsDNA lipids.

[0561] Figures 14A-14C A series of figures show the relative mRNA levels of IFNβ, CXCL10, and IL6 in HEKa cells after lipid transfection with either 5-formylcytosine-modified circular dsDNA molecules or unmodified dsDNA molecules produced in a reaction using 25% 5-formyl-dCTP. The figures show the fold change in mRNA levels at all time points (6 h, 24 h, and 72 h post-transfection) relative to the method control (i.e., transfection without DNA).

[0562] Figures 15A-15C A series of figures show the mRNA levels of IFNβ, CXCL10, and IL6 in U937 cells after transfection with circular dsDNA molecules containing 5-formylcytosine-modified dsDNA molecules or unmodified dsDNA molecules produced in a reaction using 25% 5-formyl-dCTP. Dashed horizontal lines represent the method control (i.e., transfection without DNA). The fold change in mRNA levels relative to the method control is shown at all time points (6 h, 24 h, and 72 h post-transfection).

[0563] Figure 16 The scatter plot shows the innate immune response of HEKa cells to linear dsDNA molecules containing thiophosphorylation and modifications including 5-hydroxycytosine (produced in a reaction using 50% 5-hydroxy-dCTP), 5-formylcytosine (produced in a reaction using 25% 5-formyl-dCTP), or others. The X-axis represents a reduction in interferon signaling, defined as a decrease in the mean fold change of the markers IFNB and CXCL10 relative to unmodified DNA. The Y-axis represents a reduction in inflammatory cytokine signaling, defined as a decrease in the mean fold change of the markers IL6 and TNFα relative to unmodified DNA. Dashed ellipses represent other dsDNA chemical modifications (n=42).

[0564] Figure 17The scatter plot shows the innate immune response of HEKa cells to linear dsDNA molecules containing the following: phosphorylated end-adaptor and specified modifications at the C-5 position of cytosine (i.e., 5-formylcytosine, 5-hydroxycytosine, glucosyl-5-hydroxymethylcytosine, 5-carboxycytosine, 5-propyneaminocytosine, 5-methylcytosine, or 5-hydroxymethylcytosine). The X-axis represents a reduction in interferon signaling, defined as a decrease in the mean fold change of the markers IFNB and CXCL10 relative to unmodified DNA. The Y-axis represents a reduction in inflammatory cytokine signaling, defined as a decrease in the mean fold change of the markers IL6 and TNFα relative to unmodified DNA. dsDNA molecules are produced in reactions designed to incorporate 25% 5-formylcytosine, 50% 5-hydroxycytosine, 50% glucosyl-5-hydroxymethylcytosine, 60% 5-carboxycytosine, 25% 5-propyneaminocytosine, 75% 5-methylcytosine, or 50% 5-hydroxymethylcytosine.

[0565] Figure 18 The scatter plot shows the innate immune response to linear dsDNA molecules with phosphorylated end adaptors and reporter gene expression of constructs containing 5-hydroxycytosine (produced in a reaction using 50% 5-hydroxy-dCTP), 5-formylcytosine (produced in a reaction using 25% 5-formyl-dCTP), or other chemical modifications. The X-axis represents a reduction in innate immune signaling, defined as a decrease in the mean fold change of the markers IFNB, CXCL10, IL6, and TNFα relative to unmodified dsDNA molecules. The Y-axis represents relative reporter gene expression, defined as the proportion of mCherry+ cells relative to unmodified control DNA. Dashed ellipses represent other dsDNA chemical modifications (n=38).

[0566] Figure 19 The pair of graphs shows the function (here, the ability to produce a protein, in this case mCherry) of the semi-modified dsDNA generated in a reaction using 100% 5-hydroxycytosine (5hC100), measured above the background total fluorescence (left subplot) or %mCherry+ cells (right subplot).

[0567] Figure 20 The pair of figures shows the immunohistochemical signatures of semi-modified dsDNA generated in a reaction using 100% 5-hydroxycytosine (5hC100) based on either IL6 level (left subplot) or CXCL10 level (right subplot). Figure 19 and 20 In the text, P6 unmodified indicates a closed-terminal dsDNA containing thiophosphate but lacking modified nucleobases. Detailed Implementation

[0568] This disclosure relates to compositions and methods for delivering effectors (e.g., therapeutic effectors) to cells, tissues, or subjects (e.g., in vivo or in vitro). Effectors may be DNA sequences, peptides such as therapeutic proteins, or RNA, such as regulatory RNA or mRNA.

[0569] Chemically modified nucleotides

[0570] The dsDNA molecules described herein may contain chemically modified nucleotides, such as chemically modified cytosine nucleotides. Not wishing to be bound by theory, in some embodiments, the chemically modified cytosine nucleotides described herein increase the "stealth" of the dsDNA molecule in response to an immune response while simultaneously supporting gene expression on the dsDNA molecule. Exemplary chemically modified cytosine nucleotides are provided below.

[0571] The nucleobases containing 5-formylcytosine are shown in Formula II below.

[0572]

[0573] The nucleobases containing 5-hydroxycytosine are shown in Formula III below.

[0574]

[0575] The nucleobases containing 5-carboxycytosine are shown in Formula IV below.

[0576]

[0577] The nucleobases containing 5-propynylaminocytosine are shown in formula V below.

[0578]

[0579] The nucleobases containing 5-methylcytosine are shown in Formula VI below.

[0580]

[0581] The nucleobases containing 5-hydroxymethylcytosine are shown in formula VII below.

[0582]

[0584] The nucleobases containing glucosyl-5-hydroxymethylcytosine are shown in Formula VIII below.

[0585]

[0586] The dsDNA molecule (e.g., TDSC) compositions described herein may have chemical modifications to the nucleobases, sugars, and / or phosphate backbone (e.g., such as...). Figure 1A-2 (As shown in the diagram). While not wishing to be bound by theory, such modifications can be used to protect DNA from degradation (e.g., from exonuclease degradation) or from degradation by the host tissue or the subject's immune system. Generally, chemically modified nucleotides have the same base-pairing specificity as unmodified nucleotides; for example, a chemically modified adenine "A" can pair with a thymine "T" base. In some embodiments, a chemical modification (e.g., one or more modifications) is present in each sugar-nucleoside link.

[0587] In some embodiments, the dsDNA molecule (e.g., TDSC) contains at least one chemical modification. Examples of chemical modifications of DNA that can be used in the methods described herein include, for example, 5-formylcytosine (5-formyl-2'-deoxycytosine, 5fC, f5C); 5-hydroxy-2'-deoxycytosine (5-hydroxycytosine, 5hC, h5C); 5-carboxy-2'-deoxycytosine (5-carboxycytosine, 5-carboxycytosine). ca5C, 5caC); 5-propynylamino-2'-deoxycytosine (5-propynylaminocytosine); 5-hydroxymethyl-2'-deoxycytosine (5-hydroxymethylcytosine, 5hmC, hm5C); glucosyl-5-hydroxymethyl-2'-deoxycytosine (glucosyl-5-hydroxymethylcytosine); 5-methyl-2'-deoxycytosine (5-methylcytosine, 5mC, m5C); thiophosphate; or S and R thiophosphate bonds. For example, see Pu et al. 2020. An in-vitro DNA phosphorothioate modification reaction. Mol Microbiol. 113:452–463; Zheng & Sheng. 2021.

[0588] In some embodiments, the dsDNA molecules described herein may comprise phosphate-thioester-modified nucleotides. In some embodiments, the DNA terminal forms described herein (e.g., exonuclease-resistant DNA terminal forms) may comprise phosphate-thioester-modified nucleotides. In some embodiments, the dsDNA molecules described herein may comprise S and R phosphate-thioester-modified nucleotide linkages. In one embodiment, the phosphate-thioester linkages are generated according to Iwamoto et al., 2017, Nature Biotechnology, Vol. 35: 845-851. Briefly, stereocontrolled phosphate-thioester linkages are generated from monomers of nucleoside 3'-oxazolphosphane derivatives via stereocontrolled oligonucleotide synthesis through iterative capping and sulfidation. The stereochemistry of the modification is determined by analysis of the final sample by reversed-phase high-performance liquid chromatography (RP-HPLC) and ultra-high-performance liquid chromatography-mass spectrometry (UPLC / MS). Nucleic acids containing phosphate-thioester linkages are also commercially available.

[0589] In some embodiments, the dsDNA molecules described herein may include 5-methylcytosine-modified nucleotides, for example, prepared according to the method described in Lin et al., 2002, Mol Cell Biol [Molecular and Cell Biology], Vol. 22, No. 3: 704-723. Briefly, cytosine or a cytosine-containing sequence is incubated with a glutathione S-transferase fusion of wild-type Dnmt3a (GST-3a) protein using unlabeled S-adenosylmethionine (AdoMet). The nucleotides are purified and analyzed by HPLC to determine that the nucleotides are methylated at the correct positions. 5-methylcytosine-modified nucleotides are also commercially available.

[0590] In some embodiments, the dsDNA molecule described herein contains carboxyl or formyl modifications.

[0591] In the embodiments, the dsDNA molecule described herein or one strand of the dsDNA molecule (e.g., sense strand or antisense strand) comprises between 1% and 100% of chemically modified nucleotides, between 1% and 90% of chemically modified nucleotides, between 1% and 80% of chemically modified nucleotides, between 1% and 70% of chemically modified nucleotides, between 1% and 60% of chemically modified nucleotides, between 1% and 50% of chemically modified nucleotides, between 1% and 40% of chemically modified nucleotides, between 1% and 30% of chemically modified nucleotides, between 1% and 20% of chemically modified nucleotides, between 1% and 15% of chemically modified nucleotides, between 1% and 10% of chemically modified nucleotides, between 20% and 90% of chemically modified nucleotides, and between 20% and 80% of chemically modified nucleotides. In the embodiments, the dsDNA molecule described herein, or one strand of the dsDNA molecule (e.g., sense strand or antisense strand), comprises at least 1% chemically modified nucleotides; at least 5% chemically modified nucleotides; at least 10% chemically modified nucleotides; at least 15% chemically modified nucleotides; at least 20% chemically modified nucleotides; at least 25% chemically modified nucleotides; at least 30% chemically modified nucleotides; at least 40% chemically modified nucleotides; at least 50% chemically modified nucleotides; at least 60% chemically modified nucleotides; at least 70% chemically modified nucleotides; at least 80% chemically modified nucleotides; at least 85% chemically modified nucleotides; at least 90% chemically modified nucleotides; at least 92% chemically modified nucleotides; at least 95% chemically modified nucleotides; and at least 97% chemically modified nucleotides. In the embodiments, the dsDNA molecule described herein or one strand of the dsDNA molecule (e.g., sense strand or antisense strand) contains chemically modified nucleotides of cytosine in the ranges of 0-100%, 10%-100%, 20%-100%, 30%-100%, 40%-100%, 50%-100%, 60%-100%, and 10%-50%.

[0592] In the embodiments, chemically modified nucleotides, such as those described herein, may be introduced into the entire sequence of the dsDNA molecule described herein; within elements of the sequence, such as those described herein; at the 5'- or 3'-end; and / or between the last 10, 8, 6, 5, 4, 3, or 2 nucleotides at the 5'- or 3'-end.

[0593] In some embodiments, the dsDNA molecule described herein contains only one chemically modified nucleotide on one strand (e.g., as shown in the image). Figure 1A(as shown in the diagram). In some embodiments, the dsDNA molecule described herein comprises chemically modified nucleotides on the antisense strand. In some embodiments, the dsDNA molecule described herein comprises chemically modified nucleotides on the sense strand.

[0594] In some embodiments, the dsDNA molecule described herein contains chemically modified nucleotides (e.g., as shown in the image) on both strands. Figure 1A and 2 (As shown in the diagram). In some embodiments, the two strands contain chemical modifications at the same positions (e.g., a chemically modified nucleotide on one strand pairs with a chemically modified nucleotide base on the opposite strand, and / or an unmodified nucleotide base on one strand pairs with an unmodified nucleotide base on the opposite strand). In embodiments, both strands are composed entirely of chemically modified nucleotides. In other embodiments, the two strands of the dsDNA molecule described herein contain different chemical modification patterns (e.g., one or more chemically modified nucleotides on one strand pair with unmodified nucleotide bases on the other strand). In embodiments, the dsDNA molecule described herein includes one or more double-stranded regions in which both strands are chemically modified, and / or one or more double-stranded regions in which neither strand is chemically modified. In embodiments, the dsDNA molecule described herein includes one or more double-stranded regions in which one strand is chemically modified and the other strand is not chemically modified.

[0595] In embodiments, the dsDNA molecules described herein comprise one or more DNA end forms (e.g., exonuclease-resistant DNA end forms, e.g., covalently blocked DNA end forms or non-covalently blocked DNA end forms, e.g., as described herein), wherein each comprises one or more chemically modified nucleotides (e.g., on one or both strands of the DNA end form). In embodiments, the dsDNA molecule comprises a double-stranded region flanked by a non-covalently blocked exonuclease-resistant DNA end form containing chemically modified nucleotides, e.g., as described herein (e.g., Figure 2 ).

[0596] In the embodiments, the dsDNA molecules described herein have one or more chemical modifications that disrupt the ability of a portion of the dsDNA molecule to form a double-stranded structure. For example, the dsDNA molecules described herein have one or more chemical modifications on nucleotides present in regions with intramolecular complementarity. In the embodiments, the dsDNA molecules described herein have one or more chemical modifications that disrupt base pairing in intramolecular complementary regions relative to the unmodified sequence of the dsDNA molecule. In some embodiments, the chemically modified nucleotides used herein have a reduced tendency to pair with other chemically modified nucleotides compared to the tendency of unmodified nucleotides to pair with other unmodified nucleotides. In some embodiments, the chemically modified nucleotides used herein have an increased tendency to pair with other unmodified nucleotides compared to modified nucleotides.

[0597] In some embodiments, the chemically modified dsDNA molecules described herein exhibit reduced recognition by DNA sensors in host tissues or subjects compared to unmodified dsDNA molecules of the same sequence, for example, a reduction of at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or more in recognition by DNA sensors in host tissues or subjects compared to unmodified dsDNA molecules of the same sequence. In some embodiments, the chemically modified dsDNA molecules described herein exhibit reduced recognition by DNA sensors in host tissues or subjects compared to unmodified dsDNA molecules of the same sequence, for example, a reduction of 10%-20%, 20%-30%, 30%-40%, 40%-50%, 50%-60% / 60%-70%, 70%-80%, 80%-90%, or 90%-95% in recognition by DNA sensors in host tissues or subjects compared to unmodified dsDNA molecules of the same sequence. In some embodiments, the chemically modified dsDNA molecules described herein exhibit reduced degradation by DNA nucleases compared to unmodified dsDNA molecules of the same sequence, for example, a reduction of at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or more in degradation by DNA nucleases in host tissues or subjects compared to unmodified dsDNA molecules. In some embodiments, the chemically modified dsDNA molecules described herein exhibit reduced degradation by DNA nucleases compared to unmodified dsDNA molecules of the same sequence, for example, a 10%-20%, 20%-30%, 30%-40%, 40%-50%, 50%-60% / 60%-70%, 70%-80%, 80%-90%, or 90%-95% reduction in DNA nuclease degradation in host tissues or subjects compared to unmodified dsDNA molecules. In some embodiments, the chemically modified dsDNA molecules described herein exhibit reduced activation of the innate immune system in target / host tissues or subjects compared to unmodified dsDNA molecules of the same sequence, for example, a reduction of at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or more in activation of the innate immune system in target / host tissues or subjects compared to unmodified dsDNA molecules of the same sequence.In some embodiments, the chemically modified dsDNA molecules described herein exhibit reduced activation of the innate immune system in target / host tissues or subjects compared to unmodified dsDNA molecules of the same sequence, for example, a reduction of 10%-20%, 20%-30%, 30%-40%, 40%-50%, 50%-60% / 60%-70%, 70%-80%, 80%-90%, or 90%-95% in target / host tissues or subjects compared to unmodified dsDNA molecules of the same sequence.

[0598] In some embodiments, compared to dsDNA containing the chemically modified nucleotides described herein (unmodified dsDNA) of the same sequence, dsDNA molecules exhibit any of the following properties in target / host tissues or subjects: increased integration of the exogenous construct into the target cell genome; increased retention in target cells via replication; reduced formation of secondary or tertiary structures; reduced interaction with innate immune sensors; reduced interaction with nucleases; enhanced stability; prolonged lifespan; reduced toxicity; enhanced delivery; increased expression; increased transmembrane transport; increased binding to DNA-binding moieties (e.g., nuclear DNA-binding proteins, transcription factors, molecular chaperones, DNA polymerases). In embodiments, any of the properties listed above are modulated in target / host tissues or subjects by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or more.

[0599] Components of DNA constructs

[0600] The dsDNA molecules (e.g., TDSCs) or nucleic acids containing dsDNA described herein contain elements sufficient to deliver an effector sequence to target cells, tissues, or subjects. In some embodiments, the effector sequence is a DNA sequence. In some embodiments, the dsDNA molecule drives the expression of the effector, for example, by including a promoter and a sequence encoding RNA or a polypeptide (e.g., a therapeutic RNA or polypeptide). In some embodiments, the DNA constructs described herein further include one or both of the following: a nuclear targeting sequence and a maintenance sequence. While many of the embodiments described herein relate to TDSCs, it should be understood that, where applicable, the embodiments relating to TDSCs may also be applied to nucleic acids containing dsDNA.

[0601] Exonuclease-resistant DNA terminal forms

[0602] The TDSCs or nucleic acids containing dsDNA described herein comprise DNA end forms at each end of a double-stranded DNA molecule. In some cases, the DNA end forms described herein may comprise closed ends, wherein each nucleotide of the DNA end form is covalently attached to two other nucleotides of the DNA end form. In other cases, the DNA end forms described herein comprise open ends, which comprise at least one nucleotide covalently attached to only one other nucleotide of the DNA end form. DNA end forms are generally exonuclease resistant. In some cases, DNA end forms comprising closed ends (e.g., covalently closed ends) are resistant to the exonuclease assays described in Example 2. In some cases, DNA end forms comprising open ends (e.g., Y-adaptors, blunt ends, or sticky ends, as described herein) are resistant to the exonuclease assays described in Example 3.

[0603] hair clip

[0604] In some embodiments, the exonuclease-resistant DNA terminal form comprises a DNA hairpin. The hairpin typically comprises a single-stranded loop region covalently attached to the double-stranded stem region at both the 5' and 3' ends. In some embodiments, the single-stranded loop region comprises one or more nucleotides that have not hybridized to another nucleotide (e.g., 1-2, 2-5, 5-10, 10-15, 15-20, 20-25, 25-30, 30-35, or 35-40 nucleotides). Exemplary hairpin structures and exemplary dsDNA molecules comprising hairpins are shown in... Figure 1A middle.

[0605] In some embodiments, the single-stranded loop region comprises one or more functional elements (e.g., nuclear input sequences (e.g., CT3 ssDNA sequences) or regulatory sequences). In embodiments, the functional elements contained in the single-stranded loop region are heterologous to one or more other elements of a DNA-terminal form and / or a dsDNA molecule containing a DNA-terminal form. In some embodiments, the length of the single-stranded loop region of the hairpin loop is less than about 5, 10, 15, 20, 25, 26, 27, 28, 29, or 30 nucleotides.

[0606] In an embodiment, the hairpin is contained in a dsDNA molecule having a doggybone conformation. In an embodiment, the hairpin contains a protein telomerase sequence (e.g., as described herein). In an embodiment, the protein telomerase sequence is generated by digestion with TelN, ResT, Tel PY54, or TelK protein telomerase. In an embodiment, the length of the protein telomerase sequence is less than about 15, 20, 25, 26, 27, 28, 29, or 30 nucleotides. In an embodiment, the length of the protein telomerase sequence is between about 28 (e.g., 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, or 35) nucleotides and about 56 (e.g., 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, or 60) nucleotides. In the embodiments, the protein telomerase sequence is longer than about 56 (e.g., longer than 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 65, 70, 75, 80, 90 or 100) nucleotides.

[0607] Hairpins can be attached to one or both ends of a double-stranded DNA molecule, for example, by ligation (e.g., as described herein). In some embodiments, the dsDNA molecule described herein contains DNA hairpin loops at one or both ends. In some embodiments, the upstream exonuclease-resistant DNA end of the dsDNA molecule described herein contains a DNA hairpin loop. In some embodiments, the downstream exonuclease-resistant DNA end of the dsDNA molecule described herein contains a DNA hairpin loop.

[0608] In some embodiments, the DNA hairpin loop comprises one or more unmodified nucleotides. In some embodiments, the DNA hairpin loop consists entirely of unmodified nucleotides. In some embodiments, the DNA hairpin loop comprises one or more chemically modified nucleotides (e.g., phosphate thioester-modified nucleotides, as described herein). In some embodiments, the DNA hairpin loop consists entirely of chemically modified nucleotides (e.g., phosphate thioester-modified nucleotides, as described herein).

[0609] In some embodiments, the single-stranded loop region of the DNA hairpin loop comprises one or more chemically modified nucleotides (e.g., phosphate-thioester modified nucleotides, as described herein). In embodiments, at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, or at least 99% of the nucleotides in the single-stranded loop region are chemically modified nucleotides (e.g., phosphate-thioester modified nucleotides, as described herein). In embodiments, the single-stranded loop region of the DNA hairpin loop is composed entirely of chemically modified nucleotides (e.g., phosphate-thioester modified nucleotides, as described herein). In some embodiments, the single-stranded loop region of the DNA hairpin loop comprises one or more unmodified nucleotides. In embodiments, the single-stranded loop region of the DNA hairpin loop is composed entirely of unmodified nucleotides.

[0610] In some embodiments, the double-stranded stem region of the DNA hairpin loop comprises one or more unmodified nucleotides. In some embodiments, the double-stranded stem region of the DNA hairpin loop consists entirely of unmodified nucleotides. In some embodiments, the double-stranded stem region of the DNA hairpin loop comprises one or more chemically modified nucleotides (e.g., phosphate thioester-modified nucleotides, as described herein). In some embodiments, at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, or at least 99% of the nucleotides in the double-stranded stem region are modified nucleotides (e.g., phosphate thioester-modified nucleotides, as described herein). In some embodiments, the double-stranded stem region of the DNA hairpin loop consists entirely of chemically modified nucleotides (e.g., phosphate thioester-modified nucleotides, as described herein).

[0611] In embodiments, the single-stranded loop region of the DNA hairpin loop comprises one or more chemically modified nucleotides (e.g., phosphate-thioester modified nucleotides, as described herein) and the double-stranded stem region comprises one or more unmodified nucleotides. In embodiments, at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, or at least 99% of the nucleotides in the single-stranded loop region are chemically modified nucleotides (e.g., phosphate-thioester modified nucleotides, as described herein). In embodiments, the single-stranded loop region of the DNA hairpin loop is entirely composed of chemically modified nucleotides (e.g., phosphate-thioester modified nucleotides, as described herein) and the double-stranded stem region is entirely composed of unmodified nucleotides.

[0612] Y-connector

[0613] In some embodiments, the exonuclease-resistant DNA terminal form described herein includes a Y-adaptor. As described herein, a Y-adaptor typically comprises a pair of single-stranded DNA regions, each attached at one end to a strand of a double-stranded DNA region, thereby forming a "Y" shape (where the base of the "Y" represents a double-stranded DNA region, and each fork of the "Y" represents two single-stranded DNA regions). Exemplary Y-adaptor structures and exemplary dsDNA molecules containing Y-adaptors are shown in Figure 2 middle.

[0614] In some embodiments, the Y-adaptor is generated by attaching a hairpin loop containing a single-stranded region to the end of a double-stranded DNA region (e.g., by ligation), the single-stranded region containing a cleavable portion. The cleavable portion can then be cleaved to generate two single-stranded DNA regions of the Y-adaptor.

[0615] In some embodiments, the single-stranded DNA region of the Y-adaptor (e.g., one or both single-stranded DNA regions) comprises one or more chemically modified nucleotides (e.g., phosphate-thioester modified nucleotides, as described herein). In embodiments, at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, or at least 99% of the nucleotides in the single-stranded DNA region are chemically modified nucleotides (e.g., phosphate-thioester modified nucleotides, as described herein). In embodiments, the single-stranded DNA region of the Y-adaptor (e.g., one or both single-stranded DNA regions) consists entirely of chemically modified nucleotides (e.g., phosphate-thioester modified nucleotides, as described herein). In some embodiments, the single-stranded DNA region of the Y-adaptor (e.g., one or both single-stranded DNA regions) comprises one or more unmodified nucleotides.

[0616] In embodiments, the single-stranded DNA region of the Y-adaptor (e.g., one or two single-stranded DNA regions) comprises one or more chemically modified nucleotides (e.g., phosphate-thioester modified nucleotides, as described herein), and the double-stranded DNA region of the Y-adaptor comprises one or more unmodified nucleotides. In embodiments, at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, or at least 99% of the nucleotides in one or both single-stranded DNA regions are chemically modified nucleotides (e.g., phosphate-thioester modified nucleotides, as described herein). In embodiments, the single-stranded DNA region of the Y-adaptor (e.g., one or two single-stranded DNA regions) is entirely composed of chemically modified nucleotides (e.g., phosphate-thioester modified nucleotides, as described herein), and the double-stranded DNA region of the Y-adaptor is entirely composed of unmodified nucleotides.

[0617] Acyclic closed DNA end form

[0618] In some embodiments, the dsDNA molecule described herein (e.g., TDSC) comprises a covalently closed, but not hairpin-loop-free, exonuclease-resistant DNA end form. For example, in some embodiments, each nucleotide of the covalently closed DNA end form hybridizes to another nucleotide. In some embodiments, the covalently closed DNA end form comprises a first region and a second region, wherein the first region is capable of hybridizing integrally with the second region (e.g., wherein the first region is complementary to the second region) and wherein the 3' end of the first region is covalently attached to the 5' end of the second region. In embodiments, the covalently closed DNA end form as described herein may, for example, be attached to one end of the dsDNA molecule as described herein by ligation.

[0619] Open DNA end form

[0620] In some embodiments, the dsDNA molecules described herein (e.g., TDSC) comprise non-covalently blocked exonuclease-resistant DNA ends. In some embodiments, the DNA end forms comprise blunt ends (e.g., blunt ends comprising one or more chemical modifications as described herein) or sticky ends (e.g., sticky ends comprising one or more chemical modifications as described herein).

[0621] In some embodiments, open DNA end forms are produced by digesting covalently closed DNA end forms, such as DNA hairpins, with a nuclease. In one embodiment, the DNA hairpin includes a double-stranded stem region containing a cleavable portion on each strand, and the DNA hairpin is then contacted with an enzyme capable of cleaving the cleavable portion. In another embodiment, this results in the formation of sticky ends containing protruding ends. In yet another embodiment, the protruding ends are digested with an enzyme (e.g., a single-strand-specific nuclease, such as bean nuclease) to form blunt ends.

[0622] In some embodiments, the blunt-ended DNA terminal form comprises one or more chemically modified nucleotides (e.g., phosphate-thioester modified nucleotides, as described herein). In embodiments, at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, or at least 99% of the nucleotides in the blunt-ended DNA terminal form are chemically modified nucleotides (e.g., phosphate-thioester modified nucleotides, as described herein). In embodiments, the blunt-ended DNA terminal form consists entirely of chemically modified nucleotides (e.g., phosphate-thioester modified nucleotides, as described herein). In embodiments, the terminal base pairs of the blunt-ended DNA terminal form comprise chemically modified nucleotides (e.g., one or both nucleotides of the base pair are chemically modified), such as phosphate-thioester modified nucleotides, as described herein. In embodiments, multiple base pairs (e.g., 2, 3, 4, 5, or 6 base pairs) at the ends of the DNA terminal form comprise chemically modified nucleotides (e.g., one or both nucleotides of the base pair are chemically modified), such as phosphate thioester-modified nucleotides, as described herein. In embodiments, three base pairs at the ends of the DNA terminal form comprise chemically modified nucleotides (e.g., one or both nucleotides of the base pair are chemically modified), such as phosphate thioester-modified nucleotides, as described herein. In embodiments, six base pairs at the ends of the DNA terminal form comprise chemically modified nucleotides (e.g., one or both nucleotides of the base pair are chemically modified), such as phosphate thioester-modified nucleotides, as described herein.

[0623] In some embodiments, the DNA terminal form containing sticky ends comprises one or more chemically modified nucleotides (e.g., phosphate thioester-modified nucleotides, as described herein). In embodiments, at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, or at least 99% of the nucleotides in the DNA terminal form containing sticky ends are chemically modified nucleotides (e.g., phosphate thioester-modified nucleotides, as described herein). In embodiments, the DNA terminal form containing sticky ends consists entirely of chemically modified nucleotides (e.g., phosphate thioester-modified nucleotides, as described herein). In embodiments, the terminal nucleotides of the DNA terminal form containing sticky ends comprise chemically modified nucleotides (e.g., one or both nucleotides of the base pair are chemically modified), such as phosphate thioester-modified nucleotides, as described herein. In embodiments, the protruding regions of the sticky ends in the form of DNA ends contain one or more chemically modified nucleotides, such as phosphate thioester-modified nucleotides, as described herein.

[0624] Inverted terminal repeat (ITR)

[0625] In some embodiments, the dsDNA molecule as described herein (e.g., TDSC) comprises an exonuclease-resistant DNA end form containing an inverted terminal repeat (ITR). In some embodiments, the ITR is an ITR derived from a virus such as adenovirus or adeno-associated virus (AAV). In some embodiments, the ITR comprises a nucleic acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with an ITR sequence derived from a virus such as adenovirus or adeno-associated virus (AAV). In some embodiments, the ITR comprises an origin of replication (e.g., a viral origin of replication). In embodiments, the dsDNA molecule described herein comprises an exonuclease-resistant DNA end form containing an ITR (e.g., as described herein) at each end. In some embodiments, the dsDNA molecule does not contain an ITR.

[0626] Promoters and other regulatory sequences

[0627] The TDSCs or nucleic acids containing dsDNA described herein may contain promoters (DNA sequences in which RNA polymerases and transcription factors bind directly or indirectly to initiate transcription) operatively linked to effector sequences. Promoters may be found in nature, operatively linked to effector sequences, or may be heterologous to effector sequences. The promoters described herein may be native to the target cell or tissue, or heterologous to the target cell or tissue. Promoters may be constitutive, inducible, and / or tissue-specific.

[0628] Examples of constitutive promoters include the retroviral Rouss sarcoma virus (RSV) LTR promoter (optionally with an RSV enhancer), the cytomegalovirus (CMV) promoter (optionally with a CMV enhancer) (see, for example, Boshart et al., Cell, 41:521-530 (1985)), the SV40 promoter, the dihydrofolate reductase promoter, the β-actin promoter, the glycerol phosphokinase (PGK) promoter, and the EF1α promoter.

[0629] Inducible promoters allow for the regulation of expression and can be modulated by exogenously provided compounds, environmental factors (such as temperature), or the presence of specific physiological states (e.g., acute phase, specific differentiation state of cells, or only during cell replication). Inducible promoters and inducible systems are available from a variety of sources. Examples of inducible promoters regulated by exogenously provided promoters include the zinc-inducible sheep metallothionein (MT) promoter, the dexamethasone (Dex)-inducible mouse mammary tumor virus (MMTV) promoter, and the T7 polymerase promoter system (WO... 98 / 10088); Ecdysone insect promoter (No et al., Proc. Natl. Acad. Sci. USA, 93:3346-3351 (1996)), Tetracycline inhibition system (Gossen et al., Proc. Natl. Acad. Sci. USA, 89:5547-5551 (1992)), Tetracycline induction system (Gossen et al., Science, 268:1766-1769 (1995), see also Harvey et al., Curr. Opin. Chem. Biol., 2:512-518 (1998)), RU486 induction system (Wang et al., Nat. Biotech., 15:239-243 (1997) and Wang et al., Gene Ther. [Gene Therapy], 4:432-441 (1997) and rapamycin-induced system (Magari et al., J. Clin. Invest. [Journal of Clinical Research], 100:2865-2872 (1997)).

[0630] In some embodiments, a natural promoter of a sequence encoding effectors may be used.

[0631] In some embodiments, regulatory sequences confer tissue-specific gene expression capabilities. In some cases, tissue-specific regulatory sequences bind to tissue-specific transcription factors that induce transcription in a tissue-specific manner. Such tissue-specific regulatory sequences (e.g., promoters, enhancers, etc.) are known in the art. Exemplary tissue-specific regulatory sequences include, but are not limited to, the following tissue-specific promoters: liver-specific thyroxine-binding globulin (TBG) promoter, insulin promoter, glucagon promoter, somatostatin promoter, pancreatic polypeptide (PPY) promoter, synaptic protein-1 (Syn) promoter, creatine kinase (MCK) promoter, mammalian desmin (DES) promoter, α-myosin heavy chain (a-MHC) promoter, or cardiac troponin T (cTnT) promoter. Other exemplary promoters include: β-actin promoter, hepatitis B virus core promoter (Sandig et al., Gene Ther., 3:1002-9 (1996)); alpha-fetoprotein (AFP) promoter (Arbuthnot et al., Hum. Gene Ther., 7:1503-14 (1996)); osteocalcin promoter (Stein et al., Mol. Biol. Rep., 24:185-96 (1997)); and bone salivary protein promoter (Chen et al., J. Bone Miner.Res. [Journal of Bone and Mineral Research] 11:654-64 (1996)), CD2 promoter (Hansal et al., J. Immunol. [Journal of Immunology], 161:1063-8 (1998); immunoglobulin heavy chain promoter; T cell receptor α chain promoter, neuron-specific enolase (NSE) promoter (Andersen et al., Cell. Mol. Neurobiol. [Cell and Molecular Neurobiology], 13:503-15 (1993)), neurofilament light chain gene promoter (Piccioli et al., Proc. Natl. Acad. Sci. USA [Proceedings of the National Academy of Sciences of the United States of America], 88:5611-5 (1991)), and neuron-specific vgf gene promoter (Piccioli et al., Neuron, 15:373-84 (1995)), and others known to those skilled in the art.

[0632] Table 1 lists examples of tissue / cell-specific promoters:

[0633] Table 1: Tissue- or cell-specific promoters

[0634]

[0635]

[0636] The constructs described herein may also include other natural or heterologous expression control elements, such as enhancer elements, polyadenylation sites, or cozak concordant sequences.

[0637] Effect subsequence

[0638] The effector sequence of the dsDNA molecule (e.g., TDSC) described herein may be, for example, a functional DNA sequence, such as a therapeutic functional DNA sequence; a DNA sequence encoding a therapeutic peptide, polypeptide, or protein; or a DNA sequence encoding a therapeutic RNA (e.g., non-coding RNA). In some embodiments, the therapeutic loading sequence is the effector sequence described herein.

[0639] A therapeutic load sequence can be used to express a therapeutic load encoded by the therapeutic load sequence. An effector sequence can be used to express an effector encoded by the effector sequence. In some embodiments, the therapeutic load is the effector as described herein.

[0640] DNA effectors:

[0641] Therapeutic functional DNA sequences can be DNA sequences that form functional structures, such as DNA sequences containing DNA aptamers, deoxyribozymes, or allele-specific oligonucleotides (DNAASOs). Therapeutic functional DNA sequences may not have an operable promoter. In embodiments, the dsDNA molecules described herein (e.g., TDSCs) may include one or more functional DNA sequences, such as 2, 3, 4, 5, 6, or more sequences, which may be identical or different.

[0642] Peptide effectors:

[0643] The DNA sequence encoding a therapeutic polypeptide can be a DNA sequence encoding one or more effectors, which are peptides, proteins, or combinations thereof. For example, a DNA sequence encoding mRNA. Peptides or proteins can be: DNA-binding proteins; RNA-binding proteins; transport proteins; transcription factors; translation factors; ribosomal proteins; chromatin remodeling factors; epigenetic modifying factors; antigens; hormones; enzymes (e.g., nucleases, such as endonucleases, such as nuclease elements of the CRISPR system, such as Cas9, dCas9, Cas9 nickase, Cpf / Cas12a); CRISPR-linked enzymes, such as base editors or guide editors; proteins that move genetic elements (e.g., transposases, reverse transposases, recombinases, integrases); gene writers; polymerases; methyltransferases; demethylases; acetyltransferases; deacetylases; kinases; phosphatases; ligases; deubiquitinases; proteases; integrases; recombinases; topoisomerases; gyrases; helicases; lysosomal acid hydrolases); antibodies (e.g., intact antibodies, fragments thereof, or nanobodies); signal transduction peptides; receptor ligands; receptors; clotting factors. Factors; coagulation factors; structural proteins; caspases; membrane proteins; mitochondrial proteins; nucleoproteins; engineered binders, such as centyrin, darpin, or fibronectin. See, for example, Gebauer & Skerra. 2020. Annual Review of Pharmacology and Toxicology 60:1, 391-415.

[0644] In embodiments, the dsDNA molecule described herein (e.g., TDSC) may include one or more sequences encoding a polypeptide, such as sequences 2, 3, 4, 5, 6, or more encoding a polypeptide. Each of the plurality of sequences may encode the same or a different protein. For example, the dsDNA molecule described herein (e.g., TDSC) may include multiple sequences encoding multiple proteins (e.g., multiple proteins in a biological pathway).

[0645] In some embodiments, a dsDNA molecule (e.g., TDSC) may include multiple sequences encoding polypeptides, such as 2, 3, 4, 5, 6, or more sequences encoding polypeptides, separated by self-cleaving peptides such as P2A, T2A, E2A, or F2A. The self-cleaving peptides are 18-22 amino acids long and can induce ribosome jumping during protein translation, thereby allowing two polypeptides to be encoded in the same transcript. Each polypeptide may encode the same or different proteins. In one embodiment, a dsDNA molecule (e.g., TDSC) may include a promoter followed by a sequence encoding a first target polypeptide, a sequence encoding a 2A self-cleaving peptide, a sequence encoding a second target polypeptide, and a poly-A site. In another embodiment, a dsDNA molecule (e.g., TDSC) may include a promoter followed by a sequence encoding a first target polypeptide, a sequence encoding a first 2A self-cleaving peptide, a sequence encoding a second target polypeptide, a sequence encoding a second 2A self-cleaving peptide, a sequence encoding a third target polypeptide, and a poly-A site.

[0646] In some embodiments, the effector comprises a cell-penetrating polypeptide. In some embodiments, the effector is a fusion protein comprising a cell-penetrating polypeptide and a second amino acid sequence.

[0647] RNA effectors:

[0648] Effector sequences can be DNA sequences that encode non-coding RNAs (e.g., short interfering RNA (siRNA), microRNA (miRNA), long non-coding RNA, piwi-interacting RNA (piRNA), small nucleolar RNA (snoRNA), small caharsome-specific RNA (scaRNA), transfer RNA (tRNA), ribosomal RNA (rRNA), RNA aptamers, and small nuclear RNA (snRNA).

[0649] In some embodiments, the dsDNA molecules disclosed herein (e.g., TDSCs) comprise one or more expression sequences encoding regulatory RNAs (e.g., RNAs that modify the expression of endogenous and / or exogenous genes). In some embodiments, the dsDNA molecules or sequences disclosed herein may comprise sequences that are antisense to regulatory nucleic acids (like non-coding RNAs, such as, but not limited to, tRNA, lncRNA, miRNA, rRNA, snRNA, microRNA, siRNA, piRNA, snoRNA, snRNA, exRNA, scaRNA, Y RNA, and hnRNA). In one embodiment, the regulatory nucleic acid targets a host gene. Regulatory nucleic acids may include, but are not limited to, nucleic acids that hybridize with endogenous genes (e.g., antisense RNA, guide RNA), nucleic acids that hybridize with exogenous nucleic acids (e.g., viral DNA or RNA), nucleic acids that hybridize with RNA, nucleic acids that interfere with gene transcription, nucleic acids that interfere with RNA translation, nucleic acids that stabilize or destabilize RNA (e.g., through targeted degradation), and nucleic acids that regulate DNA or RNA binding factors. In one embodiment, the sequence is a miRNA. In some embodiments, the regulatory nucleic acid targets the sense strand of a host gene. In some embodiments, the regulatory nucleic acid targets the antisense strand of a host gene.

[0650] In some embodiments, the dsDNA molecule encodes a guide RNA. The guide RNA sequence is typically designed to have a length between 15 and 30 nucleotides (e.g., 17, 19, 20, 21, 24 nucleotides) complementary to the target nucleic acid sequence, and a region that promotes complex formation (e.g., using tracrRNA or a nuclease). Custom gRNA generators and algorithms are commercially available for designing effective guide RNAs. Gene editing can also be achieved using chimeric “single guide RNA” (“sgRNA”), an engineered (synthetic) single RNA molecule that mimics the naturally occurring crRNA-tracrRNA complex and contains both tracrRNA (for binding the nuclease) and at least one crRNA (to guide the nuclease to the targeted sequence for editing). Chemically modified sgRNAs have also been shown to be effective in genome editing; see, for example, Hendel et al. (2015) Nature Biotechnol., 985-991. gRNAs can recognize specific DNA sequences (e.g., sequences adjacent to or within a gene's promoter, enhancer, silencer, or repressor). In one embodiment, gRNA is used as part of a CRISPR system for gene editing. For gene editing purposes, the dsDNA molecules or sequences disclosed herein can be designed to include one or more sequences encoding a guide RNA sequence corresponding to a desired target DNA sequence; see, for example, Cong et al. (2013) Science, 339:819–823; Ran et al. (2013) Nature Protocols, 8:2281–2308.

[0651] The dsDNA molecules or sequences disclosed herein encode certain regulatory nucleic acids that can suppress gene expression through the biological process of RNA interference (RNAi). RNAi molecules contain RNA or RNA-like structures, typically containing 15-50 base pairs (e.g., approximately 18-25 base pairs) and have a nucleobase sequence that is identical (complementary) or nearly identical (substantially complementary) to the coding sequence in the target gene expressed within the cell. Such RNAi molecules include, but are not limited to: short interfering RNA (siRNA), double-stranded RNA (dsRNA), microRNA (miRNA), short hairpin RNA (shRNA), partially double helical and dicer substrates (US Patent Nos. 8,084,599, 8,349,809, and 8,513,207), and RNA antisense oligonucleotides (RNA ASO).

[0652] In one embodiment, the dsDNA molecule or sequence disclosed herein comprises a sequence containing a sense strand of lncRNA. In one embodiment, the dsDNA molecule or sequence disclosed herein comprises a sequence encoding an antisense strand of lncRNA.

[0653] The dsDNA molecules or sequences disclosed herein can encode regulatory nucleic acids that are substantially or completely complementary to segments of endogenous genes or gene products (e.g., mRNA). Regulatory nucleic acids can be complementary to sequences at the boundaries between introns and exons, within exons, or adjacent to exons, thereby preventing the maturation of newly generated nuclear RNA transcripts of a specific gene into mRNA for transcription. Regulatory nucleic acids complementary to a specific gene can hybridize with the mRNA of that gene and prevent its translation. Antisense regulatory nucleic acids can be DNA, RNA, or derivatives or hybrids thereof. In some embodiments, regulatory nucleic acids include protein-binding sites that can bind to proteins involved in the regulation of expression of endogenous or exogenous genes.

[0654] The length of the dsDNA molecule or sequence disclosed herein that encodes a regulatory nucleic acid that hybridizes with the target transcript can be, for example, about 5 to 30 nucleotides, about 10 to 30 nucleotides, or about 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or more nucleotides. The degree of identity between the regulatory nucleic acid and the target transcript should be at least 75%, at least 80%, at least 85%, at least 90%, or at least 95%.

[0655] The dsDNA molecules or sequences disclosed herein encode a small RNA (miRNA) molecule that is identical to about 5 to about 30 consecutive nucleotides of a target gene. In some embodiments, the miRNA sequence targets mRNA and begins with dinucleotide AA, has a GC content of about 30%-70% (about 30%-60%, about 40%-60%, or about 45%-55%), and, for example, does not have a high percentage identity with any nucleotide sequence other than the target in the mammalian genome to be introduced, as determined by a standard BLAST search. In some embodiments, the dsDNA molecules or sequences disclosed herein encode at least one miRNA, such as 2, 3, 4, 5, 6, or more. In some embodiments, the dsDNA molecules or sequences disclosed herein comprise a sequence encoding a miRNA having at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% nucleotide sequence identity with any of these nucleotide sequences or with a sequence complementary to the target sequence. Lists of known miRNA sequences can be found in databases maintained by research organizations such as the Wellcome Trust Sanger Institute, the Penn Center for Bioinformatics, Memorial Sloan Kettering Cancer Center, and the European Molecule Biology Laboratory. Known effective siRNA sequences and homology binding sites are also well presented in relevant literature. RNAi molecules can be easily designed using techniques known in the field. Additionally, computational tools can increase the chances of finding effective and specific sequence motifs (see, for example, Lagana et al., Methods Mol. Bio. [Molecular Biology Methods], 2015, 1269:393-412).

[0656] The dsDNA molecules or sequences disclosed herein can regulate the expression of gene-encoded RNA. Because multiple genes may share a degree of sequence homology with each other, in some embodiments, the dsDNA molecules or sequences disclosed herein can be engineered to target a class of genes with sufficient sequence homology. In some embodiments, the dsDNA molecules or sequences disclosed herein may contain sequences that are complementary to sequences shared between different gene targets or sequences that are unique to a particular gene target. In some embodiments, the dsDNA molecules or sequences disclosed herein can be engineered to target conserved regions of RNA sequences that are homologous among several genes, thereby targeting several genes in a gene family (e.g., different gene isotypes, splice variants, mutant genes, etc.). In some embodiments, the dsDNA molecules or sequences disclosed herein can be engineered to target sequences specific to a particular RNA sequence of a single gene.

[0657] In the embodiments, the length of the effector sequence encoding the regulatory RNA is less than 5000 bp (e.g., less than about 5000 bp, less than about 4000 bp, less than about 3000 bp, less than about 2000 bp, less than about 1000 bp, less than about 900 bp, less than about 800 bp, less than about 700 bp, less than about 600 bp, less than about 500 bp, less than about 400 bp, less than about 300 bp, less than about 200 bp, less than about 100 bp, less than about 50 bp, less than about 40 bp, less than about 30 bp, less than about 20 bp, less than about 10 bp or less). In some embodiments, the effector sequence independently or additionally has a length greater than 10 bp (e.g., at least about 10 bp, at least about 20 bp, at least about 30 bp, at least about 40 bp, at least about 50 bp, at least about 60 bp, at least about 70 bp, at least about 80 bp, at least about 90 bp, at least about 100 bp, at least about 200 bp, at least about 300 bp, at least about 400 bp, at least about 500 bp, at least about 600 bp, at least about 700 bp, at least about 800 bp, at least about 900 bp, at least about 1000 kp, at least about 1.1 kp, at least about 1.2 kp, at least about 1.3 kp, at least about 1.4 kp, at least about 1.5 kp, at least about 1.6 kp, at least about 1.7 kp, at least about 1.8 kp, at least about 1.9 kp, to...). The length is approximately 2 kp, 2.1 kp, 2.2 kp, 2.3 kp, 2.4 kp, 2.5 kp, 2.6 kp, 2.7 kp, 2.8 kp, 2.9 kp, 3 kp, 3.1 kp, 3.2 kp, 3.3 kp, 3.4 kp, 3.5 kp, 3.6 kp, 3.7 kp, 3.8 kp, 3.9 kp, 4 kp, 4.1 kp, 4.2 kp, 4.3 kp, 4.4 kp, 4.5 kp, 4.6 kp, 4.7 kp, 4.8 kp, 4.9 kp, or 5 kb or more.

[0658] In some embodiments, the dsDNA molecules or sequences disclosed herein comprise one or more of the features described above, such as one or more structural DNA sequences, sequences encoding one or more peptides or proteins, sequences encoding one or more regulatory elements, sequences encoding one or more regulatory nucleic acids (e.g., one or more non-coding RNAs), other expression sequences, and any combination thereof. The constructs described herein may have one or more effector sequences, such as 2, 3, 4, 5, or more effector sequences. In the case of multiple effector sequences in a single construct, the effector sequences may be the same or different.

[0659] In one embodiment, the dsDNA molecule includes a therapeutically functional structural DNA sequence. In one embodiment, the dsDNA molecule includes a promoter and a sequence encoding a therapeutic peptide, polypeptide, or protein as described herein. In one embodiment, the dsDNA molecule includes a promoter and a sequence encoding a regulatory RNA as described herein.

[0660] In some embodiments, the effector sequence encoding a polypeptide or protein is codon-optimized, for example, for expression in mammals (e.g., humans). Generally, codon optimization refers to modifying a nucleic acid sequence to enhance expression in a target host cell by replacing at least one codon of the original sequence with a more commonly used or most frequently used codon in the host cell's gene (e.g., one or more, such as 1, 2, 3, 4, 5, 10, 15, 20, 25, 50, or more codons; e.g., at least 1%, at least 5%, at least 10%, at least 20%, at least 25%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or 100%) while preserving the original amino acid sequence. Codon usage tables are available, for example, at http: / / www.kazusa.or.jp / codon / in the "Codon Usage Database". These tables can be modified in various ways, see, for example, Nakamura et al., 2000, Nucl. Acids Res. [Nucleic Acid Research] 28:292. Computer algorithms for codon optimization of specific sequences for expression in specific host cells are also available, such as Gene Forge.

[0661] Nuclear Targeting Sequences (NTS)

[0662] dsDNA molecules (e.g., TDSCs) or nucleic acids containing dsDNA (e.g., as disclosed herein) may include nuclear targeting sequences (NTSs) that facilitate the transport of DNA from the cytoplasm to the nucleus. NTSs include binding sites for proteins (e.g., transcription factors, molecular chaperones, etc.) that bind to nuclear import proteins that transport cargo into the nucleus via the nuclear pore complex. In some embodiments, NTSs may function generally (e.g., SV40 enhancer NTSs). In other embodiments, NTSs may be cell- or tissue-specific, for example, containing binding sites for transcription factors expressed in unique cell types that can target the dsDNA molecules described herein to the nucleus in a cell-specific manner. NTSs may function at multiple locations within the dsDNA molecules described herein, such as before the promoter and / or after the effector sequence.

[0663] NTS can be viral or non-viral. For example, NTS are described in Le Guen et al. 2021. Nucleic Acids, Vol. 24: 477-486. Examples of NTS are disclosed in Table 2:

[0664] Table 2: Exemplary nuclear targeting sequences

[0665] Viral / non-viral name sequence

[0666] The virus's SV40 5'-cccaagaagaagaggaaagtc-3' (SEQ ID NO:1)

[0667] Non-viral 3NF 5'-ctggggactttccagcctggggactttccagctgggactttccagg

[0668] 3'(SEQ ID NO:85)

[0669] In some embodiments, the NTS has a sequence according to Table 2, or a functional sequence having at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with it.

[0670] nuclear input protein

[0671] In some embodiments, TDSCs or nucleic acids containing dsDNA (e.g., as described herein) can be introduced into the cell nucleus, for example, via nuclear importation proteins. In some embodiments, TDSCs or nucleic acids containing dsDNA (e.g., as described herein) can be bound by nuclear importation proteins. In some embodiments, TDSCs or nucleic acids containing dsDNA (e.g., as described herein) contain a recognition sequence for nuclear importation proteins. In some embodiments, exonuclease-resistant DNA terminal forms (e.g., contained in TDSCs or nucleic acids containing dsDNA, e.g., as described herein) contain a recognition sequence for nuclear importation proteins.

[0672] Exemplary input proteins include, for example, basic helical-loop-helical (bHLH) proteins, heterologous nucleoribonucleoprotein (hnRNP) isoforms, or nuclear factor I (NFI) proteins. In some embodiments, the input protein comprises a nuclear input protein.

[0673] In some embodiments, the input protein comprises a Ran-binding protein. In some embodiments, the input protein comprises a homeobox transcription factor. In some embodiments, the input factor specifically binds to an E-box, DTS, promoter, telomere, ATTT motif, cell cycle regulatory unit (CCRU), CT3 sequence, S / MAR, topoisomerase II common sequence, ARS common sequence, 3NF, or viral ori.

[0674] Maintenance sequence

[0675] The dsDNA molecules disclosed herein (e.g., TDSCs) may include maintenance sequences that support or enable the dsDNA molecules of the present invention to sustain gene expression in host cells through successive rounds of cell division and / or progenitor cell differentiation. In embodiments, the maintenance sequence is a nuclear scaffold / matrix attachment region (S / MAR). S / MAR elements are diverse, AT-rich sequences ranging from 60–500 bp, conserved across species, and believed to anchor chromatin to nuclear matrix proteins during interphase (Bode et al. 2003. Chromosome Res. 11, 435–445). S / MARs may be incorporated into the dsDNA molecules described herein to promote long-term transgene expression and extrachromosomal maintenance. In one embodiment, the maintenance sequence is human interferon-β MAR (5'tataattcactggaatttttttgtgtgtatggtatgacatatgggttccc ttttattttttacatataaatatatttccctgtttttctaaaaaagaaaagatcatcattttcccattgtaaaatgccatatttttttcataggtcacttacata-3' (SEQ ID NO:39)), or a functional sequence having at least 80%, at least 90%, at least 95%, or at least 98% identity with it. In an embodiment, the S / MAR available for use in the constructs described herein can be found by searching for MARome at http: / / bioinfo.net.in / MARome, which is also described in Narwade et al. 2019. Nucleic Acids Research. Vol. 47, No. 14: 7247–7261.

[0676] In embodiments, the dsDNA molecules described herein (e.g., TDSC) are capable of replicating in mammalian cells, such as human cells. In some embodiments, the dsDNA molecules described herein are maintained in host cells, tissues, or subjects through at least one cell division. For example, the dsDNA molecules described herein are maintained in host cells, tissues, or subjects through at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 10, at least 15, at least 20, at least 40, at least 50, or more cell divisions. In vitro, cell division can be tracked by flow cytometry or microscopy. In vivo, cell division can be tracked by in vivo microscopy.

[0677] Other components

[0678] The TDSCs or dsDNA-containing nucleic acids disclosed herein may also include other control elements operatively linked to effector sequences (e.g., sequences encoding effectors) in a manner that allows them to be transported, localized, transcribed, translated, and / or expressed in target cells, or promotes their degradation or inhibits their expression in non-target cells. As used herein, “operatively linked” sequences include expression control sequences adjacent to the sequence encoding the effector and expression control sequences that act trans- or at a distance to control the sequence encoding the effector. The exact nature of the regulatory sequences required for gene expression in host cells may vary by species, tissue, or cell type, but may generally include, as needed, 5' non-transcriptional and 5' non-translational sequences, respectively, associated with transcription and translation initiation, such as TATA boxes, capping sequences, CAAT sequences, enhancer elements, etc. Regulatory sequences may also include enhancer sequences or upstream activator sequences, as needed. The constructs described herein may optionally include 5' leader sequences or signal sequences.

[0679] Structure of DNA constructs

[0680] In some embodiments, the dsDNA molecule disclosed herein (e.g., TDSC) has a length of at least about 20 nucleotides, at least about 30 nucleotides, at least about 40 nucleotides, at least about 50 nucleotides, at least about 75 nucleotides, at least about 100 nucleotides, at least about 200 nucleotides, at least about 300 nucleotides, at least about 500 nucleotides, at least about 1000 nucleotides, at least about 2000 nucleotides, at least about 3000 nucleotides, at least about 4000 nucleotides, at least about 5000 nucleotides, at least about 6000 nucleotides, at least about 7000 nucleotides, at least about 8000 nucleotides, at least about 9000 nucleotides, at least about 10,000 nucleotides, at least about 20,000 nucleotides, at least about 30,000 nucleotides, at least about 40,000 nucleotides, or at least about 50,000 nucleotides. In some embodiments, the length of the dsDNA molecules disclosed herein is between 20-30, 30-40, 40-50, 50-75, 75-100, 100-200, 200-300, 300-500, 500-1000, 1000-2000, 2000-3000, 3000-4000, 4000-5000, 5000-6000, 6000-7000, 7000-8000, 8000-9000, 9000-10,000, 10,000-20,000, 20,000-30,000, 30,000-40,000, or 40,000-50,000 nucleotides. In some embodiments, the size of the dsDNA molecules disclosed herein is sufficient to encode a useful polypeptide or RNA. It should be understood that when discussing the length of linear closed-terminated dsDNA molecules in this article, length refers to the number of nucleotides starting from the upstream end and including the upstream end up to the downstream end. For example, an acyclic dsDNA molecule with 100 base pairs will have a length of 100 nucleotides.

[0681] In some embodiments, the dsDNA molecule comprises exonuclease-resistant DNA ends (e.g., as described herein). In some embodiments, the length of the DNA ends is at least 2, at least 3, at least 4, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, or at least 100 nucleotides. In some embodiments, the length of the DNA ends is less than 10, less than 15, less than 20, less than 25, less than 30, less than 40, less than 50, less than 60, less than 70, less than 80, less than 90, or less than 100 nucleotides. In some embodiments, the length of the DNA terminal form is 2-5, 5-10, 10-15, 15-20, 20-25, 25-30, 30-35, 35-40, 40-45, 45-50, 50-55, 55-60, 60-70, 70-80, 80-90, or 90-100 nucleotides.

[0682] In some embodiments, the dsDNA molecule comprises a double-stranded region encoding an effector (e.g., a polypeptide or RNA, as described herein), for example located between two exonuclease-resistant DNA ends. In some embodiments, the length of the double-stranded region is at least 10, at least 15, at least 20, at least 25, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 200, at least 300, at least 400, at least 500, at least 600, at least 700, at least 800, at least 900, at least 1000, at least 2000, at least 3000, at least 4000, at least 5000, at least 6000, at least 7000, at least 8000, at least 9000, at least 10,000, at least 20,000, at least 30,000, at least 40,000, or at least 50,000 nucleotides. In some embodiments, the length of the double-stranded region is less than 50, less than 60, less than 70, less than 80, less than 90, less than 100, less than 200, less than 300, less than 400, less than 500, less than 600, less than 700, less than 800, less than 900, less than 10,000, less than 20,000, less than 30,000, less than 40,000, or less than 50,000 nucleotides. In some embodiments, the length of the double-stranded region is 10-15, 15-20, 20-25, 25-30, 30-35, 35-40, 40-45, 45-50, 50-55, 55-60, 60-70, 70-80, 80-90, 90-100, 100-200, 200-300, 300-400, 400-500, 500-600, 600-700, 700-800, 800-90. 0, 900-1000, 1000-2000, 2000-3000, 3000-4000, 4000-5000, 5000-6000, 6000-7000, 7000-8000, 8000-9000, 9000-10,000, 10,000-20,000, 20,000-30,000, 30,000-40,000, or 40,000 to 50,000 nucleotides.

[0683] The dsDNA molecules described herein may have a single-stranded structure below a threshold level. In one embodiment, the dsDNA molecule does not contain a single-stranded region longer than 20, 18, 16, 14, 12, 10, 8, 7, 5, 4, 3, 2, or 10 bases, for example, it does not contain a single-stranded region longer than 100, 80, 70, 60, 50, 40, 30, 20, or 10 bases. In one embodiment, the double-stranded region formed by the dsDNA molecule described herein is determined as follows: Xayaphoummine et al. 2005. Kinefold web server for RNA / DNA folding path and structure prediction including pseudoknots and knots. Nucleic Acids Research, Vol. 33: W605-610. In one embodiment, the Kinefold website (http: / / kinefold.curie.fr / cgi-bin / form.pl) is used to predict the doubly linked regions of the construct described herein using the following parameters:

[0684] • The sequence to be folded: Enter and select "DNA sequence"

[0685] • Randomized simulation: co-transcriptional folding, 3 milliseconds

[0686] • Simulate molecular time: Default

[0687] • False knot: Not allowed

[0688] Entanglement: No intersection

[0689] Random seed: 11453

[0690] In some embodiments, the dsDNA form described herein is asymmetrically modified, wherein one strand contains chemically modified nucleotides and the other strand is substantially free of chemically modified nucleotides. In some embodiments, the half-modified DNA may be completely free of chemically modified nucleotides on the antisense strand, and in other embodiments, the half-modified DNA may contain some chemical modifications (e.g., backbone modifications, such as phosphate thioesters) on the antisense strand. In some embodiments, the half-modified DNA molecule contains chemically modified nucleotides (e.g., nucleotides containing chemically modified nucleotides) on the sense strand. In some embodiments, the half-modified DNA molecule contains chemically modified cytosine nucleotides on the sense strand.

[0691] Production

[0692] In some embodiments, dsDNA molecules (e.g., TDSCs) as described herein are produced from plasmids assembled to contain the desired elements as described herein. For example, golden gate cloning can be used to assemble plasmid templates to assemble multiple DNA fragments in a defined linear order in an acceptor vector using a one-pot assembly procedure. Golden gate cloning is described in Marillonnet & Grützner, 2020, Synthetic DNA assembly using golden gate cloning and the hierarchical modular cloning pipeline, Current Protocols in Molecular Biology, 130:e115. In some embodiments, plasmid templates are linearized, for example, by digestion with a nuclease (e.g., restriction endonuclease) or by PCR amplification of a linear nucleic acid sequence from the plasmid template.

[0693] In some embodiments, a dsDNA molecule containing chemical modifications on one strand is generated by amplifying one strand (e.g., from a plasmid template) using a mixture of dNTPs, the mixture containing one or more chemically modified nucleotides and primers capable of amplifying the sequence of the dsDNA molecule on one strand. In some embodiments, the opposing strand (e.g., an unmodified strand or a strand with different chemical modifications, e.g., as described herein, is used). Figure 1A-2 (In the middle) is generated in a separate amplification reaction, for example using a mixture of dNTPs containing unmodified nucleotides or different groups of chemically modified nucleotides, and primers capable of amplifying the opposite strand of the dsDNA molecule sequence.

[0694] In some embodiments, dsDNA molecules containing the same chemical modifications on both strands are generated by amplifying dsDNA molecular chains (e.g., from a plasmid template) using a mixture of dNTPs, the mixture containing one or more chemically modified nucleotides and primers capable of amplifying both strands of the dsDNA molecular sequence.

[0695] In some embodiments, an exonuclease-resistant DNA end form (e.g., as described herein) is introduced (e.g., ligated) to one or both ends of a dsDNA molecule. In some embodiments, the DNA end form is attached to the end of the dsDNA molecule by ligation. In embodiments, the attachment (e.g., ligation) of the DNA end form (e.g., a covalently closed DNA end form) to the dsDNA molecule produces the final dsDNA molecule. In some embodiments, the exonuclease resistance of the attached DNA end form is confirmed, for example, by incubating the dsDNA molecule in the presence of an exonuclease (e.g., exonuclease III and / or mung bean nuclease), as described in Examples 2 and 3. In embodiments, the exonuclease resistance of the attached DNA end form is confirmed, for example, by incubating the dsDNA molecule in the presence of exonuclease III. In the embodiments, the DNA end form comprises blunt ends, sticky ends, or Y-adaptors (e.g., as described herein), and the exonuclease resistance of the attached DNA end form is confirmed by incubating the dsDNA molecule in the presence of exonuclease III and (e.g., subsequently, before, or simultaneously) mung bean nuclease.

[0696] In some embodiments, the DNA end form is nascently attached to the end of the dsDNA molecule (e.g., a non-covalently closed DNA end form can be attached to the dsDNA molecule as a hairpin). In subsequent steps, the nascent form of the DNA end form can be further modified (e.g., cleaved) to produce the final DNA end form. For example, the non-covalently closed DNA end form can be generated by cleaving the nascent form, for example, with a nuclease. In some embodiments, the nascent form containing protruding or sticky ends can be converted to blunt ends by digestion with a single-strand-specific nuclease, such as bean nuclease. In some embodiments, the nascent form containing a hairpin with a cleavable portion in its single-stranded loop region is converted to a Y-adjoint by cleavage of the cleavable portion.

[0697] In an embodiment, the method further includes formulating enriched or purified dsDNA molecules for pharmaceutical use, for example, by formulating dsDNA molecules with pharmaceutically acceptable excipients and / or with a carrier such as LNP.

[0698] In embodiments, the methods described herein include enriching or purifying dsDNA molecules. In embodiments, enrichment or purification includes substantially removing from dsDNA molecules one or more impurities selected from: endotoxins, mononucleotides, chemically modified mononucleotides, single-stranded DNA, DNA fragments or truncated segments, and proteins (e.g., enzymes, such as ligases, restriction enzymes).

[0699] dsDNA molecules can be enriched or purified from impurities or byproducts selected from the group consisting of: endotoxins, mononucleotides, chemically modified mononucleotides, single-stranded DNA, circular DNA, proteins (e.g., enzymes, such as ligases, restriction enzymes), DNA fragments, or truncated forms. In some embodiments, the purified dsDNA molecules are substantially free of process byproducts and impurities, such as those described herein.

[0700] In the embodiments, the pharmaceutical compositions comprising the dsDNA molecules described herein are substantially free of, for example, impurities or process byproducts selected from the group consisting of: endotoxins, mononucleotides, chemically modified mononucleotides, DNA fragments or truncated DNA, and proteins (e.g., enzymes, such as ligases, restriction enzymes). In some embodiments, the pharmaceutical compositions are substantially free of circular DNA. In some embodiments, the pharmaceutical compositions are substantially free of RNA. In some embodiments, the pharmaceutical compositions are substantially free of single-stranded DNA (ssDNA). In some embodiments, the pharmaceutical compositions are substantially free of DNA fragments. In some embodiments, the pharmaceutical compositions are substantially free of open-terminated double-stranded DNA. In some embodiments, the pharmaceutical compositions are substantially free of microorganisms. In some embodiments, the pharmaceutical compositions are substantially free of bacterial proteins. In some embodiments, the pharmaceutical compositions are substantially free of bacterial DNA.

[0701] In some embodiments, all dsDNA molecules in the pharmaceutical composition have substantially the same nucleotide length (e.g., all dsDNA molecules in the pharmaceutical composition have the same nucleotide length). In some embodiments, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% of the dsDNA molecules in the pharmaceutical composition have the same nucleotide length. In some embodiments, the therapeutic loading sequences of the dsDNA molecules in the pharmaceutical composition have substantially the same nucleotide length (e.g., the therapeutic loading sequences of the dsDNA molecules in the pharmaceutical composition have the same nucleotide length). In some embodiments, all dsDNA molecules in the pharmaceutical composition have a length between 100, 200, 500, or 1000 nucleotides. In some embodiments, all dsDNA molecules in the pharmaceutical composition have a length between 500-1000, 1000-2000, 2000-3000, 3000-4000, 4000-5000, 5000-6000, 6000-7000, 7000-8000, 8000-9000, 9000-10000, 10000-11000, or 11000-12000 nucleotides. In some embodiments, all dsDNA molecules in the pharmaceutical composition encode substantially the same effector (e.g., all dsDNA molecules in the pharmaceutical composition encode the same effector). In some embodiments, all dsDNA molecules in the pharmaceutical composition have substantially the same sequence (e.g., all dsDNA molecules in the pharmaceutical composition have the same sequence).

[0702] In some embodiments, the pharmaceutical composition is substantially free of a given impurity or process byproduct, for example, the pharmaceutical composition is free of impurities or process byproducts.

[0703] In some embodiments, the pharmaceutical composition comprises a plurality of dsDNA molecules described herein, wherein one of the plurality of dsDNA molecules comprises an amplicon region that originates from the start codon of the polypeptide encoded by the dsDNA molecules and extends in the transcriptional direction for 200 to 210 base pairs, 210 to 220 base pairs, 220 to 230 base pairs, 230 to 240 base pairs, or 240 to 250 base pairs. In some embodiments, the pharmaceutical composition comprises a first subgroup of dsDNA molecules, wherein each amplicon region in the first subgroup has the same DNA sequence, such as a desired sequence, and at least one additional dsDNA molecule, wherein the amplicon region of the additional dsDNA molecule has a different DNA sequence from the amplicon region in the first subgroup, for example, the amplicon region of the additional dsDNA molecule has one or more errors relative to the desired DNA sequence. In some embodiments, at least 70%, 20% to 70%, or 20% or less of the dsDNA molecules are part of a first subgroup. In some embodiments, the dsDNA molecules in the pharmaceutical composition have an average of at least 5, 1 to 5, or less than 1 substitution / kJ relative to the desired DNA sequence. In some embodiments, the dsDNA molecules in the pharmaceutical composition have an average of at least 0.1, 0.05 to 0.1, or less than 0.05 insertions / kJ relative to the desired DNA sequence. In some embodiments, the dsDNA molecules in the pharmaceutical composition have an average of at least 0.25, 0.15 to 0.25, or less than 0.15 deletions / kJ relative to the desired DNA sequence. In some embodiments, in the amplicon region, at least 99.5%, 0.15% to 99.5%, or less than 0.15% of the adenine, cytosine, guanine, or thymine positions in the desired DNA sequence are identical nucleobases in the dsDNA molecules of the pharmaceutical composition.

[0704] In some embodiments, the pharmaceutical composition comprises a plurality of dsDNA molecules described herein. In some embodiments, when the plurality of dsDNA molecules are introduced into a cell, the cell transcribes the dsDNA molecules to produce a plurality of RNA molecules comprising amplicon regions that originate from the start codon of the polypeptide encoded by the dsDNA molecules and extend in the transcriptional direction for at least 200, 210, 220, 230, 240, or 250 base pairs. In some embodiments, the plurality of RNA molecules comprises a first subgroup of RNA molecules, wherein each amplicon region in the first subgroup has the same RNA sequence, such as a desired RNA sequence, and at least one additional RNA molecule, wherein the amplicon region of the additional RNA molecule has an RNA sequence different from that of the amplicon regions in the first subgroup, for example, wherein the amplicon region of the additional RNA molecule has one or more errors relative to the desired RNA sequence. In some embodiments, at least 70%, 20% to 70%, or 20% or less of the RNA molecules are part of the first subgroup. In some embodiments, the RNA molecule in the pharmaceutical composition has an average of at least 5, 1 to 5, or less than 1 substitution / kilobase relative to the desired RNA sequence. In some embodiments, the RNA molecule in the pharmaceutical composition has an average of at least 0.1, 0.05 to 0.1, or less than 0.05 insertions / kilobase relative to the desired RNA sequence. In some embodiments, the RNA molecule in the pharmaceutical composition has an average of at least 0.25, 0.15 to 0.25, or less than 0.15 deletions / kilobase relative to the desired RNA sequence.

[0705] In some embodiments, dsDNA molecules are formulated with lipid-based carriers such as lipid nanoparticles (LNPs), as described in Example 1.

[0706] The dsDNA molecule can be sequenced to confirm the desired designed sequence. In the examples, other structural analyses of the dsDNA molecule (e.g., restriction enzyme analysis) can be performed to confirm or verify its sequence.

[0707] The chemically modified dsDNA molecules described herein can be produced by a variety of methods, including those conventional in the art. For example, chemically modified dsDNA molecules can be produced by polymerase chain reaction of a DNA template in the presence of unmodified and chemically modified nucleotides and a suitable polymerase. Exemplary suitable polymerases are described in Example 5 and include KOD polymerase (710864, ​​Sigma Aldrich), KOD Xtreme polymerase (719753, Sigma Aldrich), and Deep Vent polymerase (M0258, NEB). Many other polymerases are available, for example, from commercial sources. Other polymerases can be used, provided they incorporate the chemically modified nucleotides with sufficiently high efficiency.

[0708] Chemically modified dsDNA molecules can also be produced without resorting to polymerase chain reactions. For example, direct chemical synthesis can be used.

[0709] Chemically modified dsDNA molecules can be produced by providing dsDNA molecules and chemically modifying the nucleotides of the dsDNA molecules. For example, dsDNA molecules can be contacted with an enzyme to produce chemically modified dsDNA molecules. In some embodiments, the enzyme is a chemically modified cytosine enzyme, such as a 5-mC methyltransferase or a 5-hmC glycosyltransferase (e.g., Zymo Research, E2026). In some embodiments, the enzyme converts unmodified nucleotides into chemically modified nucleotides. In some embodiments, the enzyme converts chemically modified nucleotides into nucleotides with different modifications.

[0710] In some embodiments, dsDNA molecules, such as those described herein, including dsDNA molecules containing chemically modified cytosine nucleotides with substitutions other than hydrogen at carbon 5 of cytosine, are generated from plasmids assembled to contain the desired elements described herein. In some embodiments, the plasmid template comprises a promoter sequence (e.g., the Ef1a promoter sequence), an effector sequence (e.g., a sequence encoding a model / marker protein, such as a sequence encoding mCherry), an enhancer sequence (e.g., the SV40 enhancer sequence), a maintenance sequence (e.g., a sequence from human interferon-βMAR), and / or a second-strand motif (e.g., a sequence from the AAV2 wild-type ITR). The plasmid template can be designed using standard DNA design manipulation software. Once designed, the plasmid can be ordered from a commercial vendor (GenScript). In some embodiments, the plasmid template is used as a template for PCR amplification.

[0711] In some embodiments, purification involves the reduction of one or more contaminants, such as partial or complete reduction.

[0712] Pharmaceutical Composition

[0713] This disclosure includes dsDNA molecules (e.g., TDSC) and related compositions in combination with one or more pharmaceutically acceptable excipients and / or carriers.

[0714] The pharmaceutical composition may optionally contain one or more additional active substances, such as therapeutic and / or preventative active substances. The pharmaceutical compositions of the present invention are generally sterile and / or pyrogen-free.

[0715] The dsDNA molecules described herein can be formulated without a carrier; for example, the dsDNA molecules described herein can be administered "naked" to host cells, tissues, or subjects. Naked formulations may contain pharmaceutical excipients or diluents but lack a carrier.

[0716] Pharmaceutically acceptable excipients or diluents may contain inactive substances used as a medium or agent in the compositions described herein, such as any inactive ingredient approved by the United States Food and Drug Administration (FDA) and listed in the Inactive Ingredient Data, which is incorporated herein by reference. Non-limiting examples of pharmaceutically acceptable excipients or diluents include solvents, aqueous solvents, non-aqueous solvents, tension agents, dispersion media, cryoprotectants, diluents, suspending agents, surfactants, isotonic agents, thickeners, emulsifiers, preservatives, hyaluronidase, dispersants, lubricants, granulators, disintegrants, binders, antioxidants, buffers (e.g., phosphate-buffered saline (PBS)), lubricating agents, oils, and mixtures thereof.

[0717] General considerations in the formulation and / or production of pharmaceutical preparations can be found in the following literature: e.g., Remington: The Science and Practice of Pharmacy, 21st edition, Lippincott Williams & Wilkins, 2005 (incorporated hereby by reference).

[0718] Carrier

[0719] The dsDNA molecules described herein (e.g., TDSCs) can also be formulated together with or contained within a carrier. General considerations for carrier and drug delivery can be found, for example, in the following: Delivery Technologies for Biopharmaceuticals:Peptides,Proteins,Nucleic Acids and Vaccines[Delivery Technologies for Biopharmaceuticals: Peptides, Proteins, Nucleic Acids, and Vaccines] (Lene Jorgensen and Hanne Morck Nielson, eds.) Wiley; 1st ed. (December 21, 2009); and Vargason et al. 2021. Nat Biomed Eng. 5, 951–967.

[0720] Non-limiting examples of carriers include carbohydrate carriers (e.g., anhydride-modified plant glycogen or glycoprototype materials, GalNAc), nanoparticles (e.g., nanoparticles encapsulated or covalently linked to dsDNA molecules, gold nanoparticles, silica nanoparticles), lipid particles (e.g., liposomes, lipid nanoparticles), cationic carriers (e.g., cationic lipid polymers or transfection reagents), fusosomes, anucleate cells (e.g., in vitro differentiated reticulocytes), nucleated cells, exosomes, protein carriers (e.g., proteins covalently linked to dsDNA molecules), peptides (e.g., cell-penetrating peptides), materials (e.g., graphene oxide), single pure lipids (e.g., cholesterol), and DNA origami (e.g., DNA tetrahedrons).

[0721] In one embodiment, the dsDNA molecular compositions, constructs, and systems described herein can be formulated in liposomes or other similar vesicles. Liposomes are globular vesicular structures consisting of a single or multiple lipid bilayer surrounding an internal aqueous compartment and a relatively impermeable outer lipophilic phospholipid bilayer. Liposomes can be anionic, neutral, or cationic. Liposomes are biocompatible, non-toxic, capable of delivering both hydrophilic and lipophilic drug molecules, protecting their cargo from degradation by plasma enzymes, and transporting their load across biological membranes and the blood-brain barrier (BBB) ​​(for reviews, see, e.g., Spuch and Navarro, Journal of Drug Delivery, Vol. 2011, Article ID 469679, p. 12, 2011. doi:10.1155 / 2011 / 469679).

[0722] Vesicles can be made from several different types of lipids; however, phospholipids are most commonly used to generate liposomes as drug carriers. Methods for preparing multilayered vesicular lipids are known in the art (see, for example, U.S. Patent No. 6,693,086, the teachings of which pertain to the preparation of multilayered vesicular lipids are incorporated herein by reference). Although vesicle formation can be spontaneous when the lipid membrane is mixed with an aqueous solution, it can also be accelerated by applying force in an oscillatory manner using a homogenizer, sonicator, or extrusion device (for a review, see, for example, Spuch and Navarro, Journal of Drug Delivery, Vol. 2011, Article ID 469679, p. 12, 2011. doi:10.1155 / 2011 / 469679). Extruded lipids can be prepared by extruding through a filter with reduced size, as described by Templeton et al., Nature Biotech, 15:647-652, 1997, the teachings of which on the preparation of extruded lipids are incorporated herein by reference.

[0723] Exosomes can also be used as drug delivery mediators for the compositions and systems described herein. For a review, see Ha et al., July 2016. Acta Pharmaceutica Sinica B, Vol. 6, No. 4, pp. 287-296; https: / / doi.org / 10.1016 / j.apsb.2016.02.001.

[0724] Differentiated red blood cells can also be used as carriers for the reagents described herein (e.g., dsDNA molecules, such as TDSC). See, for example, WO 2015073587; WO 2017123646; WO 2017123644; WO 2018102740; WO2016183482; WO 2015153102; WO 2018151829; WO 2018009838; Shi et al. 2014. Proc NatlAcad Sci USA. [Proceedings of the National Academy of Sciences of the United States of America] 111(28):10131–10136; U.S. Patent 9,644,180; Huang et al. 2017. Nature Communications 8:423; Shi et al. 2014. Proc NatlAcad Sci USA. [Proceedings of the National Academy of Sciences of the United States of America] 111(28):10131–10136.

[0725] For example, the fusion composition described in WO 2018208728 can also be used as a carrier to deliver the dsDNA molecules described herein.

[0726] Lipid nanoparticles:

[0727] Lipid nanoparticles (LNPs) are carriers made of ionizable lipids. LNPs are taken up by cells via endocytosis, and their properties allow endosome escape, thereby allowing the cargo to be released into the cytoplasm of target cells. In addition to ionizable lipids, LNPs may also contain helper lipids that promote cell binding, cholesterol to fill the gaps between lipids, and / or polyethylene glycol (PEG) to reduce serum protein opsonization and reticuloendothelial clearance. In some embodiments, lipid nanoparticles comprise one or more ionic lipids, such as non-cationic lipids (e.g., neutral or anionic or zwitterionic lipids); one or more conjugated lipids (such as PEG-conjugated lipids or lipids conjugated to polymers as described in Table 5 of WO 2019217941; which is incorporated herein by reference in its entirety); one or more sterols (e.g., cholesterol); and, optionally, one or more targeting molecules (e.g., conjugated receptors, receptor ligands, antibodies); or combinations thereof.

[0728] Lipids that can be used to form nanoparticles (e.g., lipid nanoparticles) include, for example, those described in Table 4 of WO 2019217941, which are incorporated herein by reference. For example, lipid-containing nanoparticles may contain one or more lipids as described in Table 4 of WO 2019217941. Lipid nanoparticles may include additional elements, such as polymers, as described in Table 5 of WO 2019217941, which are incorporated herein by reference.

[0729] In some embodiments, the conjugated lipids, when present, may include one or more of the following: PEG-diacylglycerol (DAG) (such as 1-(monomethoxy-polyethylene glycol)-2,3-dimyristoylglycerol (PEG-DMG)), PEG-dialkoxypropyl (DAA), PEG-phospholipids, PEG-ceramide (Cer), polyethylene glycolated phosphatidylethanolamine (PEG-PE), PEG-succinate diacylglycerol (PEGS-DAG) (such as 4-O-(2',3'-di(tetradecanoyloxy)propyl-1-O-(w-methoxy(polyethoxy)ethyl)succinate (PEG-S-DMG)), PEG-dialkoxypropylcarbamate, N-(carbonyl-methoxy-polyethylene glycol 2000)-1,2-distearate-sn-glycerol-3-phosphate ethanolamine sodium salt, and those described in Table 2 of WO 2019051289 (incorporated by reference) and combinations thereof.

[0730] In some embodiments, the sterols that can be incorporated into the lipid nanoparticles include one or more of cholesterol or cholesterol derivatives, such as those cited in WO2009 / 127060 or US2010 / 0130588, which are incorporated herein by reference. Other exemplary sterols include phytosterols, including those described in Eygeris et al. (2020), dx.doi.org / 10.1021 / acs.nanolett.0c01386, which are incorporated herein by reference.

[0731] In some embodiments, the lipid particles comprise ionizable lipids, noncationic lipids, conjugated lipids that inhibit particle aggregation, and sterols. The amounts of these components can be varied independently to obtain desired properties. For example, in some embodiments, the lipid nanoparticles comprise: ionizable lipids in an amount of about 20 mol% to about 90 mol% of total lipids (in other embodiments, it may be 20-70%, 30-60%, or 40-50% (mol); about 50 mol% to about 90 mol% of total lipids present in the lipid nanoparticles); noncationic lipids in an amount of about 5 mol% to about 30 mol% of total lipids; conjugated lipids in an amount of about 0.5 mol% to about 20 mol% of total lipids; and sterols in an amount of about 20 mol% to about 50 mol% of total lipids. The ratio of total lipids to nucleic acids can be varied as needed. For example, the ratio of total lipids to nucleic acids (by mass or weight) can be about 10:1 to about 30:1.

[0732] In some embodiments, the lipid to nucleic acid ratio (mass / mass ratio; w / w ratio) may be in the range of about 1:1 to about 25:1, about 10:1 to about 14:1, about 3:1 to about 15:1, about 4:1 to about 10:1, about 5:1 to about 9:1, or about 6:1 to about 9:1. The amounts of lipids and nucleic acids can be adjusted to provide a desired N / P ratio, such as 3, 4, 5, 6, 7, 8, 9, 10, or higher. Typically, the total lipid content of lipid nanoparticle formulations may be in the range of about 5 mg / mL to about 30 mg / mL.

[0733] Some non-limiting examples of lipid compounds that can be used (e.g., in combination with other lipid components) to form lipid nanoparticles for delivering the compositions described herein, such as the nucleic acids described herein, include:

[0734]

[0735] In some embodiments, the LNP comprising formula (i) is used to deliver the DNA composition described herein to the liver and / or hepatocytes.

[0736]

[0737] In some embodiments, the LNP comprising formula (ii) is used to deliver the DNA composition described herein to the liver and / or hepatocytes.

[0738]

[0739] In some embodiments, the LNP comprising formula (iii) is used to deliver the DNA composition described herein to the liver and / or hepatocytes.

[0740]

[0741] In some embodiments, the LNP comprising formula (v) is used to deliver the DNA composition described herein to the liver and / or hepatocytes.

[0742]

[0743] In some embodiments, the LNP of formula (vi) is used to deliver the DNA composition described herein to the liver and / or hepatocytes.

[0744]

[0745] In some embodiments, the LNP comprising formula vii or (viii) is used to deliver the DNA composition described herein to the liver and / or hepatocytes.

[0746]

[0747] In some embodiments, the LNP of formula (ix) is used to deliver the DNA composition described herein to the liver and / or hepatocytes.

[0748] In some embodiments, the LNP comprising formula (x) is used to deliver the DNA composition described herein to the liver and / or hepatocytes:

[0749]

[0750] in

[0751] X 1 It is O, NR 1 Or press the key directly, X 2 It is a C2-5 alkylene group, X 3 It is a C (=O) or direct bond, R 1 Is it H or Me, R? 3 It is a Ci-3 alkyl group, R 2 It is a Ci-3 alkyl group, or R 2 With the nitrogen atom and X attached to it 2 One to three carbon atoms together form a 4-, 5-, or 6-membered ring, or X 1 It is NR1 R 1 and R 2 Together with the nitrogen atom to which they are attached, they form a 5- or 6-membered ring, or R 2 With R 3 Together with the nitrogen atom to which they are attached, they form a 5-, 6-, or 7-membered ring, Y 1 is a C2-12 alkylene group, Y 2 Selected from

[0752]

[0753] n is 0 to 3, R 4 is a C15 alkyl group, Z 1 It is a Ci-6 alkylene or a direct bond, Z 2 yes

[0754] (in either orientation) or not present, provided that if Z 1 is a direct key, then Z 2 does not exist;

[0755] R 5 is C5-9 alkyl or C6-10 alkoxy, R 6 is a C5-9 alkyl group or a C6-10 alkoxy group, W is a methylene group or a direct bond, and R 7 is H or Me, or a salt thereof, provided that if R 3 and R 2 is a C2 alkyl group, X 1 It's O, X 2 is a straight chain C3 alkylene, X 3 is C(=0), Y 1 is a straight chain Ce alkylene group, (Y 2 )nR 4 yes

[0756] R 4 is a straight chain C5 alkyl group, Z 1 is C2 alkylene, Z 2 does not exist, W is methylene, and R 7 is H, then R 5 and R 6 Not a Cx alkoxy group.

[0757]

[0758] In some embodiments, the LNP of formula (xi) is used to deliver the DNA composition described herein to the liver and / or hepatocytes.

[0759] In some embodiments, the LNP of formula (xii) is used to deliver the DNA composition described herein to the liver and / or hepatocytes.

[0760]

[0761] In some embodiments, the LNP comprises a compound of formula (xiii) and a compound of formula (xiv).

[0762]

[0763] In some embodiments, the LNP of formula (xv) is used to deliver the DNA composition described herein to the liver and / or hepatocytes.

[0764]

[0765] In some embodiments, the LNP of the formulation containing (xvi) is used to deliver the DNA composition described herein to lung endothelial cells.

[0766] In some embodiments, an LNP comprising a formulation of formula (xvii), (xviii), or (xix) is used to deliver the DNA composition described herein to lung endothelial cells.

[0767]

[0768] In some embodiments, the lipid compound for forming lipid nanoparticles for delivering the compositions described herein (e.g., the nucleic acids described herein) is prepared by one of the following reactions:

[0769]

[0770] In some embodiments, the compositions described herein (e.g., nucleic acids or proteins) are provided in an LNP comprising an ionizable lipid. In some embodiments, the ionizable lipid is heptadecan-9-yl 8-((2-hydroxyethyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate (SM-102); for example, as described in Example 1 of US 9,867,888 (incorporated herein by reference in its entirety). In some embodiments, the ionizable lipid is 9Z,12Z)-3-((4,4-bis(octyloxy)butyryl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl octadec-9,12-dienoate (LP01), for example, synthesized in Example 13 of WO 2015 / 095340 (incorporated herein by reference in its entirety). In some embodiments, the ionizable lipid is 9-((4-dimethylamino)butyryl)oxy)heptadecanedioic acid di((Z)-non-2-en-1-yl) ester (L319), synthesized, for example, in Examples 7, 8, or 9 of US2012 / 0027803 (incorporated herein by reference in its entirety). In some embodiments, the ionizable lipid is 1,1'-((2-(4-(2-((2-(bis(2-hydroxydodecyl)amino)ethyl)(2-hydroxydodecyl)amino)ethyl)piperazin-1-yl)ethyl)azanediyl)bis(dodecyl-2-ol) (C12-200), synthesized, for example, in Examples 14 and 16 of WO 2010 / 053572 (incorporated herein by reference in its entirety). In some embodiments, the ionizable lipid is an imidazole cholesterol ester (ICE) lipid (3S,10R,13R,17R)-10,13-dimethyl-17-((R)-6-methylhept-2-yl)-2,3,4,7,8,9,10,11,12,13,14,15,16,17-tetradecano-1H-cyclopenten[a]phenanthrene-3-yl 3-(1H-imidazol-4-yl)propionate, for example, from the structure (I) of WO 2020 / 106946 (which is incorporated herein by reference in its entirety).

[0771] In some embodiments, the ionizable lipid may be a cationic lipid, an ionizable cationic lipid, such as a cationic lipid that exists in a positively charged or neutral form depending on pH, or an amine-containing lipid that can be readily ionized. In some embodiments, the cationic lipid is, for example, a lipid capable of carrying a positive charge under physiological conditions. Exemplary cationic lipids include one or more positively charged amine groups. In some embodiments, the lipid particles comprise a cationic lipid formulated with one or more of neutral lipids, ionizable amine-containing lipids, biodegradable alkyne lipids, steroids, phospholipids including polyunsaturated lipids, structural lipids (e.g., sterols), PEG, cholesterol, and polymer-conjugated lipids. In some embodiments, the cationic lipid may be an ionizable cationic lipid. Exemplary cationic lipids as disclosed herein may have an effective pKa greater than 6.0. In embodiments, the lipid nanoparticles may comprise a second cationic lipid having an effective pKa different from that of the first cationic lipid (e.g., greater than the first effective pKa). The lipid nanoparticles may comprise 40 mol% to 60 mol% of cationic lipids, neutral lipids, steroids, polymer-conjugated lipids, and therapeutic agents (e.g., nucleic acids as described herein) encapsulated within or associated with the lipid nanoparticles. In some embodiments, the nucleic acid is co-formulated with the cationic lipid. The nucleic acid may adsorb onto the surface of the LNP (e.g., an LNP containing cationic lipids). In some embodiments, the nucleic acid may be encapsulated within the LNP (e.g., an LNP containing cationic lipids). In some embodiments, the lipid nanoparticles may include a targeting portion, such as a targeting portion coated with a targeting agent. In embodiments, the LNP formulation is biodegradable. In some embodiments, lipid nanoparticles comprising one or more lipids described herein (e.g., formula (i), (ii), (ii), (vii), and / or (ix)) encapsulate at least 1%, at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 92%, at least 95%, at least 97%, at least 98%, or 100% of the dsDNA molecules described herein.

[0772] Exemplary ionizable lipids that can be used in lipid nanoparticle formulations include, but are not limited to, those listed in Table 1 of WO 2019051289, which is incorporated herein by reference. Other exemplary lipids include, but are not limited to, one or more of the following: X of US2016 / 0311759; I of US20150376115 or US2016 / 0376224; I, II, or III of US20160151284; I, IA, II, or IIA of US20170210967; Ic of US20150140070; A of US2013 / 0178541; I of US2013 / 0303587 or US2013 / 0123338; ​​I of US2015 / 0141678; II, III, IV, or V of US2015 / 0239926; I of US2017 / 0119904; WO US2017 / 117528, Part I or II; US2012 / 0149894, Part A; US2015 / 0057373, Part A; WO 2013 / 116126, Part A; US2013 / 0090372, Part A; US2013 / 0274523, Part A; US2013 / 0274504, Part A; US2013 / 0053572, Part A; WO2013 / 016058, Part A; WO2012 / 162210, Part A; US2008 / 042973, Part I; US2012 / 01287670, Parts I, II, and III Or IV; I or II of US2014 / 0200257; I, II or III of US2015 / 0203446; I or III of US2015 / 0005363; I, IA, IB, IC, ID, II, IIA, IIB, IIC, IID or III-XXIV of US2014 / 0308304; of US2013 / 0338210; WO2009 / 13213 1. I, II, III, or IV; A of US2012 / 01011478; I or XXXV of US2012 / 0027796; XIV or XVII of US2012 / 0058144; of US2013 / 0323269; I of US2011 / 0117125; I, II, or III of US2011 / 0256175; I or II of US2012 / 0202871 III, IV, V, VI, VII, VIII, IX, X, XI, XII; I, II, III, IV, V, VI, VII, VIII, X, XII, XIII, XIV, XV or XVI of US2011 / 0076335; I or II of US2006 / 008378; I of US2013 / 0123338; ​​I of US2015 / 0064242 or XAYZ;US2013 / 0022649, XVI, XVII, or XVIII; US2013 / 0116307, I, II, or III; US2013 / 0116307, I, II, or III; US2010 / 0062967, I or II; US2013 / 0189351, IX; US2014 / 0039032, I; US2018 / 0028664, V; US2016 / 0317458, I; US2013 / 0195920, I; US10,221,127, 5, 6, or 10; WO 2018 / 081480, III-3; WO I-5 or I-8 of US 2020 / 081938; 18 or 25 of US 9,867,888; A of US 2019 / 0136231; II of WO 2020 / 219876; 1 of US 2012 / 0027803; OF-02 of US 2019 / 0240349; 23 of US 10,086,013; cKK-E12 / A6 of Miao et al. (2020); C12-200 of WO 2010 / 053572; 7C1 of Dahlman et al. (2017); 304-O13 or 503-O13 of Whitehead et al.; TS-P4C2 of US 9,708,628; I of WO 2020 / 106946; WO I of 2020 / 106946. ;

[0773] In some embodiments, the ionizable lipid is MC3(6Z,9Z,28Z,31Z)-heptadecane-6,9,28,31-tetraen-19-yl-4-(dimethylamino)butyrate (DLin-MC3-DMA or MC3), for example, as described in Example 9 of WO 2019051289A9 (incorporated herein by reference in its entirety). In some embodiments, the ionizable lipid is lipid ATX-002, for example, as described in Example 10 of WO 2019051289A9 (incorporated herein by reference in its entirety). In some embodiments, the ionizable lipid is (13Z,16Z)-A,A-dimethyl-3-nonyldocodi-13,16-dien-1-amine (compound 32), for example, as described in Example 11 of WO 2019051289A9 (incorporated herein by reference in its entirety). In some embodiments, the ionizable lipid is compound 6 or compound 22, for example, as described in Example 12 of WO 2019051289A9 (which is incorporated herein by reference in its entirety).

[0774] Exemplary non-cationic lipids include, but are not limited to, distearyl-sn-glycero-ethanolamine phosphate, distearylphosphatidylcholine (DSPC), dioleoylphosphatidylcholine (DOPC), dipalmitoylphosphatidylcholine (DPPC), dioleoylphosphatidylcholine (DOPG), dipalmitoylphosphatidylglycerol (DPPG), dioleoylphosphatidylethanolamine (DOPE), palmitoylphosphatidylcholine (POPC), palmitoylphosphatidylethanolamine (POPE), dioleoylphosphatidylethanolamine 4-(N-maleimidemethyl)-cyclohexane-1-carboxylic acid ester (DOPE-mal), dipalmitoylphosphatidylethanolamine (DPPE), dimyristoylphosphatidyl phosphate ethanolamine (DMPE), distearyl-phosphatidyl-ethanolamine (DSPE), monomethyl-phosphatidylethanolamine (such as 16-O-monomethylPE), dimethyl-phosphatidylethanolamine (such as 16- O-dimethyl PE), l8-l-trans PE, l-stearoyl-2-oleoyl-phosphatidylethanolamine (SOPE), hydrogenated soybean phosphatidylcholine (HSPC), lecithin choline (EPC), dioleoylphosphatidylserine (DOPS), sphingomyelin (SM), dimyristoylphosphatidylcholine (DMPC), dimyristoylphosphatidylglycerol (DMPG), distearate phosphatidylglycerol (DSPG), disqualylphosphatidylcholine (DEPC), palmitoyloleoylphosphatidylglycerol (POPG), ditransolenoyl-phosphatidylethanolamine (DEPE), lecithin, phosphatidylethanolamine, lysophosphatidyl lecithin, lysophosphatidylethanolamine, phosphatidylserine, phosphatidylinositol, sphingomyelin, lecithin (ESM), cephalin, cardiolipin, phosphatidic acid, cerebroside, dihexadecosyl phosphate, lysophosphatidylcholine, dilinoleoylphosphatidylcholine or mixtures thereof. It should be understood that other diacylphosphatidylcholine and diacylphosphatidylethanolamine phospholipids may also be used. The acyl groups in these lipids are preferably derived from fatty acids having a C10-C24 carbon chain, such as lauroyl, myristyl, palmitoyl, stearoyl, or oleoyl. In some embodiments, additional exemplary lipids include, but are not limited to, those described by Kim et al. (2020) dx.doi.org / 10.1021 / acs.nanolett.0c01386, which is incorporated herein by reference. In some embodiments, such lipids include plant lipids (e.g., DGTS) found to improve liver transfection with mRNA.

[0775] Other examples of noncationic lipids suitable for use in lipid nanoparticles include, but are not limited to, nonphospholipids such as stearylamine, dodecylamine, hexadecylamine, acetyl palmitate, glyceryl ricinoleate, hexadecyl stearate, isopropyl myristate, amphoteric acrylic polymers, triethanolamine-lauryl sulfate, alkyl-aryl sulfates, polyethoxylated fatty acid amides, dioctadecyl dimethyl ammonium bromide, ceramides, sphingomyelin, etc. Other noncationic lipids are described in WO2017 / 099823 or US Patent Publication US2018 / 0028664, the contents of which are incorporated herein by reference in their entirety.

[0776] In some embodiments, the noncationic lipid is oleic acid or a compound of formula I, II, or IV of US2018 / 0028664, which is incorporated herein by reference in its entirety. The noncationic lipid may comprise, for example, 0-30% (mol) of the total lipids present in the lipid nanoparticles. In some embodiments, the noncationic lipid content is 5%-20% (mol) or 10%-15% (mol) of the total lipids present in the lipid nanoparticles. In embodiments, the molar ratio of ionizable lipids to neutral lipids is from about 2:1 to about 8:1 (e.g., about 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, or 8:1).

[0777] In some embodiments, the lipid nanoparticles do not comprise any phospholipids.

[0778] In some aspects, lipid nanoparticles may further include components such as sterols to provide membrane integrity. An exemplary sterol that can be used in lipid nanoparticles is cholesterol and its derivatives. Non-limiting examples of cholesterol derivatives include polar analogs such as 5α-cholesterol, 53-costanol, cholesterol-(2'-hydroxy)-ethyl ether, cholesterol-(4'-hydroxy)-butyl ether, and 6-ketocholesterol; nonpolar analogs such as 5α-cholesterol, cholesterolenone, 5α-cholesterone, 5p-cholesterone, and cholesterol decanoate; and mixtures thereof. In some embodiments, the cholesterol derivative is a polar analog, for example, cholesterol-(4'-hydroxy)-butyl ether. Exemplary cholesterol derivatives are described in PCT Publication WO2009 / 127060 and U.S. Patent Publication US2010 / 0130588, each of which is incorporated herein by reference in its entirety.

[0779] In some embodiments, a component providing membrane integrity, such as sterols, may comprise 0-50% (mol) of the total lipids present in the lipid nanoparticles (e.g., 0-10%, 10%-20%, 20%-30%, 30%-40%, or 40%-50%). In some embodiments, such a component may comprise 20%-50% (mol) or 30%-40% (mol) of the total lipid content of the lipid nanoparticles.

[0780] In certain embodiments, lipid nanoparticles can include polyethylene glycol (PEG) or a lipid molecule that is put together. Typically, these are used to suppress the aggregation of lipid nanoparticles and / or provide spatial stabilization. Exemplary put together lipids include but are not limited to PEG-lipid conjugates, polyoxazoline (POZ)-lipid conjugates, polyamide-lipid conjugates (such as ATTA-lipid conjugates), cationic polymer lipid (CPL) conjugates and mixtures thereof. In certain embodiments, put together lipid molecule is PEG-lipid conjugates, for example (methoxy polyethylene glycol) put together lipid.

[0781] Exemplary PEG-lipid conjugates include, but are not limited to, PEG-diacylglycerol (DAG) (such as 1-(monomethoxy-polyethylene glycol)-2,3-dimyristoylglycerol (PEG-DMG)), PEG-dialkoxypropyl (DAA), PEG-phospholipids, PEG-ceramides (Cer), polyethylene glycol-modified phosphatidylethanolamine (PEG-PE), PEG-succinate diacylglycerol (PEGS-DAG) (such as 4-O-(2',3'-di(tetradecanoyloxy)propyl-1-O-(w-methoxy(polyethoxy)ethyl)succinate (PEG-S-DMG)), PEG-dialkoxypropylcarbamate, N-(carbonyl-methoxy-polyethylene glycol 20... 00)-1,2-distearate-sn-glycerol-3-phosphate ethanolamine sodium salt or mixtures thereof. Other exemplary PEG-lipid conjugates are described, for example, in US5,885,613, US6,287,591, US2003 / 0077829, US2003 / 0077829, US2005 / 0175682, US2008 / 0020058, US2011 / 0117125, US2010 / 0130588, US2016 / 0376224, US2017 / 0119904 and US / 099823, all of which are incorporated herein by reference in their entirety. In some embodiments, PEG-lipid... The substance is a compound of formula III, III-aI, III-a-2, III-b-1, III-b-2 or V of US2018 / 0028664, the contents of which are incorporated herein by reference in their entirety. In some embodiments, the PEG-lipid has formula II of US20150376115 or US2016 / 0376224, the contents of which are incorporated herein by reference in their entirety. In some embodiments, the PEG-DAA conjugate may be, for example, PEG-dilauryloxypropyl, PEG-dimyristyloxypropyl, PEG-dispalmityloxypropyl or PEG-distearateloxypropyl. The PEG-lipid may be one or more of the following: PEG-D MG, PEG-dilaurylglycerol, PEG-dipalmitoylglycerol, PEG-distearatelglycerol, PEG-dilaurylglycerol esteramide, PEG-dimyristylglycerol esteramide, PEG-dipalmitoylglycerol esteramide, PEG-distearatelglycerol esteramide, PEG-cholesterol (l-[8'-(cholest-5-en-3[β]-oxy)carbamoyl-3',6'-dioxaoctyl]carbamoyl-[ω]-methyl-poly(ethylene glycol)), PEG-DMB (3,4-bistetradecoxybenzyl-[ω]-methyl-poly(ethylene glycol) ether) and 1,2-dimyristoyl-sn-glycerol-3-phosphate ethanolamine-N-[methoxy(polyethylene glycol)-2000].In some embodiments, the PEG-lipid comprises PEG-DMG, 1,2-dimyristoyl-sn-glycerol-3-phosphoethanolamine-N-[methoxy(polyethylene glycol)-2000]. In some embodiments, the PEG-lipid comprises a structure selected from the following:

[0782]

[0783] In some embodiments, lipids conjugated to molecules other than PEG can also be used in place of PEG-lipids. For example, polyoxazoline (POZ)-lipid conjugates, polyamide-lipid conjugates (such as ATTA-lipid conjugates), and cationic polymer lipid (GPL) conjugates can be used in place of PEG-lipids or in combination with PEG-lipids.

[0784] Exemplary conjugated lipids, namely PEG-lipids, (POZ)-lipid conjugates, ATTA-lipid conjugates, and cationic polymer-lipids, are described in the PCT and LIS patent applications listed in Table 2 of WO 2019051289 A9, all of which are incorporated herein by reference in their entirety.

[0785] In some embodiments, PEG or conjugated lipids may comprise 0-20% (mol) of the total lipids present in the lipid nanoparticles. In some embodiments, the content of PEG or conjugated lipids is 0.5%-10% or 2%-5% (mol) of the total lipids present in the lipid nanoparticles. The molar ratio of ionizable lipids, noncationic lipids, sterols, and PEG / conjugated lipids can be varied as needed. For example, the lipid particles may comprise 30%-70% ionizable lipids by molar weight or total weight of the composition, 0-60% cholesterol by molar weight or total weight of the composition, 0-30% noncationic lipids by molar weight or total weight of the composition, and 1%-10% conjugated lipids by molar weight or total weight of the composition. Preferably, the composition comprises 30%-40% ionizable lipids by molar weight or total weight of the composition, 40%-50% cholesterol by molar weight or total weight of the composition, and 10%-20% noncationic lipids by molar weight or total weight of the composition. In some other embodiments, the composition comprises 50%-75% by molar or total weight of ionizable lipids, 20%-40% by molar or total weight of cholesterol, 5%-10% by molar or total weight of noncationic lipids, and 1%-10% by molar or total weight of conjugated lipids. The composition may contain 60%-70% by molar or total weight of ionizable lipids, 25%-35% by molar or total weight of cholesterol, and 5%-10% by molar or total weight of noncationic lipids. The composition may also contain up to 90% by molar or total weight of ionizable lipids and 2%-15% by molar or total weight of noncationic lipids.The formulation can also be a lipid nanoparticle formulation, for example comprising 8%-30% ionizable lipid by mole or total weight of the composition, 5%-30% non-cationic lipid by mole or total weight of the composition, and 0-20% cholesterol by mole or total weight of the composition; 4%-25% ionizable lipid by mole or total weight of the composition, 4%-25% non-cationic lipid by mole or total weight of the composition, 2% to 25% cholesterol by mole or total weight of the composition, 10% to 35% conjugated lipid by mole or total weight of the composition, and 0% to 20% cholesterol by mole or total weight of the composition. 5% cholesterol; or 2%-30% ionizable lipids, 2%-30% non-cationic lipids, 1%-15% cholesterol, 2%-35% conjugated lipids, and 1%-20% cholesterol; or up to 90% ionizable lipids and 2%-10% non-cationic lipids, or up to 100% cationic lipids, by molar ratio of 50:10:38.5:1.5. In some other embodiments, the lipid particle formulation comprises ionizable lipids, phospholipids, cholesterol, and polyethylene glycol-modified lipids in a molar ratio of 60:38.5:1.5.

[0786] In some embodiments, the lipid particles comprise an ionizable lipid, a non-cationic lipid (e.g., a phospholipid), a sterol (e.g., cholesterol), and a PEGylated lipid, wherein the lipid molar ratio of the ionizable lipid is in the range of 20 to 70 mol%, with a target of 40-60 mol%, the molar percentage of the non-cationic lipid is in the range of 0 to 30 mol%, with a target of 0 to 15 mol%, the molar percentage of the sterol is in the range of 20 to 70 mol%, with a target of 30 to 50 mol%, and the molar percentage of the PEGylated lipid is in the range of 1 to 6 mol%, with a target of 2 to 5 mol%.

[0787] In some embodiments, the lipid particles comprise ionizable lipids / non-cationic lipids / sterols / conjugated lipids in a molar ratio of 50:10:38.5:1.5.

[0788] In one aspect, this disclosure provides formulations of lipid nanoparticles comprising phospholipids, lecithin, phosphatidylcholine, and phosphatidylethanolamine.

[0789] In some embodiments, one or more additional compounds may also be included. Those compounds may be administered alone, or additional compounds may be included in the lipid nanoparticles of the present invention. In other words, in addition to the nucleic acid or at least the second nucleic acid, the lipid nanoparticles may contain other compounds that are different from the first nucleic acid. In a non-limiting manner, other additional compounds may be selected from the group consisting of: small or large organic or inorganic molecules, monosaccharides, disaccharides, trisaccharides, oligosaccharides, polysaccharides, peptides, proteins, peptide analogs and derivatives thereof, peptide mimetics, nucleic acids, nucleic acid analogs and derivatives, extracts made from biological materials, or any combination thereof.

[0790] In some embodiments, LNPs are directed to specific tissues by adding a targeting domain. For example, a biological ligand can be displayed on the surface of the LNP to enhance interaction with cells displaying the homologous receptor, thereby promoting association with and delivery of the carrier to the tissue where the cell expresses the receptor. In some embodiments, the biological ligand can be a ligand that drives delivery to the liver, for example, an LNP displaying GalNAc prompts delivery of a nucleic acid carrier to hepatocytes displaying the sialic acid glycoprotein receptor (ASGPR). The work of Akinc et al. Mol Ther [Molecular Therapy] 18(7):1357-1364 (2010) taught the use of trivalent GalNAc ligands conjugated with PEG-lipids (GalNAc-PEG-DSG) to generate ASGPR-dependent LNPs to obtain observable LNP carrier effects (see, for example, Akinc et al. 2010, ibid.). Figure 6Other LNP formulations exhibiting ligands, such as those incorporating folic acid, transferrin, or antibodies, are discussed in WO 2017223135, which is incorporated herein by reference in its entirety, along with the references used therein: Kolhatkar et al., Curr Drug Discov Technol. 2011 8:197-206; Musacchio and Torchilin, Front Biosci. 2011 16:1388-1412; Yu et al., Mol Membr Biol. 2010 27:286-298; Patil et al., Crit Rev Ther Drug Carrier Syst. 2008 25:1-61; Benoit et al., Biomacromolecules. 2011 12:2708-2714; Zhao et al., Expert Opinion on Drug Delivery. 2008 5:309-319; Akinc et al., Mol Ther. 2010 18:1357-1364; Srinivasan et al., Methods in Molecular Biology. 2012 820:105-116; Ben-Arie et al., Methods in Molecular Biology. 2012 757:497-507; Peer 2010 J Control Release. 20:63-68; Peer et al., ProcNatlAcad Sci US A. 2007 104:4095-4100; Kim et al., Methods in Molecular Biology. 2011 721:339-353; Subramanya et al., Mol Ther. 2010 18:2028-2037; Song et al., Nat Biotechnol. 2005 23:709-717; Peer et al., Science. 2008 319:627-630; and Peer and Lieberman, Gene Ther. 2011 18:1127-1133.

[0791] In some embodiments, LNPs are selected for tissue-specific activity by adding Selective Organ Targeting (SORT) molecules to formulations containing conventional components such as ionizable cationic lipids, amphiphilic phospholipids, cholesterol, and polyethylene glycol (PEG). The teachings of Cheng et al. in *Nat Nanotechnol* 15(4):313-320 (2020) demonstrate that the addition of supplemental “SORT” components can precisely alter the in vivo RNA delivery profile and mediate tissue-specific (e.g., lung, liver, spleen) gene delivery and editing, depending on the percentage and biophysical properties of the SORT molecules.

[0792] In some embodiments, the LNP comprises a biodegradable, ionizable lipid. In some embodiments, the LNP comprises (9Z,12Z)-3-((4,4-bis(octyloxy)butyryl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyloctadec-9,12-dienoate, also known as 3-((4,4-bis(octyloxy)butyryl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl(9Z,12Z)-octadec-9,12-dienoate or another ionizable lipid. See, for example, WO 2019 / 067992, WO / 2017 / 173054, WO 2015 / 095340, and WO 2014 / 136086, and the lipids described in the references provided therein. In some embodiments, the terms cationic and ionizable are interchangeable in the context of LNP lipids, eg, where the ionizable lipid is cationic depending on pH.

[0793] In some embodiments, the average LNP diameter of the LNP preparation can be between tens of nm and hundreds of nm, for example, measured by dynamic light scattering (DLS). In some embodiments, the average LNP diameter of the LNP preparation can be from about 40 nm to about 150 nm, such as about 40 nm, 45 nm, 50 nm, 55 nm, 60 nm, 65 nm, 70 nm, 75 nm, 80 nm, 85 nm, 90 nm, 95 nm, 100 nm, 105 nm, 110 nm, 115 nm, 120 nm, 125 nm, 130 nm, 135 nm, 140 nm, 145 nm, or 150 nm. In some embodiments, the average LNP diameter of the LNP formulation may be about 50 nm to about 100 nm, about 50 nm to about 90 nm, about 50 nm to about 80 nm, about 50 nm to about 70 nm, about 50 nm to about 60 nm, about 60 nm to about 100 nm, about 60 nm to about 90 nm, about 60 nm to about 80 nm, about 60 nm to about 70 nm, about 70 nm to about 100 nm, about 70 nm to about 90 nm, about 70 nm to about 80 nm, about 80 nm to about 100 nm, about 80 nm to about 90 nm, or about 90 nm to about 100 nm. In some embodiments, the average LNP diameter of the LNP formulation may be about 70 nm to about 100 nm. In a particular embodiment, the average LNP diameter of the LNP formulation may be about 80 nm. In some embodiments, the average LNP diameter of the LNP formulation may be about 100 nm. In some embodiments, the average LNP diameter of the LNP preparation ranges from about 1 mm to about 500 mm, from about 5 mm to about 200 mm, from about 10 mm to about 100 mm, from about 20 mm to about 80 mm, from about 25 mm to about 60 mm, from about 30 mm to about 55 mm, from about 35 mm to about 50 mm, or from about 38 mm to about 42 mm.

[0794] In some cases, LNPs can be relatively homogeneous. The polydispersity index can be used to indicate the homogeneity of LNPs, such as the particle size distribution of lipid nanoparticles. Small polydispersity indices (e.g., less than 0.3) typically indicate a narrow particle size distribution. The polydispersity index of an LNP can be from about 0 to about 0.25, such as 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.10, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.20, 0.21, 0.22, 0.23, 0.24, or 0.25. In some embodiments, the polydispersity index of an LNP can be from about 0.10 to about 0.20.

[0795] The zeta potential of LNPs can be used to indicate the electrokinetic potential of the composition. In some embodiments, the zeta potential can describe the surface charge of the LNP. Lipid nanoparticles with relatively low charges (positive or negative) are generally desirable because substances with higher charges may interact undesirably with cells, tissues, and other elements in the body. In some embodiments, the zeta potential of the LNP may be about -10mV to about +20mV, about -10mV to about +15mV, about -10mV to about +10mV, about -10mV to about +5mV, about -10mV to about 0mV, about -10mV to about -5mV, about -5mV to about +20mV, about -5mV to about +15mV, about -5mV to about +10mV, about -5mV to about +5mV, about -5mV to about 0mV, about 0mV to about +20mV, about 0mV to about +15mV, about 0mV to about +10mV, about 0mV to about +5mV, about +5mV to about +20mV, about +5mV to about +15mV, or about +5mV to about +10mV.

[0796] Encapsulation efficiency of proteins and / or nucleic acids describes the amount of protein and / or nucleic acid that is encapsulated or otherwise associated with LNPs after preparation, relative to the initial amount provided. Ideally, encapsulation efficiency should be high (e.g., close to 100%). Encapsulation efficiency can be measured, for example, by comparing the amount of protein or nucleic acid in a solution containing lipid nanoparticles before and after cleavage with one or more organic solvents or detergents. Anion exchange resins can be used to measure the amount of free protein or nucleic acid in solution. Fluorescence can be used to measure the amount of free protein and / or nucleic acid in solution. For the lipid nanoparticles described herein, the encapsulation efficiency of proteins and / or nucleic acids can be at least 50%, such as 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%. In some embodiments, the encapsulation efficiency can be at least 80%. In some embodiments, the encapsulation efficiency can be at least 90%. In some embodiments, the encapsulation efficiency may be at least 95%.

[0797] LNPs may optionally contain one or more layers of coating. In some embodiments, LNPs may be formulated in coated capsules, films, or tablets. Capsules, films, or tablets containing the compositions described herein may have any available size, tensile strength, hardness, or density.

[0798] Additional exemplary lipids, formulations, methods, and LNP characterizations are provided by WO 2020061457, which is incorporated herein by reference in its entirety. See also: Hou et al. Lipid nanoparticles for mRNA delivery. Nat Rev Materials (2021). https: / / doi.org / 10.1038 / s41578-021-00358-0.

[0799] In some embodiments, in vitro or ex vivo cell liposome transfection was performed using Lipofectamine MessengerMax (Thermo Fisher) or TransIT-mRNA transfection reagent (Mirus Bio). In some embodiments, LNPs were formulated using a GenVoy_ILM ionizable lipid mixture (Precision NanoSystems). In some embodiments, LNPs were formulated using 2,2-dilinolenic-4-dimethylaminoethyl-[1,3]-dioxolane (DLin-KC2-DMA) or dilinolenic-methyl-4-dimethylaminobutyrate (DLin-MC3-DMA or MC3), the formulation and in vivo use of which are taught in Jayaraman et al., Angew Chem Int Ed Engl [Germany Angewandte Chemie] 51(34):8529-8533 (2012), which is incorporated herein by reference in its entirety.

[0800] Optimized LNP formulations for delivery of CRISPR-Cas systems (e.g., Cas9-gRNARNP, gRNA, Cas9 mRNA) are described in both WO 2019067992 and WO 2019067910, which are incorporated herein by reference.

[0801] Additional specific LNP preparations that can be used to deliver nucleic acids are described in both US8158601 and US8168775, which are incorporated herein by reference, including preparations sold under the name ONPATTRO used in patisiran.

[0802] The following embodiments are envisioned:

[0803] A. A lipid nanoparticle (LNP) comprising a dsDNA molecule (e.g., TDSC) construct, sequence, or composition described herein.

[0804] B. The LNP as described in Example A, which comprises cationic lipids.

[0805] C. The LNP as described in Example B, wherein the cationic lipid has a structure according to the following:

[0806]

[0807]

[0808] D. The LNP as described in any one of Examples A, C, and D, further comprising one or more neutral lipids, such as DSPC, DPPC, DMPC, DOPC, POPC, DOPE, SM, steroids, such as cholesterol, and / or one or more polymer-conjugated lipids, such as PEG-DAG, PEG-PE, PEG-S-DAG, PEG-cer, or PEG dialkoxypropyl carbamate.

[0809] In the embodiments, LNP formulations containing the dsDNA molecules described herein can be surface-modified with targeting effectors to target desired cell types. Such targeting effectors include, for example, cell-specific receptor ligands that bind to target cells; antibodies or other conjugates targeting target cells; centryins; cell-penetrating peptides; and peptides capable of endosome escape (e.g., GALA, KALA). See, for example, Tables 1 and 2 of Tai & Gau, 2017. A review in Adv Drug Deliv Rev. 110-111:157-168.

[0810] In the embodiments, LNP formulations containing the dsDNA molecules described herein may be administered co-administered with an adjuvant, for example, co-delivered in the same formulation as the adjuvant.

[0811] Application route

[0812] Introduce the dsDNA molecules described herein (e.g., TDSC) into cells, tissues, or subjects via any suitable means.

[0813] Administration to target cells or tissues (e.g., in vitro) can be achieved by methods known in the art, such as transfection, transient or stable transfection using reagents (e.g., liposomes, calcium phosphate) or physical means (e.g., electroporation, gene gun, microinjection, microfluidic shearing, cell extrusion). Other methods are described, for example, in Rad et al. 2021. Adv. Mater. [Advanced Materials] 33:2005363, which is incorporated herein by reference.

[0814] It can be administered to subjects (e.g., mammals, such as human subjects) via parenteral routes (e.g., intravenous, intramuscular, intraperitoneal, subcutaneous, or intracranial); via local, transdermal, or percutaneous administration. Other suitable routes include oral, rectal, mucosal, intranasal, inhalation (e.g., via aerosol), oral (e.g., sublingual), vaginal, intrathecal, intraocular, transdermal, intraendothelial, intrauterine (or intraovarian), intrapleural, intracranial, intra-articular, local, and intralymphatic. Direct tissue or organ injection is also included (e.g., to the liver, eye, skeletal muscle, myocardium, diaphragm, muscle, or brain).

[0815] application

[0816] The dsDNA molecules (e.g., TDSCs) described herein can be used for therapeutic or health applications in subjects (e.g., humans or non-human animals). While the description of the pharmaceutical compositions provided herein primarily relates to pharmaceutical compositions suitable for administration to humans, those skilled in the art will understand that such compositions are generally suitable for administration to any other animal. The subject can be any animal, such as a mammal, like a human or a non-human mammal. In examples, the subject is a vertebrate (e.g., a mammal, bird, fish, reptile, or amphibian). In examples, the subject is a human. In examples, the subject in this method is a non-human mammal. In examples, the subject is a non-human mammal, such as a non-human primate (e.g., monkey, ape), an ungulate (e.g., cattle, buffalo, sheep, goats, pigs, camels, llamas, alpacas, deer, horses, donkeys), a carnivore (e.g., dog, cat), a rodent (e.g., rat, mouse), or a rabbit (e.g., rabbit). In one embodiment, the subject is a bird, such as a member of the following bird taxa: Galliformes (e.g., chicken, turkey, pheasant, quail), Anseriformes (e.g., duck, goose), Paleognathea (e.g., ostrich, emu), Columbiformes (e.g., pigeon, wild pigeon), or Psittaciformes (e.g., parrot). In another embodiment, the subject is an invertebrate, such as arthropods (e.g., insects, spiders, crustaceans), nematodes, annelids, worms, or mollusks.

[0817] In some embodiments, the DNA described herein is provided at a dose of about 0.1-100 mg / kg DNA.

[0818] In some embodiments, the dsDNA molecules described herein confer biological effects on host cells, tissues, or subjects, such as the expression of therapeutic peptides, over the following time periods: at least 2, at least 3, at least 4, at least 5, at least 6 days or at least one week; at least 8, at least 9, at least 10, at least 12, at least 14 days or at least two weeks; at least 16, at least 18, at least 20 days or at least 3 weeks; at least 22, at least 24, at least 25, at least 27, at least 28 days or at least one month; at least 2 months, at least 3 months, at least 4 months, at least 5 months, at least 6 months or more; between one week and 6 months, between 1 month and 6 months, or between 3 months and 6 months.

[0819] In some embodiments, the dsDNA molecules described herein confer biological effects on host cells, tissues, or subjects, such as the expression of therapeutic peptides, over a period of time of at least one cell division of the host cell.

[0820] In the embodiments, the dsDNA molecules described herein can be used to deliver effectors, such as those described herein, to cells, tissues, or subjects.

[0821] In the embodiments described herein, the dsDNA molecules can be used to regulate (e.g., increase or decrease) biological parameters in cells, tissues, or subjects. Biological parameters may include an increase or decrease in gene expression of a subject gene in target cells, tissues, or subjects.

[0822] In the embodiments, the dsDNA molecules described herein can be used to treat such cells, tissues, or subjects by administering the dsDNA molecules described herein to cells, tissues, or subjects in need.

[0823] In the embodiments, the dsDNA molecule delivers effectors to cells selected from immune cells (e.g., monocytes), cancer cells, HEK293 cells, hepatocytes, or epidermal cells (e.g., keratinocytes).

[0824] Example

[0825] Table of contents

[0826] Example 1: Preparing dsDNA molecules (e.g., TDSC) using LNPs

[0827] Example 2: Determining exonuclease resistance in dsDNA molecules containing closed ends (e.g., TDSC)

[0828] Example 3: Determining exonuclease resistance in dsDNA molecules (e.g., TDSC) containing open ends (e.g., two open ends).

[0829] Example 4: Design and assembly of plasmid templates for producing double-stranded DNA (dsDNA) molecules

[0830] Example 5: Production of chemically modified dsDNA molecules

[0831] Example 6: Assessment of in vitro reporter gene expression

[0832] Example 7: Assessment of innate immune response in vitro

[0833] Example 8: Quantitative analysis of in vitro DNA chemical modification

[0834] Example 9: Validation of chemically modified DNA sequences in cells

[0835] Example 10: Assessment of in vitro reporter gene expression

[0836] Example 11: Assessment of innate immune response in vitro

[0837] Example 12: Assessment of mutations during dsDNA molecule production

[0838] Example 1: Preparing dsDNA molecules (e.g., TDSC) using LNPs

[0839] This example describes how to formulate constructs prepared as described herein using lipid nanoparticles (LNPs).

[0840] Following the method described by Chen et al. (2012, J Am Chem Soc., Vol. 134, No. 16: 6948-6951), nucleic acid constructs were combined with lipid components using a microfluidic device. Briefly, the microfluidic device was fabricated in polydimethylsiloxane (PDMS) according to a standard photolithography procedure (McDonald & Whitesides. 2002, Accounts Chem Res., Vol. 35, No. 7: 491-499). The lipid components (typically containing cationic lipids, cholesterol, cofactor lipids, polyethylene glycol-modified lipids, and lipids that promote targeted partial conjugation (optional)) were combined and dissolved in 90% ethanol. The nucleic acid constructs were dissolved in a buffer solution. The nucleic acid solution, lipid solution, and phosphate-buffered saline (PBS) were infused into the microfluidic device. Freshly prepared LNPs were dialyzed against PBS buffer using a membrane with a MWCO of 3.5 kD to remove ethanol and exchange the buffer.

[0841] The effective diameter, polydispersity, and zeta potential of the LNP were characterized using dynamic light scattering (DLS) (ZetaPALS, Brookhaven Instruments, NY, 15mW laser, incident beam 676nm); and the LNP was characterized by pyrolysis of the particles and the use of high-sensitivity (HS) and wide-range (BR) Quant-iT according to the manufacturer's protocol (Thermo Fisher Scientific, Q33232). TM The 1X dsDNA assay kit is used to determine the total nucleic acid concentration.

[0842] Example 2: Determining exonuclease resistance in dsDNA molecules containing closed ends (e.g., TDSC)

[0843] This example describes how to test whether a dsDNA molecule (e.g., TDSC) containing closed ends (e.g., an adaptor-ligated linear dsDNA construct) is resistant to exonuclease III (M0206, New England Biolabs Inc.). The TDSC is tested alongside a non-nuclease control. The non-nuclease control contains DNA with the same sequence as the target TDSC, except that it has undergone an adaptor ligation protocol used to add the exonuclease-resistant DNA end form to the TDSC, but no adaptor oligonucleotides are added to the mixture. Add 1 μL of exonuclease III (starting concentration 100 units / μL) / 5 μg DNA to 50 μL. Mix the tube thoroughly and centrifuge. Run the tube on a thermal cycler at 37°C for 1 hour and then heat-inactivate at 70°C for 30 minutes.

[0844] According to the manufacturer's plan, a vacuum manifold is used, through... Purify the sample using the Gel and PCR Purification Kit (Catalogue No. 740609, Macherrey-Nagel). Briefly, heat the elution buffer to 70°C. Add 2x volumes of NTI binding buffer to 1x volume of Exo III-treated DNA. Mix the sample until evenly distributed and incubate at room temperature for 5 minutes. Secure the column to the vacuum manifold, open the valve, and turn on the vacuum. Add 375 μL of the DNA-NTI mixture to 2x columns, ensuring it passes completely through each column. Add 700 μL of NTC wash buffer twice. Remove the column from the vacuum manifold and place it in a collection tube. Centrifuge the assembly at 11,000 x g for 1 minute. Transfer the column to a new low-binding microcentrifuge tube, add 25 μL of preheated buffer, and incubate the assembly at 70°C for 5 minutes. Centrifuge the assembly at 11,000 x g for 1 minute. Repeat the incubation and elution steps a second time. According to the manufacturer's instructions, the collected DNA was quantified using the dsDNABR Qubit (Q32850, Thermo Fisher Scientific) on a Qubit 4 fluorometer (Q33226, Thermo Fisher Scientific).

[0845] Load the sample into each well of an E-Gel EX, 1% agarose gel (G402021, Thermo Fisher Scientific) at a rate of 16 ng DNA per well. Add 2 μl of ladder (10488090, Thermo Fisher Scientific) to the leftmost lane of the gel. Run the gel through an E-GelPower Snap electrophoresis system according to the manufacturer's protocol (G8100, G8200, Thermo Fisher Scientific). After gel run, exonuclease-resistant TDSCs will be visible, with molecular weights corresponding to the full-length DNA plus the blocking adaptor sequence. TDSCs are considered exonuclease-resistant in this assay if at least 95% of the product appearing in the gel in that lane corresponds to the full-length TDSC.

[0846] Example 3: Identifying nucleic acids in dsDNA molecules (e.g., TDSCs) that contain open ends (e.g., two open ends). Exonuclease resistance

[0847] This example describes how to test whether a dsDNA molecule (e.g., TDSC) containing open ends (e.g., an adaptor-ligated linear dsDNA construct) is resistant to exonuclease III (M0206, New England Biolabs, Inc.) . TDSC is tested alongside a non-nuclease control. The non-nuclease control contains DNA with the same sequence as the target TDSC, except that it has undergone an adaptor ligation protocol used to add the exonuclease-resistant DNA end form to the TDSC, but no adaptor oligonucleotides are added to the mixture. In a 20 μL reaction, 2 units of exonuclease III / 200 ng DNA (10 ng / μL) are added. The tubes are thoroughly mixed and centrifuged. The tubes are then run on a thermal cycler at 37°C for 30 minutes.

[0848] Load the sample into each well of an E-Gel EX, 1% agarose gel (G402021, Thermo Fisher Scientific) at a rate of 20 ng DNA per well. Add 2 μl of ladder (10488090, Thermo Fisher Scientific) to the leftmost lane of the gel. Run the gel through an E-GelPower Snap electrophoresis system according to the manufacturer's protocol (G8100, G8200, Thermo Fisher Scientific). After gel run, exonuclease-resistant TDSCs will be visible, with molecular weights corresponding to the full-length DNA plus the blocking adaptor sequence. TDSCs are considered exonuclease-resistant in this assay if at least 95% of the product appearing in the gel in that lane corresponds to the full-length TDSC.

[0849] Example 4: Design and assembly of plasmid templates for producing double-stranded DNA (dsDNA) molecules

[0850] This example describes the production of a plasmid template for a dsDNA molecule. In this example, the construct template was designed using the following specific sequence components.

[0851]

[0852] · Effector sequence (mCherry) encoding the model / marker protein: 5’atggtgagcaagggcgaggaggataacatggccatcatcaaggagttcatgcgcttcaaggtgcacatggagggctccgtgaacggccacgagttcgagatcgagggcgagggcgagggccgcccctacgagggcacccagaccgccaagctgaaggtgaccaagggtggccccctgcccttcgcctgggacatcctgtcccctcagttcatgtacggctccaaggcctacgtgaagcaccccgccgacatccccgactacttgaagctgtccttccccgagggcttcaagtgggagcgcgtgatgaacttcgaggacggcggcgtggtgaccgtgacccaggactcctccctgcaggacggcgagttcatctacaaggtgaagctgcgcggcaccaacttcccctccgacggccccgtaatgcagaagaagaccatgggctgggaggcctcctccgagcggatgtaccccgaggacggcgccctgaagggcgagatcaagcagaggctgaagctgaaggacggcggccactacgacgctgaggtcaagaccacctacaaggccaagaagcccgtgcagctgcccggcgcctacaacgtcaacatcaagttggacatcacctcccacaacgaggactacaccatcgtggaacagtacgaacgcgccgagggccgccactccaccggcggcatggacgagctgtacaagtaa-3’(SEQ ID NO:38)

[0853] Optional:

[0854] · NTS: SV40 enhancer: 5’-cccaagaagaagaggaaagtc-3’(SEQ ID NO:1)

[0855] · Maintenance sequence: human interferon-β MAR

[0856] 5'tataattcactggaattttttgtgtgtatggtatgacatatgggttcccttttattttttacatataaatatatttccctgttttttctaaaaaagaaaaagatcatcattttcccattgtaaaatgccatatttttttcataggtcacttacata3' (SEQ ID NO: 39)

[0857] • Second chain motif: AAV2 wild-type ITR

[0858] 5'aggaacccctagtgatggagttggccactccctctctgcgcgctcgctcgctcactgaggccgggcgaccaaaggtcgcccgacgcccgggctttgcccgggcggcctcagtgagcgagcgagcgcgcagctgcctgcagg-3' (SEQ ID NO: 26)

[0859] These elements were used to design a plasmid template. Once the design was complete, the plasmid was ordered from a commercial supplier (GenScript) to be used as a template for PCR amplification.

[0860] Example 5: Production of chemically modified dsDNA molecules

[0861] This example demonstrates the preparation of dsDNA molecules containing a chemically modified cytosine (e.g., 5-formyl-2'-deoxycytosine (5-formylcytosine)) at the carbon 5 position (C-5 position).

[0862] Plasmid DNA (10 ng / 50 μL PCR reaction) was used as the template for PCR amplification using KOD polymerase (710864, ​​Sigma-Aldrich), KOD Xtreme (KODX) polymerase (719753, Sigma-Aldrich), or Deep Vent polymerase (M0258, NEB). Other commercially available polymerases may also be used. The product versions used were purchased as constitutive components, not as a master mix, to ensure an accurate ratio of modified nucleotides to standard dNTPs. PCR reaction conditions for each enzyme included:

[0863] a. For KOD polymerase, the final concentration of MgSO4 is 2 mM.

[0864] b. 100 mM unmodified dNTP solution group (N0446, New England Biological Laboratory), final concentration 200 μM.

[0865] c. Modified deoxyribonucleoside triphosphates (e.g., 5-formyl-dCTP, N-2064, Trilink Biotechnologies) are added to their homologous dNTPs in varying proportions, totaling 200 μM (i.e., 200 μM dATP, 200 μM dCTP, 200 μM dTTP, and 200 μM dGTP). Therefore, a reaction designed for 25% incorporation would consist of 50 μM modified dCTP and 150 μM unmodified dCTP, for a total of 200 μM dCTP.

[0866] d. The final concentration of both forward and reverse primers is 300 μM.

[0867] The thermal cycling was performed according to the manufacturer's protocol, except that the extension time was extended from 20-60 seconds per kilobase amplicon (for KOD and KOD Xtreme polymerases, respectively) to 2-3 minutes per kilobase.

[0868] To synthesize linear covalently blocked dsDNA molecules, primers contain phosphate groups or TelN recognition sequences to improve ligation efficiency.

[0869] For the synthesis of circular dsDNA, in addition to containing sequences complementary to the plasmid, the primers also contain other sequences useful in the downstream process:

[0870] a. Recognition sequences of one or more nickases;

[0871] b. Restriction enzyme recognition sequences (e.g., BsaI, KpnI, or NheI) used to generate sticky ends in DNA and promote DNA circularization after restriction enzyme digestion; and

[0872] c. Additional bases (e.g., 5'-CCGTGGTCCTTC-3') (SEQ ID NO:40) to improve the efficiency of restriction enzyme digestion.

[0873] Such as 3A and Figure 3B This demonstrates successful incorporation of 5-formyl-dCTP into the PCR product. When 5-formyl-dCTP was added to the PCR mixture at a ratio of 1:3 with unmodified dCTP (i.e., 25% of the total dCTP being 5-formyl-dCTP), and when using Deep Vent polymerase (…),… Figure 3A ) or KOD Xtreme polymerase ( Figure 3B When the desired product is detected (indicated by an arrow), the desired product is detected.

[0874] For all forms, PCR products were purified using a standard DNA purification column.

[0875] Figure 4 The generation of covalently blocked linear dsDNA molecules with phosphate-thioester modified ends was described. For dsDNA molecules with phosphate-thioester modified ends, up to 10 μg of 50 μL of PCR DNA was added to a mixture (E7546L) of NEBNext UltraII end repair / dA-tailing buffer (8 μL) and enzyme (3 μL) for each reaction, and incubated first at 20 °C for 30 min, then at 65 °C for 30 min. After brief cooling on ice, the NEBNext Ultra II ligation module components, comprising ligation mixture (30 μL), ligation enhancer (1 μL), and 3 μL of 100 μM solution containing the phosphorylated phosphate-thioester DNA adaptor to be ligated, were added. The reaction was incubated for >1 h (usually overnight). The ligated PCR-adaptor solution was then purified using a Nucleospin Midi column, quantified by Nanodrop, and any unligated PCR was removed using exonuclease III (NEB M0206) at 37 °C for one h.

[0876] Figure 5 The generation of covalently blocked linear dsDNA molecules with TelN-terminated forms was described. For dsDNA molecules with TelN-terminated forms, 1 μg of purified PCR product was incubated at 30 °C for 1 h in a 40 μL reaction mixture containing 4 μL of 10x ThermoPol buffer and 2 μL of TelN protein telomerase (M0651, New England Biolabs). The TelN-modified DNA was then purified using a ZymoDCC-100 column, quantified by Nanodrop, and any PCR product without TelN modification was removed using exonuclease III (NEB M0206) at 37 °C for 1 h.

[0877] Figure 6 It is a diagram depicting a circular dsDNA molecule. Figure 7 The generation of circular dsDNA molecules was described. To synthesize circular dsDNA molecules, purified PCR products were digested in an overnight reaction using a restriction enzyme corresponding to the restriction enzyme recognition sequence, such as KpnI-HF-V2 (R3142, New England Biolabs). The DNA was then purified using a DNA purification column. The digested DNA was circularized for one hour at 26°C using T3 DNA ligase (M0317, New England Biolabs). Non-circularized DNA was degraded by incubating the DNA with T5 exonuclease (M0663L, New England Biolabs) at 37°C for one hour. T5 exonuclease was used to digest linear dsDNA but not circular dsDNA. The DNA was purified using a DNA purification column. Other similar methods, such as agarose gel purification, can also be used.

[0878] Figure 8 PCR with various thermal cycling parameters can be used to generate chemically modified DNA molecules, including 5-formylcytosine and 5-hydroxycytosine. For KOD Xtreme polymerase, extended times of two minutes (manufacturer recommended), four minutes, and six minutes produce detectable amounts of chemically modified DNA amplicones, including 5-formylcytosine (lane 2) and 5-hydroxycytosine (lane 3).

[0879] The composition and purity of the obtained dsDNA molecules were analyzed using the CRISPR Discovery Kit (DNF-930-K1000CP) on an Agilent 5300 fragment analyzer. dsDNA loading buffer and electrophoresis gels with intercalation dyes were freshly prepared daily, while labeling trays with mineral oil coating and capillary conditioning solution were freshly prepared monthly. Buffers were prepared according to the manufacturer's specifications. Circular dsDNA molecules were diluted with water to a final concentration of 100 pg / µL. For each sample well, 2 µL of DNA sample was added to 22 µL of dilution buffer (0.1X TE), and 2–4 replicates were run per sample, with one well used for the MDK DNA ladder. Samples were run via the instrument controller software using the default settings of the CRISPR Discovery method (CRP-910-33).

[0880] Sample traces were analyzed using ProSize data analysis software v4.0.2.7. The peak analysis conditions for dsDNA were set to "Peak Width (seconds)" of 5, "Minimum Peak Height (RFU)" of 50, "Extra Valley Points" of 3, and "Interval Baseline" enabled. Manual baselines were set to -2 minutes from the lower label and +2 minutes from the upper label. Under these conditions, the software automatically detects peaks and selects the peak width, except in cases where manual adjustment is required due to broad peaks, peak shoulders, or multiple peaks within a narrow size range.

[0881] Figure 9-12 Fragment analyzer traces of dsDNA molecules with C-5 cytosine modification are displayed. Figure 9 The circular dsDNA molecule produced and purified as described above was shown in a reaction using 25% 5-formylcytosine. Figure 10 and Figure 11 It shows a terminal form containing a thiophosphate modification ( Figure 10 ) and TelN terminal form ( Figure 11 Linear covalently blocked dsDNA molecules, which are produced in a reaction using 25% formylcytosine and purified as described above. Figure 12Linear covalently blocked dsDNA molecules with phosphate-thioester modified ends, produced in a reaction using 50% 5-hydroxycytosine, are shown. In each trace, a single peak (indicated by arrows) is clearly visible. These results demonstrate that cytosines with 5-C chemical modifications (e.g., 5-formylcytosine and 5-hydroxycytosine) can be incorporated into and purified from various types of dsDNA molecules.

[0882] Example 6: Assessment of in vitro reporter gene expression

[0883] This example demonstrates the detection and quantification of gene expression in cultured cells using chemically modified dsDNA molecules.

[0884] Experimental dsDNA molecules and controls were administered via lipid transfection (lipotransfection). DNA lipid transfection was performed in HEKa, HepG2, HEK293, and U937 cells using Lipofectamine 3000 transfection reagent (#L3000001, Thermo Fisher Scientific) according to the manufacturer's instructions. All DNA constructs and controls used a 1:2:3 ratio of DNA:P3000:Lipofectamine 3000. One day prior to transfection, 10,000 cells were pre-seeded into each well of a 96-well plate. Transfection was performed when the cells reached approximately 80% to 90% confluence. For each well of the 96-well plate, 3X Lipofectamine 3000 was first added to 5 μL of Opti-MEM. TM Dilute in low serum medium (#31985070, Thermo Fisher Scientific). Use 2X P3000 reagent in 5 μL Opti-MEM. TM The DNA was diluted in low-serum medium. Then the DNA was added to a medium containing Opti-MEM. TM Add the DNA-Lipofectamine 3000 to low-serum medium and mix gently with a pipette. After incubating at room temperature for 15 minutes, drop the DNA-Lipofectamine 3000 complex into different areas of the wells containing complete medium for the target cells. Gently shake the plate back and forth and side to side to distribute the DNA-Lipofectamine 3000 complex evenly. After transfection, incubate the cells in a CO2 tissue culture incubator, changing the medium 6 to 8 hours after transfection.

[0885] To determine the expression of the construct encoding the fluorescent reporter mCherry, cells were washed with PBS before flow cytometry analysis. All flow cytometry analyses were performed on a Miltenyi MACSQuant VYB. To detect the mCherry signal, a yellow laser (561 nm wavelength) was used for excitation with a 615 / 620 nm emission filter. 20,000 events were recorded for each sample, and data were analyzed using Flowjo V.9.0 software. Cells were first gated on FSC-A and SSC-A plots to remove cell debris. Populations were further plotted on FSC-A and FSC-H plots to restrict to single-cell populations. Finally, a bivariate plot between fluorescently expressed and non-expressing cells was used to determine the percentage of expressing cells. The distribution of expressing cells was used to determine the expression level within each cell. Expression analysis was performed at multiple time points.

[0886] Figure 13 The 5-formylcytosine-modified dsDNA supports reporter protein expression. In three different cell types (HepG2, HEKa, and U937 cells), the circular 5-formylcytosine-modified dsDNA retained function, as defined by detectable expression of the reporter protein mCherry. In HepG2 cells, the function of the 5-formylcytosine-modified dsDNA was approximately 80% of that of the unmodified control dsDNA, as defined by the relative percentage of mCherry+ cells compared to the unmodified control dsDNA. These results demonstrate that 5-formylcytosine-modified dsDNA can be transcribed in multiple cell lines and ultimately produce the protein product.

[0887] Example 7: Assessment of innate immune response in vitro

[0888] This example demonstrates the effect of chemically modified dsDNA molecules on the innate immune response of cultured cells.

[0889] The experimental constructs were prepared as described in Examples 4 and 5 above, and then applied to cells as described in Example 6 above. qPCR was performed to determine the RNA levels of cytokines IFN-β, IL-6, TNF-α, and CXCL10 in cells transfected with dsDNA molecules. In short, the probe and primer sets used in qPCR are: human IFN-b (forward sequence: CTTGGATTCCTACAAAGAAGCAGC (SEQ ID NO:41); reverse sequence: TCTCCTTCTGGAACTGCTGCA (SEQ ID NO:42); human IL-6 (forward sequence: AGACAGACCACTCACCTCTTCAG (SEQ ID NO:43); reverse sequence: TTCTGCCAGTGCCTCTTTGCTG (SEQ ID NO:44)); human TNF-a (forward sequence: CTCTTCTGCCTGCTGCACTTTG (SEQ ID NO:47); reverse sequence: ATGGGCTACAGGCTTGTCACTC (SEQ ID NO:48)); human CXCL10 (forward sequence: GGTGAGAAGAGATGTCTGAATCC (SEQ ID NO:49); reverse sequence: GTCCATCCTTGGAAGCACTGCA (SEQ ID NO:44)). RNA expression was analyzed using a QuantStudio7 Flex real-time PCR system and a SYBR Select Master Mix from Life Technologies Corporation. RNA expression was normalized for GAPDH and expressed as a fold change relative to the relevant untreated control. (SEQ ID NO: 50) Human CCL20 (forward sequence: AAGTTGTCTGTGTGCGCAAATCC (SEQ ID NO: 51); reverse sequence: CCATTCCAGAAAAGCCACAGTTTT (SEQ ID NO: 52)) Human CCL20 (forward sequence: GTCTCCTCTGACTTCAACAGCG (SEQ ID NO: 53); reverse sequence: ACCACCCTGTTGCTGTAGCCAA (SEQ ID NO: 54)).

[0890] Figures 14A-14C and Figures 15A-15C This demonstrates the innate immune response of HEKa and U937 cells to a circular dsDNA molecule chemically modified with 5-formylcytosine. In HEKa ( Figures 14A-14C ) and U937 Figures 15A-15CIn U937 cells, dsDNA molecules modified with 5-formylcytosine exhibited reduced production of innate immune biomarkers associated with interferon responses (IFNβ, CXCL10) and inflammatory cytokine responses (IL6) compared to dsDNA molecules with unmodified nucleotides. In U937 cells, the reduction in IFNβ and CXCL10 mRNA levels was comparable to that of messenger RNA chemically modified with 5-methoxyuridine to reduce immunogenicity. These results suggest that incorporating 5-formylcytosine into dsDNA molecules can reduce innate immune responses to DNA in a variety of immunologically active cell types.

[0891] Figure 16 and 17 This diagram illustrates the innate immune response of HEKa cells to linear dsDNA molecules with various modifications, including a phosphorylated end-adaptor and a cytosine C-5 position. For each chemically modified dsDNA molecule, the innate immune response was visualized as a scatter plot, where the X-axis represents a reduction in interferon signaling, defined as a decrease in the mean fold change of the markers IFNB and CXCL10 relative to unmodified dsDNA, and the Y-axis represents a reduction in inflammatory cytokine signaling, defined as a decrease in the mean fold change of the markers IL6 and TNFα relative to unmodified dsDNA. Several specific chemical modifications at the cytosine C-5 position, particularly 5-hydroxycytosine and 5-formylcytosine, reduced the production of these markers compared to unmodified dsDNA and other dsDNA chemical modifications (dashed ellipses; n = 42). Figure 16 These results indicate that incorporation of various specific chemical modifications at the C-5 position of cytosine can reduce the innate immune response to DNA in immunocompetent cell lines.

[0892] Figure 18This study illustrates the innate immune response to dsDNA and reporter gene expression in dsDNA molecules containing phosphate-thioester end-adaptors and chemical modifications at the C-5 position of cytosine. Each chemically modified dsDNA molecule is visualized as a point in a scatter plot, where the X-axis represents a reduction in innate immune signaling, defined as a decrease in the mean fold change of markers IFNB, CXCL10, IL6, and TNFα relative to unmodified DNA, and the Y-axis represents relative reporter gene expression, defined as the proportion of mCherry+ cells relative to unmodified control DNA. Several specific C-5 cytosine modifications to dsDNA, including 5-hydroxycytosine and 5-formylcytosine, reduced the cellular immune response in HEKa cells while still preserving function relative to unmodified dsDNA and other specific dsDNA chemical modifications (dashed ellipses, n=38). These results suggest that incorporation of multiple chemical modifications at the C-5 position of cytosine can reduce the innate immune response to DNA while simultaneously achieving protein expression in immune-active cells.

[0893] In summary, these results indicate that C-5 modification of cytosine, such as 5-formylcytosine and 5-hydroxycytosine, can reduce the immunogenicity of dsDNA while preserving its ability to encode functional protein products.

[0894] Example 8: Quantitative analysis of in vitro DNA chemical modification

[0895] This example describes the quantification of modified cytosine in chemically modified dsDNA molecules.

[0896] Purified dsDNA molecules containing chemically modified cytosines (e.g., 5-formylcytosine and 5-hydroxycytosine) were prepared from plasmid templates as described in Examples 4 and 5 above. The proportion of modified cytosines was quantified by liquid chromatography-tandem mass spectrometry (LC-MS / MS), as described in Bachman et al., 2014, Nature Chemistry, Vol. 6, No. 12, pp. 1049-1055. Briefly, DNA was degraded into nucleosides by incubation with DNA Degradase Plus (Zimo Research). Following enzymatic digestion, LC-MS / MS analysis was performed on a mass spectrometer equipped with a liquid chromatography system. Calibration curves were generated using mixtures of synthetic standards containing deoxycytosine (range 0.01–100 μM) and chemically modified cytosine (range 0.0001–1 μM) (e.g., 5-formyl-2'-deoxycytosine and 5-hydroxy-2'-deoxycytosine). A mixture of isotopically labeled deoxycytosine and chemically modified derivatives was incorporated as an internal standard into both the samples and synthetic standards. The mass spectrometer was operated in multiple reaction monitoring (MRM) mode. The ion source was positive ion mode electrospray ionization. Results are expressed as a percentage of total cytosine.

[0897] Example 9: Validation of chemically modified DNA sequences in cells

[0898] This example describes the sequence verification of chemically modified DNA delivered to cells.

[0899] Purified dsDNA constructs containing natural or chemically modified cytosines (e.g...

Claims

1. A double-stranded DNA (dsDNA) molecule comprising: A promoter sequence and a therapeutic payload sequence operatively connected to the promoter sequence, and A chemically modified cytosine nucleotide, specifically 5-hydroxycytosine, is located in the therapeutic loading sequence. The dsDNA molecule is a closed-terminal linear DNA.

2. The dsDNA molecule of claim 1, wherein at least 1%, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 50%, or at least 75% of the cytosine positions in the dsDNA molecule contain the chemically modified cytosine nucleotide.

3. The dsDNA molecule as described in claim 1 or 2, comprising one, two, or all of the following: i) Heterogeneous functional sequences, such as nuclear targeting sequences or regulatory sequences; ii) Maintain the sequence; or iii) Copying origin.

4. The dsDNA molecule of any one of claims 1-3, wherein the chemically modified cytosine nucleotide is located in the sense strand of the therapeutic loading sequence.

5. The dsDNA molecule according to any one of claims 1-4, when it comes into contact with HEKa cells, causes one or both of the following: (i) A reduction in the measured value of interferon signaling relative to the control DNA molecule, for example, a reduction of at least 2-fold, at least 4-fold, at least 5-fold, or at least 6-fold, wherein the measured value of interferon signaling is the mean fold change of IFNβ mRNA and CXCL10 mRNA relative to the control DNA molecule; or (ii) A decrease in the measurement of inflammatory cytokine signaling relative to the control DNA molecule, for example, a decrease of at least 2-fold or at least 3-fold, wherein the measurement of inflammatory cytokine signaling is the mean fold change of IL6 mRNA and TNFα mRNA relative to the control DNA molecule. The control DNA molecule contains the same sequence, the same strand state, and the same circular or linear features as the dsDNA molecule, but contains unmodified cytosine nucleotides instead of these chemically modified cytosine nucleotides.

6. The dsDNA molecule of any one of claims 1-5, when contacted with HEKa cells, results in the expression level of the therapeutic load sequence being at least 20%, at least 30%, at least 40%, at least 50%, or at least 55% of the expression of the therapeutic load sequence of the control DNA, wherein the control DNA molecule contains the same sequence, the same strand state, and the same circular or linear features as the dsDNA molecule, but contains unmodified cytosine nucleotides instead of these chemically modified cytosine nucleotides.

7. A pharmaceutical composition comprising a dsDNA molecule as described in any one of claims 1-6.

8. A method for expressing a therapeutic load in target cells, the method comprising: (i) Introducing the dsDNA molecule as described in any one of claims 1-6 into the target cell; and (ii) Maintain (e.g., incubate) the cell under conditions suitable for expressing a therapeutic load from the therapeutic load sequence of the dsDNA molecule; This allows the therapeutic load to be expressed in the target cells.

9. A dsDNA molecule comprising a chemically modified cytosine nucleotide having a substitution other than hydrogen at the carbon 5 position of the cytosine.

10. The dsDNA molecule of claim 9, wherein it comprises a therapeutically loaded sequence.

11. A dsDNA molecule comprising: A promoter sequence and a therapeutic payload sequence operatively connected to the promoter sequence, and The chemically modified cytosine nucleotide located in this therapeutic loading sequence comprises a structure of formula I: R1 is selected from the group consisting of: –OH; -aldehyde; -carboxylic acid; -alkyl; -(CH2). m OR2, m = 1-3 and R2 = H or sugar molecule; and -propyne amino.

12. The dsDNA molecule of claim 11, wherein R1 is selected from the group consisting of: -OH; -CHO; -COOH; -alkyl; -(CH2). m OR2, m = 1-3 and R2 = H or a sugar molecule; and -propynylamino, wherein the alkyl group contains one to six carbons.

13. The dsDNA molecule of claim 11 or 12, wherein R1 is selected from the group consisting of: -OH; -CHO; -COOH; -CH2OR3, R3 = H or glucose; -methyl; and -propynylamino.

14. The dsDNA molecule according to any one of claims 9-13, wherein the chemically modified cytosine nucleotide comprises 5-formylcytosine, 5-hydroxycytosine, 5-carboxycytosine, 5-propynylaminocytosine, 5-methylcytosine, 5-hydroxymethylcytosine, or glucosyl-5-hydroxymethylcytosine.

15. The dsDNA molecule according to any one of claims 9-14, wherein the dsDNA molecule is circular or linear.

16. The dsDNA molecule according to any one of claims 9-15, wherein the dsDNA molecule has closed, linear ends.

17. The dsDNA molecule of any one of claims 9-16, wherein at least 1%, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 50%, or at least 75% of the cytosine positions in the dsDNA molecule comprise the chemically modified cytosine nucleotide.

18. The dsDNA molecule according to any one of claims 9-17, comprising one, two, or all of the following: i) Heterogeneous functional sequences, such as nuclear targeting sequences or regulatory sequences; ii) Maintain the sequence; or iii) Copying origin.

19. The dsDNA molecule according to any one of claims 9-18, which, upon contact with HEKa cells, results in one or more of the following: IFNβ mRNA at levels lower than control DNA molecules (e.g., at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90% lower). CXCL10 mRNA at levels lower than control DNA molecules (e.g., at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 95% lower), or IL6 mRNA at lower levels (e.g., at least 10%, at least 20%, or at least 30% lower) compared to control DNA molecules. The control DNA molecule contains the same sequence, the same strand state, and the same circular or linear features as the dsDNA molecule, but contains unmodified cytosine nucleotides instead of these chemically modified cytosine nucleotides.

20. The dsDNA molecule of any one of claims 10-19, when contacted with HepG2 cells, results in the expression level of the therapeutic load sequence being at least 50%, at least 60%, at least 70%, or at least 75% of the expression level of the therapeutic load sequence of the control DNA, wherein the control DNA molecule contains the same sequence, the same strand state, and the same circular or linear features as the dsDNA molecule, but contains unmodified cytosine nucleotides in place of these chemically modified cytosine nucleotides.

21. The dsDNA molecule according to any one of claims 9-20, wherein the dsDNA molecule is linear and comprises: a) The end form of upstream exonuclease-resistant DNA; b) The double-stranded region; and c) Downstream exonuclease-resistant DNA terminal form.

22. A double-stranded DNA (dsDNA) molecule comprising: Chemically modified cytosine nucleotides, wherein the chemically modified cytosine nucleotides are selected from 5-hydroxycytosine or glucosyl-5-hydroxymethylcytosine. The dsDNA molecule is a closed-terminal linear DNA.

23. The dsDNA molecule of claim 22, wherein it comprises a therapeutic loading sequence.

24. A pharmaceutical composition comprising a dsDNA molecule as described in any one of claims 9-23.

25. A method for preparing or manufacturing double-stranded DNA (dsDNA) molecules, the method comprising: (a) Provide a composition comprising a DNA template, a forward primer, a reverse primer, a DNA polymerase, an unmodified deoxyribonucleotide, and a chemically modified cytosine nucleotide, wherein the DNA template is, for example, a plasmid, and the chemically modified cytosine nucleotide has a substitution other than hydrogen at the carbon 5 of the cytosine. as well as (b) Perform a polymerase chain reaction on the composition of (a). Thus, the dsDNA molecule is prepared or manufactured, wherein the dsDNA molecule is the dsDNA molecule as described in any one of claims 9-23.

26. A dsDNA molecule produced by the method of claim 25.

27. A method for expressing a therapeutic load in target cells, the method comprising: (i) Providing target cells with the dsDNA molecule as described in any one of claims 10-21, 23 or 26; as well as (ii) Maintain (e.g., incubate) the cell under conditions suitable for expressing a therapeutic load from the therapeutic load sequence of the dsDNA molecule; This allows the therapeutic load to be expressed in the target cells.

28. A method for delivering a therapeutic load to target cells, the method comprising: The dsDNA molecule as described in any one of claims 10-21, 23 or 26 is introduced into the target cell, wherein the therapeutic load sequence encodes a therapeutic load; This allows the therapeutic load to be delivered to the target cell.

29. A method for regulating (e.g., increasing or decreasing) biological activity in target cells, the method comprising: (i) Providing target cells with the dsDNA molecule as described in any one of claims 10-21, 23 or 26; The therapeutic load sequence encodes a therapeutic load that regulates the biological activity of the target cell; and (ii) Maintain (e.g., incubate) the cell under conditions suitable for expressing the therapeutic load from the dsDNA molecule; This regulates the biological activity of the target cells.

30. A method for treating cells, tissues, or subjects in need, the method comprising: The dsDNA molecule as described in any one of claims 9-23 or 26 is administered to the cell, tissue, or subject. This allows for the treatment of the cell, tissue, or subject.

Images