Molecular biomarker for targeted treatment of glioma and application thereof
By upregulating LanCL1 expression in glioma cells and constructing targeted therapeutic drugs using a lentiviral vector system, the limited application range of existing glioma treatment drugs has been solved, achieving precise inhibition of glioma cells.
Patent Information
- Application Number
- CN202511043932.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-07-28
- Publication Date
- 2025-10-31
AI Technical Summary
Current glioma treatments have limited application due to their targeting of specific sites, and their efficacy requires further evaluation, making it impossible to achieve precise molecular subtyping and targeted therapy.
Using LanCL1 as a target, we upregulated LanCL1 protein expression in glioma cells through a lentiviral vector system to prepare targeted therapeutic drugs. This included constructing a human LanCL1 recombinant overexpression vector, viral packaging and cell infection, and establishing a LanCL1-overexpressing human glioma cell line.
LanCL1 overexpression significantly inhibits glioma cell proliferation and migration, and in vitro experiments show decreased proliferation capacity. The expression of the cell cycle regulatory molecule CDK1 is reduced, and in vivo experiments show inhibition of tumor growth, providing a more precise targeted therapy.
Smart Images
Figure CN120860189A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biomedical technology, specifically relating to a molecular biomarker for targeted therapy of glioma and its application. Background Technology
[0002] Gliomas are among the most common malignant tumors of the central nervous system, especially glioblastoma (GBM), which is known for its malignant proliferation and high invasiveness. Although advancements in standard surgical resection combined with radiotherapy and chemotherapy have extended patient survival to some extent, the overall prognosis for glioma patients remains unsatisfactory. One fundamental reason for this is the high heterogeneity of gliomas; that is, the same type of glioma exists in multiple subtypes at the molecular level, leading to significant differences in treatment sensitivity and efficacy among different patients. Therefore, precise molecular subtyping and targeted therapy have become important directions for the development of glioma research and treatment.
[0003] With the development of molecular biology and high-throughput omics technologies, an increasing number of molecular biomarkers are being used for targeted therapy of gliomas, some of which have already been approved or are in clinical trials. These primarily target specific molecular targets, such as selective inhibitors of IDH1 / 2 mutant enzyme activity like vorasidenib, and immune checkpoint inhibitors (PD-1 / PD-L1 inhibitors like nivolumab). Although targeted therapy for gliomas has made significant progress in recent years, its application remains limited because each drug targets only specific individuals, and its therapeutic efficacy requires further evaluation. Developing new molecular targets can not only further improve the precision treatment of gliomas but also has important value for the diagnosis and prognosis prediction of gliomas. Summary of the Invention
[0004] To address the aforementioned problems in existing technologies, this invention provides a molecular biomarker for targeted therapy of gliomas and its application. This invention demonstrates that upregulation of LanCL1 can inhibit glioma cell proliferation and migration.
[0005] The technical solution adopted in this invention is as follows:
[0006] Application of LanCL1 in the preparation of drugs for treating glioma.
[0007] Application of formulations that activate LanCL1 expression in the preparation of drugs for the treatment of glioma.
[0008] The formulation includes an mRNA target sequence that activates human LanCL1, the nucleotide sequence of which is shown in SEQ ID No:1.
[0009] A drug for treating glioma, the drug being designed to target LanCL1 and upregulate LanCL1 expression.
[0010] Gene delivery was achieved using a lentiviral vector system, which targeted and upregulated the expression level of LanCL1.
[0011] The lentiviral vector system described herein uses the LanCL1 gene as a target to enhance the expression of LanCL1 protein in glioma cells.
[0012] A method for preparing a LanCL1-overexpressing human glioma cell line includes the following steps:
[0013] (1) Construct a human LanCL1 recombinant overexpression vector;
[0014] (2) Based on the recombinant overexpression vector described in step (1), the virus is packaged to obtain the virus stock solution;
[0015] (3) Based on the viral stock solution described in step (2), human glioma cells were transfected to construct a human glioma cell line overexpressing LanCL1.
[0016] The vector is a human LanCL1 lentivirus overexpression vector.
[0017] When constructing the vector, the target gene was amplified by PCR and corresponding backbone vector restriction sites were added to both ends. The primer sequences are as follows:
[0018] The upstream primer sequence of LanCL1 is shown in SEQ ID No:2, and the downstream primer sequence of LanCL1 is shown in SEQ ID No:3.
[0019] In step (2), the titer of the virus stock solution is 5 × 10⁻⁶. 8 TU / mL;
[0020] The human glioma cells are any one of U87MG, U251, and A172.
[0021] The beneficial effects of this invention are as follows:
[0022] This invention relates to LanCL1, a molecular biomarker for targeted therapy of glioma, demonstrating that upregulation of LanCL1 can inhibit glioma cell proliferation and migration. In vitro experiments showed that the proportion of EdU-positive cells decreased, the proportion of G0 / G1 phase cells increased, while the number of S phase cells significantly decreased in the LanCL1 overexpression group, and clonogenic ability was significantly reduced. Cell scratch assays showed that the migration ability of LanCL1-overexpressing glioma cells was significantly reduced. In vivo animal experiments showed that upregulation of LanCL1 expression can effectively inhibit the growth of glioma cells in the mouse brain. Mechanistic studies revealed that LanCL1 inhibits glioma cell proliferation by downregulating the cell cycle regulator CDK1. Attached Figure Description
[0023] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0024] Figure 1 The image shows the alignment results of the sequencing results of the LanCL1 recombinant lentiviral overexpression vector with the target gene sequence.
[0025] Figure 2 The figure shows the results of Western blotting identification of LanCL1 protein expression levels in U87MG and A172 glioma cells overexpressing LanCL1;
[0026] Figure 3 The image shows a comparison of cell proliferation in LanCL1-overexpressing U87MG glioma cells and the control group as detected by EdU staining.
[0027] Figure 4 This image shows a comparison of the cell cycle of LanCL1-overexpressing A172 glioma cells and control cells as detected by flow cytometry.
[0028] Figure 5A and Figure 5B This image shows a comparison of colony formation assays between LanCL1-overexpressing A172 and U251 glioma cells and the control group.
[0029] Figure 6A and Figure 6B This image shows a comparison of scratch assay results between A172 and U251 glioma cells overexpressing different LanCL1 levels and the control group.
[0030] Figure 7 This image shows a comparison of intracranial in situ tumor growth between LanCL1-overexpressing U87MG glioma cells and the control group using in vivo fluorescence imaging.
[0031] Figure 8 This image shows a comparison of the cell cycle regulatory protein CDK1 in LanCL1-overexpressing U87MG glioma cells and the control group using Western blotting. Detailed Implementation
[0032] To make the objectives, technical solutions, and advantages of this invention clearer, the technical solutions of this invention will be described in detail below. Obviously, the described embodiments are merely some embodiments of this invention, and not all embodiments. Based on the embodiments of this invention, all other implementation methods obtained by those skilled in the art without creative effort are within the scope of protection of this invention.
[0033] Example 1: Preparation and Validation of a LanCL1 Lentiviral Overexpression Human Glioma Cell Line
[0034] This embodiment uses a lentiviral vector to deliver genes and target and upregulate the expression level of LanCL1 in human glioma cells. The specific operation is as follows:
[0035] (1) Construction of human LanCL1 lentiviral overexpression vector
[0036] The lentiviral overexpression backbone vector GV492 was used, with the following sequence information: Ubi-MCS-3FLAG-CBh-gcGFP-IRES-puromycin (Shanghai Genechem, Shanghai, China). An overexpression vector carrying human LanCL1 cDNA was constructed according to the manufacturer's instructions. PCR was then performed.
[0037]
[0038] The target gene was amplified and corresponding backbone vector restriction sites were added to both ends. The primer sequences are as follows:
[0039] Human LanCL1 cDNA (human LANCL1, NM_001136575) was directionally inserted into linearized backbone vector plasmid GV492 digested with BamHI / AgeI to construct the LanCL1 recombinant lentiviral overexpression vector (LanCL1-OE). The empty vector of GV492 served as a negative control (Ctrl). Positive clones were screened and sequenced after transformation into competent cells. Alignment analysis of the LanCL1 recombinant lentiviral overexpression vector sequencing results with the target gene LanCL1 CDS sequence confirmed the successful construction of the LanCL1 overexpression vector. The alignment results are shown below. Figure 1 As shown, the part in red text is the target gene sequence.
[0040] The target gene sequence (as shown in SEQ ID No:1) is as follows:
[0041] ATGGCTCAAAGGGCCTTCCCGAATCCTTATGCTGATTATAACAAATCCCTGGCCGAAGGCTACTTTGATGCTGCCGGGAGGCTGACTCCTGAGTTCTCACAACGCTTGACCAATAAGATTCGGGAGCTTCTTCAGCAAATGGAGAGAGGCCTGAAATCAGCAGACCCTCGGGATGGCACCGGTTACACTGGCTGGGCAGGTATTGCTGTGCTTTACTTACATCTTTATGATGTATTTGGGGACCCTGCCTACCTACAGTTAGCACATGGCTATGTAAAGCAAAGTCTGAACTGCTTAACCAAGCGCTCCATCACCTTCCTTTGTGGGGATGCAGGCCCCCTGGCAGTGGCCGCTGTGCTATATCACAAGATGAACAATGAGAAGCAGGCAGAAGATTGCATCACACGGCTAATTCACCTAAATAAGATTGATCCTCATGCTCCAAATGAAATGCTCTATGGGCGAATAGGCTACATCTATGCTCTTCTTTTTGTCAATAAGAACTTTGGAGTGGAAAAGATTCCTCAAAGCCATATTCAGCAGATTTGTGAAACAATTTTAACCTCTGGAGAAAACCTAGCTAGGAAGAGAAACTTCACGGCAAAGTCTCCACTGATGTATGAATGGTACCAGGAATATTATGTAGGGGCTGCTCATGGCCTGGCTGGAATTTATTACTACCTGATGCAGCCCAGCCTTCAAGTGAGCCAAGGGAAGTTACATAGTTTGGTCAAGCCCAGTGTAGACTACGTCTGCCAGCTGAAATTCCCTTCTGGCAATTACCCTCCATGTATAGGTGATAATCGAGATCTGCTTGTCCATTGGTGCCATGGCGCCCCTGGGGTAATCTACATGCTCATCCAGGCCTATAAGGTATTCAGAGAGGAAAAGTATCTCTGTGATGCCTATCAGTGTGCTGATGTGATCTGGCAATATGGGTTGCTGAAGAAGGGATATGGGCTGTGCCACGGTTCTGCAGGGAATGCCTATGCCTTCCTGACACTCTACAACCTCACACAGGACATGAAGTACCTGTATAGGGCCTGTAAGTTTGCTGAATGGTGCTTAGAGTATGGAGAACATGGATGCAGAACACCAGACACCCCTTTCTCTCTCTTTGAAGGAATGGCTGGAACAATATATTTCCTGGCTGACCTGCTAGTCCCCACAAAAGCCAGGTTCCCTGCATTTGAACTC.
[0042] (2) Preparation of high-titer lentivirus (5×10⁻⁶) 8 TU / mL)
[0043] A three-plasmid transfection system was used. LanCL1 recombinant overexpression plasmid (LanCL1-OE) or control plasmid (Ctrl) was co-transfected with two virus packaging helper plasmids (Helper 1.0, Helper 2.0) using Gilead transfection reagent to package the virus into 293T cells. Green fluorescence was observed under a fluorescence microscope to determine the transfection efficiency. Viral supernatant was collected 48-72 hours post-transfection, concentrated, purified to obtain the viral stock solution, and the viral titer (5×10⁻⁶) was determined. 8 (TU / mL). Aliquot and store at -80℃ for later use.
[0044] (3) Preparation and validation of a stable human glioma cell line overexpressing LanCL1
[0045] 10 μl each of LanCL1 overexpression (LanCL1-OE) and control (Ctrl) viral stock solutions were added to serum-free culture medium, and transfection aid P was added simultaneously and mixed thoroughly. The viral mixture was then added to a human glioma cell (U87MG, U251, A172) culture system. After 72 h of infection, 2.5 μg / L puromycin was added for selection. The LanCL1 overexpression protein level of positive cells was identified by Western blotting using a Flag tag antibody (anti-Flag, Sigma-Aldrich, #F3165) and a β-actin internal control antibody (anti-β-actin, Boster Biological Technology, BM0627). The identification results for U87MG and A172 cells are shown below. Figure 2 As shown, the expression level of LanCL1 protein in the overexpression group was significantly higher than that in the control group, indicating that the human glioma cell line overexpressing LanCL1 was successfully constructed. The glioma cells successfully overexpressing LanCL1 (LanCL1-OE) and control cells (Ctrl) were expanded and cryopreserved for subsequent in vitro cell biological behavior analysis and in vivo experiments.
[0046] Example 2: In vitro biological behavior analysis of LanCL1-overexpressing glioma cells
[0047] The following cell biological behavior analysis was conducted using human glioma cells (U87MG, U251, A172) stably overexpressing LanCL1 and corresponding control cells. The LanCL1 overexpression group was labeled LanCL1-OE or OE, and the control group was uniformly labeled Ctrl.
[0048] like Figure 3 As shown, in the EdU staining cell proliferation assay, cells were stained with EdU (Cell-Light EdUApollo567 In Vitro Kit, Rabobio, #C10310-1) and mounted with DAPI-containing mounting medium. The number of EdU-stained (red fluorescence) / DAPI-stained (blue fluorescence) double-positive cells and the number of DAPI-stained single-positive cells were counted, and the ratio of the two was calculated. The results showed that the proportion of EdU / DAPI double-positive cells in LanCL1-overexpressing human glioma U87MG cells (LanCL1-OE group) was significantly lower than that in the control group (Ctrl cells), indicating that the proportion of EdU-positive proliferating cells in the LanCL1-overexpressing group was significantly reduced, suggesting that LanCL1 overexpression reduces the proliferative activity of glioma cells.
[0049] like Figure 4 As shown, in the flow cytometry cell cycle assay, LanCL1-overexpressing human glioma A172 cells and control cells were collected, fixed with 75% ethanol after pre-cooling, and incubated overnight at 4°C. Cells were collected by centrifugation at 1000g for 5 minutes, washed with PBS, and stained with propidium iodide (PI, Beyotime, China) for 30 minutes. Flow cytometry (Beckman Coulter, USA) was used to analyze the stained cells, and the cell cycle distribution was calculated using ModFit LT software (Version 5.0.9). The results showed that the proportion of cells in the G0 / G1 phase in the LanCL1-overexpressing human glioma A172 cell group (LanCL1-OE) was significantly higher than that in the control group (Ctrl), while the proportion of cells in the S phase was significantly lower than that in the control group. There was no significant difference in the proportion of cells in the G2 / M phase between the two groups. This suggests that LanCL1 overexpression inhibits glioma cells from entering the S phase and reduces the proliferation capacity of glioma cells.
[0050] like Figure 5A and Figure 5BAs shown, cell colony formation experiments were conducted using LanCL1-overexpressing human glioma cell lines A172 and U251. Approximately 1000 cells were seeded into 6-well plates and cultured in complete DMEM for about 2 weeks. Cells were fixed with 4% paraformaldehyde (PFA), stained with crystal violet, and subjected to microscopic imaging to quantitatively count the number of colonies. The results showed that the number of glioma cell colonies formed in the LanCL1-overexpressing (LanCL1-OE) group was significantly less than that in the control group, suggesting that LanCL1 overexpression inhibits glioma cell colony formation.
[0051] like Figure 6A and Figure 6B As shown, scratch assays were performed using LanCL1-overexpressing glioma cell lines A172 and U251. The results indicated that the scratch healing rate of glioma cells in the LanCL1 OE group was significantly lower than that in the control group, suggesting that LanCL1 overexpression significantly reduces the migration ability of glioma cells.
[0052] Example 3: Detection of In situ Tumor Formation in Mice - Effect of LanCL1 Overexpression on Glioma Growth
[0053] like Figure 7 As shown, 4-6 week old male BALB / c nude mice were selected and, after acclimatization, were inoculated with LanCL1-overexpressing human U87MG glioma cells and control cells, respectively. Each mouse was inoculated with approximately 5 × 10⁶ cells. 4 A mouse model of intracranial orthotopic tumor formation was established by stereotactic intracranial injection of 5 μL of LanCL1 OE cells. Tumor volume was monitored periodically post-surgery using in vivo fluorescence imaging. Results showed that 3 weeks post-inoculation, the glioma volume in the LanCL1 OE group was significantly lower than that in the control group, suggesting that LanCL1 overexpression inhibits glioma cell growth in mice.
[0054] Example 4: Mechanism Study: LanCL1 Overexpression Reduces the Expression of CDK1, a Cell Cycle Regulatory Molecule
[0055] like Figure 8 As shown in the mechanistic study, LanCL1-overexpressing (OE) U87MG cells and control cells (Ctrl) were collected to prepare cell lysates. Western blotting was performed using a specific antibody against CDK1 (anti-CDK1, Cell Signaling Technology, #2546) and an internal control antibody β-actin. The results showed that the expression level of CDK1 protein, a key molecule in cell cycle regulation, was significantly reduced in LanCL1-overexpressing cells. This suggests that LanCL1 overexpression may inhibit glioma cell proliferation through CDK1, causing glioma cells to be more in the G0 / G1 phase and less in the S phase, resulting in reduced G1 / S phase transition and cell cycle arrest.
[0056] As alternative implementation methods, in addition to Western blotting, LanCL1 detection can also employ other biochemical or molecular biological detection methods such as real-time quantitative PCR (qRT-PCR), immunohistochemistry (IHC), immunofluorescence, in situ hybridization (ISH), RNA sequencing (RNA-seq), digital PCR, ELISA (e.g., for detecting serum LanCL1 protein levels), and mass spectrometry.
[0057] In addition to cells, LanCL1 can also be used to detect fluid samples such as brain tissue, blood, and cerebrospinal fluid for liquid biopsies.
[0058] As an alternative implementation method, besides upregulating LanCL1 expression via viral vectors, other methods for regulating LanCL1 function include:
[0059] 1) Recombinant proteins or small molecule agonists upregulate or activate LanCL1 expression.
[0060] 2) Peptide drugs, antibody drugs, and nanoparticle delivery systems upregulate or activate LanCL1 expression.
[0061] 3) It indirectly upregulates or activates LanCL1 expression by regulating upstream regulatory factors.
[0062] As alternative implementation methods, the intervention methods and routes of administration may also include:
[0063] 1) Drug delivery via intraperitoneal, intravenous, oral, nasal, local sustained-release gel, or biomaterials (such as hydrogels, microspheres) and other carriers.
[0064] 2) Combine multiple treatment options such as radiotherapy, chemotherapy, immunotherapy, electric field therapy and other molecularly targeted drugs.
[0065] As alternative implementation methods, in addition to human glioma cell lines as cell models and nude mice as experimental animals, other glioma cell lines, including those from other species such as the murine glioma cell line GL261, non-immunodeficient mice or transgenic mice, patient-derived glioma xenograft animal models (PDX), organoid models, and primary cultured glioma cell models, can be used to expand the applicability of the experiment.
[0066] As an alternative implementation method, LanCL1-related pathways can not only be used to regulate the CDK1 axis, but also be combined with other metabolic and signaling pathways closely related to glioma progression (such as PI3K / AKT, MAPK, AMPK / PGC1a / SIRT1, JNK pathway, CDKN family signaling, etc.) for joint regulation.
[0067] The above description is merely a specific embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any variations or substitutions that can be easily conceived by those skilled in the art within the technical scope disclosed in the present invention should be included within the scope of protection of the present invention. Therefore, the scope of protection of the present invention should be determined by the scope of the claims.
Claims
1. Application of LanCL1 in the preparation of drugs for treating glioma.
2. Application of preparations that activate LanCL1 expression in the preparation of drugs for the treatment of glioma.
3. The application according to claim 2, characterized in that, The formulation includes an mRNA target sequence that activates human LanCL1, the nucleotide sequence of which is shown in SEQ ID No:
1.
4. A drug for treating glioma, characterized in that, The drug is designed to target LanCL1 and upregulate LanCL1 expression.
5. The medicament for treating glioma according to claim 4, characterized in that, Gene delivery was achieved using a lentiviral vector system, which targeted and upregulated the expression level of LanCL1.
6. The medicament for treating glioma according to claim 5, characterized in that, The lentiviral vector system described herein uses the LanCL1 gene as a target to enhance the expression of LanCL1 protein in glioma cells.
7. A method for preparing a LanCL1-overexpressing human glioma cell line, characterized in that, Includes the following steps: (1) Construct a human LanCL1 recombinant overexpression vector; (2) Based on the recombinant overexpression vector described in step (1), the virus is packaged to obtain the virus stock solution; (3) Based on the viral stock solution described in step (2), human glioma cells were transfected to construct a human glioma cell line overexpressing LanCL1.
8. The method for preparing a LanCL1-overexpressing human glioma cell line according to claim 7, characterized in that, The vector is a human LanCL1 lentivirus overexpression vector.
9. The method for preparing a LanCL1-overexpressing human glioma cell line according to claim 7, characterized in that, When constructing the vector, the target gene was amplified by PCR and corresponding backbone vector restriction sites were added to both ends. The primer sequences are as follows: The upstream primer sequence of LanCL1 is shown in SEQ ID No:2, and the downstream primer sequence of LanCL1 is shown in SEQ ID No:
3.
10. The method for preparing a LanCL1-overexpressing human glioma cell line according to claim 7, characterized in that, In step (2), the titer of the virus stock solution is 5 × 10⁻⁶. 8 TU / mL; The human glioma cells are any one of U87MG, U251, and A172.