Application of single-stranded DNA adjuvant in preparation of vaccine for protecting animals from being infected by pathogenic bacteria

Abstract

The invention relates to the technical field of immune prevention and control, in particular to application of a single-stranded DNA adjuvant in preparation of a vaccine for protecting animals from being infected by pathogenic bacteria. In the invention, the single-stranded DNA adjuvant comprises more than one section of ssDNA motif; the ssDNA motif comprises a Hind III restriction enzyme cutting site sequence, a random ssDNA sequence and a polyG sequence; wherein the single-stranded DNA adjuvant has an annular structure, and is in a nano-particle state. The single-stranded DNA adjuvant is synthesized in a rolling circle amplification mode, efficient preparation of the single-stranded DNA adjuvant is achieved, and the synthesis cost of the single-stranded DNA adjuvant is reduced; the single-stranded DNA adjuvant provided by the invention has good stability and biological safety, can be swallowed by macrophages under a naked delivery condition, can effectively up-regulate the expression of immune factors, is composed of single-stranded DNA composed of a plurality of motifs with different numbers, has the potential of serving as a vaccine adjuvant, and can be used as a vaccine adjuvant. The immune protection effect of the Edwardsiella tarda inactivated vaccine can be obviously enhanced.

Description

Technical Field

[0001] This invention relates to the field of immunoprevention and control technology, and in particular to the application of a single-stranded DNA adjuvant in the preparation of vaccines that protect animals from pathogenic bacterial infections. Background Technology

[0002] Vaccines are an effective means of preventing various infectious diseases and are generally classified into several types, including inactivated vaccines, live attenuated vaccines, subunit vaccines, and nucleic acid vaccines. Vaccines deliver antigens to the body in a specific manner to safely stimulate an immune response, thereby promoting memory-based cellular and humoral immunity. Adjuvants play a crucial role in vaccines, controlling how the immune system encounters immunogens and providing inflammatory signals to effectively initiate the body's immune response (E. Ben-Akiva, et al. Sci. Immunol. 2025, 10: eado5937.). The development of novel adjuvants can significantly facilitate vaccine application.

[0003] Synthetically synthesized unmethylated CpG oligodeoxynucleotides (ODNs) can activate the Toll-like receptor 9 (TLR9) to mimic pathogen-associated molecular patterns (PAMPs), thereby activating the host's innate immune response, promoting the expression of various cytokines, and driving the maturation of immune cells (S. Bhagchandani, et al. Adv. Drug Deliv. Rev. 2021, 175:113803.). Currently, CpG is widely used as an adjuvant in mammalian subunit vaccines and inactivated vaccines (S. Bhagchandani, et al. Adv. Drug Deliv. Rev. 2021, 175:113803.). However, the natural phosphodiester backbone type CpG sequence has poor ribozyme resistance and usually requires phosphothioester modification to improve its stability. Currently, the preparation of chemically modified CpG relies on solid-phase synthesis, which requires expensive reagents and equipment. The large-scale use of organic reagents, in particular, can cause environmental pollution, and the synthesis of long-chain nucleic acid molecules is even more costly, limiting efficiency and yield in large-scale production (W. Zhao, et al. Angew. Chem. Int. Ed. 2008, 47: 6330-6337.). Given the extreme sensitivity of the animal field to the cost of vaccine adjuvants, developing low-cost adjuvant production strategies is crucial. Summary of the Invention

[0004] To address the aforementioned problems, the present invention aims to provide the application of a single-stranded DNA adjuvant in the preparation of vaccines that protect animals from pathogenic bacterial infections.

[0005] The objective of this invention can be achieved through the following technical solutions:

[0006] The first object of the present invention is to provide an application of a single-stranded DNA adjuvant in the preparation of a vaccine that protects animals from infection by pathogenic bacteria, said single-stranded DNA adjuvant comprising one or more ssDNA motifs;

[0007] The ssDNA motif includes a HindIII restriction site sequence, a random ssDNA sequence, and a polyG sequence.

[0008] The single-stranded DNA adjuvant has a circular structure and is in a nanoparticle state.

[0009] In one embodiment of the present invention, the HindIII restriction site sequence is shown in SEQ ID NO.1; the polyG sequence is shown in SEQ ID NO.2; and the random ssDNA sequence is a random ssDNA sequence of less than 25 nt.

[0010] Preferably, the ssDNA motif is selected from one of the following: RCA-DZ ssDNA motif, RCA-1826 ssDNA motif, RCA-2006 ssDNA motif, or RCA-2138 ssDNA motif.

[0011] More preferably, the ssDNA motif is the RCA-1826 ssDNA motif.

[0012] In one embodiment of the present invention, fish pathogens include Edwardsiella tarda, Vibrio anguillarum, Aeromonas hydrophila, Vibrio harveyi, and Vibrio alginolyticus.

[0013] In one embodiment of the present invention, the vaccine is an inactivated vaccine against Edwardsiella tarda;

[0014] Preferably, the vaccine is a formalin-inactivated vaccine against Edwardsiella tarda.

[0015] A second objective of this invention is to provide a vaccine that protects animals from infection by pathogens, the vaccine containing a single-stranded DNA adjuvant comprising one or more ssDNA motifs;

[0016] The ssDNA motif includes a HindIII restriction site sequence, a random ssDNA sequence, and a polyG sequence.

[0017] The single-stranded DNA adjuvant has a circular structure.

[0018] In one embodiment of the present invention, the ssDNA motif is selected from one of the following: RCA-DZ ssDNA motif, RCA-1826 ssDNA motif, RCA-2006 ssDNA motif, or RCA-2138 ssDNA motif.

[0019] Preferably, the ssDNA motif is the RCA-1826 ssDNA motif.

[0020] A third objective of this invention is to provide the application of the above-described vaccine for protecting animals from pathogenic bacteria in the preparation of a kit for protecting animals from pathogenic bacteria.

[0021] A fourth object of the present invention is to provide a kit for protecting animals from pathogenic bacteria infection, characterized in that the kit contains the aforementioned vaccine for protecting animals from pathogenic bacteria infection.

[0022] Rolling circle amplification (RCA) is an isothermal nucleic acid amplification technique that uses circular single-stranded DNA (cssDNA) as a template to form long-chain ssDNA molecules containing repetitive copies. This method possesses both strand translocation and sustained catalytic functions (RR Garafutdinov, et al. Appl. Biochem. Biotech. 2020, 190:758-771.). This enzymatic synthesis method greatly simplifies operations, reduces equipment requirements, improves production efficiency, and minimizes environmental pollution. Circular single-stranded DNA, a unique nucleic acid structure, is composed of multiple identical ssDNA motifs. These motifs can be designed to contain functional elements, such as DNA aptamers, CpG motifs, and restriction endonuclease cleavage sites, to generate RCA products. These functional domains facilitate the self-assembly of the RCA-generated ssDNA into nanostructures, thereby enhancing nuclease resistance (S. Rattanakiat, et al. Eur. J. Pharm. Sci. 2012, 147:352-358.).

[0023] Compared with the prior art, the present invention has the following beneficial effects:

[0024] This invention designs a single-stranded DNA adjuvant (RCA-DZ) composed of multiple identical ssDNA motifs. The ssDNA motifs include a random ssDNA sequence (within 25 nt), a polyG sequence, and a HindIII restriction site. RCA-1826 is the preferred design of RCA-DZ (the random ssDNA sequence is the ODN 1826 sequence). This invention synthesizes the single-stranded DNA adjuvant via rolling circle amplification, achieving efficient preparation and reducing the synthesis cost. The single-stranded DNA adjuvant provided by this invention exhibits good biosafety and stability, can be phagocytosed by macrophages under naked delivery conditions, and can effectively upregulate the expression of immune factors. Composed of single-stranded DNA with varying numbers of motifs, this single-stranded DNA adjuvant has the potential to serve as a vaccine adjuvant and can significantly enhance the immunoprotective effect of inactivated Edwardsiella tarda vaccines. Attached Figure Description

[0025] Figure 1 A is a schematic diagram of the synthesis process of RCA-1826; Figure 1 B is a structural simulation diagram of RCA-1826.

[0026] Figure 2 A is a PAGE electrophoresis image of the template sequence cssDNA of RCA-1826; Figure 2 B and 2C are agarose gel electrophoresis images of RCA-1826; Figure 2 D shows the purification and recovery results of RCA-1826.

[0027] Figure 3 A and Figure 3 B represents the particle size, zeta potential, and morphological characteristics of the single-stranded DNA adjuvant RCA-1826. Figure 3 Figure C represents the nuclease resistance of the single-stranded DNA adjuvant RCA-1826 in fetal bovine serum.

[0028] Figure 4 A represents the biosafety results of the single-stranded DNA adjuvant RCA-1826 in RAW264.7 cells; Figure 4 B and 4C represent the delivery efficacy of the single-stranded DNA adjuvant RCA-1826 in RAW264.7 cells. Figure 4 B represents the results observed under a fluorescence microscope. Figure 4 C represents the results of flow cytometry analysis.

[0029] Figure 5 A shows the upregulation of immune factors in RAW264.7 cells by the single-stranded DNA adjuvants RCA-DZ and RCA-1826 (compared to different adjuvants). Figure 5B represents the upregulation of immune factors in RAW264.7 cells by the single-stranded DNA adjuvant RCA-DZ with different random sequences; Figure 5 C represents the first result of upregulation of immune factors in RAW264.7 cells after inhibitor treatment; 5D represents the second result of upregulation of immune factors in RAW264.7 cells by single-stranded DNA adjuvant RCA-1826 (compared to different adjuvants); 5E represents the second result of upregulation of immune factors in RAW264.7 cells by single-stranded DNA adjuvant RCA-1826 after inhibitor treatment.

[0030] Figure 6 A and Figure 6 B represents the upregulation of immune factors in zebrafish by the single-stranded DNA adjuvants RCA-1826 and RCA-DZ. Figure 6 C represents the immunoprotective effect of a single-stranded DNA adjuvant combined with an inactivated Edwardsiella pneumoniae vaccine. Detailed Implementation

[0031] The present invention will now be described in detail with reference to the accompanying drawings and specific embodiments.

[0032] Unless otherwise specified, all reagents used in the following embodiments are commercially available reagents, and all detection methods and techniques used are conventional detection methods and techniques in the art.

[0033] Example 1

[0034] This embodiment provides the design of a single-stranded DNA adjuvant, as detailed below:

[0035] The single-stranded DNA adjuvant is a single-stranded DNA fragment composed of multiple identical ssDNA motifs, synthesized via rolling circle amplification using Phi29 DNA polymerase. The ssDNA motif consists of a HindIII restriction site (SEQ ID NO.1 (5'-3'): AGCTT), a random ssDNA sequence, and a polyG sequence (SEQ ID NO.2 (5'-3'): GAGGGGGGGAA), with ODN 1826 being the preferred design of the random ssDNA sequence.

[0036] RCA-DZ ssDNA sequence (SEQ ID NO. 3, 5'-3'): AGCTTGGGTCTGACGCTCAGTGGAACGAAGAGGGGGGGAA;

[0037] RCA-1826 ssDNA sequence (SEQ ID NO. 4, 5'-3'): AGCTTTCCATGACGTTCCTGACGTTGAGGGGGGGAA;

[0038] RCA-2006 ssDNA sequence (SEQ ID NO. 5, 5'-3'): AGCTTTCGTCGTTTTGTCGTTTTGTCGTTGAGGGGGGGAA;

[0039] RCA-2138 ssDNA sequence (SEQ ID NO. 6, 5'-3'): AGCTTTCCATGAGCTTCCTGAGCTTGAGGGGGGGAA.

[0040] Example 2

[0041] This embodiment provides the preparation of single-stranded DNA adjuvants (taking RCA-1826 as an example, such as...). Figure 1 A and Figure 1 As shown in B), the details are as follows:

[0042] The ODNs are shown in Table 1 (synthesized by Tsingke). The 1826-F sequence (as shown in Table 1) was phosphorylated at the 5' end by reacting at 37°C for 2 h in an aqueous solution containing 50 U / mL T4PNK, 500 mM Tris-HCl (25°C, pH 7.6), 100 mM MgCl2, 50 mM dithiothreitol (DTT), 1 mM spermidine, and 1 mM EDTA. This was followed by mixing with an equal volume of Splint sequence (as shown in Table 1), heating at 90°C for 10 min, and then slowly cooling to 25°C over 2.5 h. The mixture was then reacted at 22°C for 12 h in an aqueous solution containing 2.5 U / mL T4 DNA ligase, 66 mM Tris-HCl (pH 7.6), 6.6 mM MgCl2, 10 mM DTT, and 0.1 mM ATP to prepare circular single-stranded DNA (cssDNA). The cssDNA was then purified by ethanol precipitation.

[0043] Rolling circle amplification system: 0.1 mM cssDNA, 32 U / mL Phi29 DNA polymerase, 50 mM Tris-HCl (pH 7.5), 10 mM MgCl2, 10 mM (NH4)2SO4, 4 mM DTT, 200 μg / mL BSA, and 0.1 mM of each dNTP. The reaction was carried out at 30 °C and 400 rpm for 48 h, followed by heat inactivation at 65 °C for 10 min. RCA-1826 was purified by ethanol precipitation and vacuum freeze-drying.

[0044] Table 1 Summary of ODN sequences used in the synthesis of RCA-1826

[0045]

[0046] like Figure 2As shown in Figure A, the CSSDNA product contains multiple bands, corresponding to n×CSSDNA, 2×CSSDNA, and 1×CSSDNA, respectively, each composed of different numbers of ssDNA motifs. After purification of the three bands, rolling circle amplification was performed, and the amplification products were detected by agarose gel electrophoresis. Figure 2 As shown in B, RCA was successful for all three CSSDNA templates. The larger the molecular weight of the CSSDNA template, the larger the molecular weight of the RCA product. The high molecular weight DNA product (RCA-1826) remained in the sample well during electrophoresis. Figure 2 C); The morphology of RCA-1826 after purification at different yields is as follows: Figure 2 As shown in D. In summary, RCA-1826 can be produced in large quantities via rolling circle amplification, and the presence of the splint sequence can serve as a primer for the RCA reaction, further reducing primer costs.

[0047] Performance Analysis: Physicochemical Characteristics of Single-Stranded DNA Adjuvants

[0048] (1) Particle size, zeta potential and transmission electron microscopy image of RCA-1826

[0049] RCA-1826 was dissolved in DEPC water and filtered through a 0.22 μm filter membrane. The particle size and zeta potential of RCA-1826 were characterized using a Malvern Zetasizer NanoZS90 instrument, with each sample analyzed three times. In addition, the morphological characteristics of RCA-1826 were observed by transmission electron microscopy (10 μL of RCA-1826 solution was placed on a clean copper grid, allowed to dry naturally, and then the morphology of RCA-1826 was observed).

[0050] like Figure 3 As shown in Figure A, the average hydrodynamic diameter of the RCA-1826 nanoparticles is 63.05 nm and the zeta potential is -5.75 mV, as determined by dynamic light scattering (DLS). Figure 3 B represents the morphological characteristics of RCA-1826, revealing that RCA-1826 consists of dispersed spherical nanoparticles.

[0051] (2) Stability of RCA-1826

[0052] RCA-1826 was mixed with an equal volume of fetal bovine serum and incubated at 37°C. Nuclease activity was inhibited by adding 0.5M EDTA (2 μL EDTA per 10 μL reaction solution) at 0, 1, 2, 4, 6, 12, and 24 h after incubation. Stability was assessed by 1% agarose gel electrophoresis.

[0053] like Figure 3As shown in C, the single-stranded linear DNA sequence (1826-R) was completely degraded within 4-6 hours under the same conditions, while RCA-1826 remained well in agarose gel and formed diffuse bands, exhibiting more significant nuclease resistance and remaining active for a longer time in 50% FBS.

[0054] Example 3

[0055] This embodiment provides the in vitro delivery effect of single-stranded DNA adjuvants (taking RCA-1826 as an example), as detailed below:

[0056] (1) Cytotoxicity test of RCA-1826

[0057] Twelve hours before drug administration, RAW264.7 cells were seeded in 96-well plates. When the cells reached 60–70% confluence, they were treated for 24 hours with different concentrations of RCA-1826 (0, 0.5 μg / mL, 1 μg / mL, 2 μg / mL, 4 μg / mL, and 8 μg / mL). After removing the treatment medium, the cells were treated for 2 hours with fresh complete medium containing 10% (v / v) CCK-8 reagent (Beyotime); then, the absorbance was measured at 450 nm using a microplate reader.

[0058] The CCK8 assay was used to determine the cytotoxicity of RCA-1826 against RAW264.7 cells, such as... Figure 4 As shown in Figure A, RCA-1826 did not exhibit significant cytotoxicity, and it also did not react with the CCK-8 reagent. These results confirm that RCA-1826 has good cell compatibility within the tested concentration range.

[0059] (2) In vitro delivery efficacy test of RCA-1826

[0060] Using Label Cy TM 5. RCA-1826 was fluorescently labeled using a Labeling Kit (NeoBioscience). 24-well plates were seeded with RAW264.7 cells 12 hours before administration. When cells reached 60–70% confluence, they were treated with Cy5-labeled RCA-1826 (final concentration 1 μg / mL) for specific time periods (2, 4, and 6 hours).

[0061] Cell nuclei were labeled with Hoechst 33258 (Beyotime); RCA-1826 internalization was observed using laser confocal microscopy. Furthermore, the in vitro delivery efficiency of RCA-1826 was assessed by flow cytometry. Six hours after transfection with Cy5-labeled RCA-1826 (final concentrations of 1, 2, and 4 μg / mL), the original culture medium was discarded, cells were collected, washed twice with PBS, and analyzed by flow cytometry (fluorescence intensity was analyzed using FlowJo software).

[0062] like Figure 4 As shown in Figure B, RCA-1826 can enter RAW264.7 cells under naked delivery conditions, and Cy5 fluorescence can be observed by fluorescence microscopy 2 hours after administration, with the number of positive cells increasing with increasing administration time. Furthermore, flow cytometry analysis also reflected similar results. Figure 4 C) After 6 hours of administration, the proportion of positive cells was significantly increased compared to the control group, and gradually increased with the increase of RCA-1826 dose.

[0063] Example 4

[0064] This embodiment provides the immunostimulatory effect of single-stranded DNA adjuvant and its evaluation in fish, as detailed below:

[0065] (1) Immunostimulatory effect of single-stranded DNA adjuvant in RAW264.7 macrophages

[0066] Twelve hours before drug administration, RAW264.7 cells were seeded in 24-well plates. When the cells reached a confluence of 60–70%, the immunostimulatory effects of RCA-DZ, RCA-1826, RCA-2006, and RCA-2138 on RAW264.7 cells were evaluated by naked drug delivery (1 μg / well). The control group included other nucleic acid adjuvants (ODN 1826, c-di-GMP, and poly(I:C)), the HACC group (hydroxypropyltrimethylammonium chloride chitosan (HACC) delivery nucleic acid adjuvant groups, namely HACC+ODN 1826, HACC+c-di-GMP, HACC+poly(I:C), and HACC+ssDNA, with HACC and each nucleic acid adjuvant mixed at a mass ratio of 5:1, incubated at room temperature for 20 min before being administered to cells), the dsDNA group (pVAX1 plasmid, naked delivery), and the ssDNA group (denatured plasmid single-stranded DNA, naked delivery). At 6 h and 24 h after administration, all cells and culture supernatant (500 μL) were collected for qPCR and ELISA detection, respectively.

[0067] In the STING / TLR9 inhibition assay, RAW264.7 cells were pretreated with 2 μM E6446 (TLR7 / 9 inhibitor, MedChemExpress) and / or 3 μM H-151 (STING inhibitor, MedChemExpress) for 2 h, followed by stimulation with RCA-1826 (1 μg / well).

[0068] qPCR procedure: Cell samples were collected 6 hours after transfection, and total RNA was extracted using Trizol (Invitrogen) for RT-qPCR. cDNA was synthesized using the FastQuant RT Kit (TransGen). RT-qPCR was performed on the SuperReal PreMix Plus (SYBR Green) (Monad) vector. GAPDH was used as an internal reference gene. Relative gene expression levels were calculated using the 2-ΔΔCt method. Primers used are shown in Table 2.

[0069] ELISA Procedure: The secretion of cytokines in the culture supernatant 24 hours after transfection was detected using an ELISA kit. The secretion levels of IL-6 and TNF-α were measured using a commercially available ELISA kit (Genever) according to the manufacturer's protocol.

[0070] Table 2. qPCR primers used in this study

[0071]

[0072]

[0073] like Figure 5 As shown in Figure A, the mRNA levels of immune factors indicate that, without a delivery carrier, RCA-1826 and RCA-DZ molecules significantly upregulate the expression of various immune factors compared to other immunostimulatory molecules (ODN 1826, c-di-GMP, and poly(I:C)). When HACC is added as a delivery carrier, the efficiency of ODN 1826 and other nucleic acid adjuvants in entering cells is significantly improved, but their immunostimulatory effect is significantly weaker than that of RCA-1826 and RCA-DZ molecules without a delivery carrier. Similarly, similar results can be reflected in the protein expression levels of immune factors. Figure 5 B) In general, RCA-1826 and RCA-DZ have significant immunostimulatory effects.

[0074] like Figure 5As shown in C, replacing the random sequence in RCA-DZ with other sequences such as ODN2006 and ODN2138, the changes in the mRNA levels of immune factors show that the immunostimulatory effects of RCA-DZ, RCA-1826, RCA-2006, and RCA-2138 are significantly stronger than those of dsDNA and ssDNA groups. Moreover, the immunostimulatory effects of these four types of molecules are similar. Therefore, RCA-DZ can be used as an effective immunostimulatory adjuvant with a strong immunostimulatory effect, and the adjustment of its random sequence does not affect the immunostimulatory effect of single-stranded DNA adjuvants.

[0075] like Figure 5 As shown in D and 5E, the inhibitor model revealed that single-stranded DNA adjuvant (RCA-1826 as an example)-mediated immune activation is achieved through the synergistic effect of TLR7 / 9 and STING signaling pathways. Under the combined action of TLR7 / 9 pathway inhibitor E6446 and STING pathway inhibitor H-151, the upregulation of immune factors stimulated by RCA-1826 was significantly reduced. Figure 5 D represents the mRNA level. Figure 5 E represents the protein expression level, and the downregulation effect is far greater than that of a single inhibitor.

[0076] (2) Immunostimulatory effect of single-stranded DNA adjuvant in zebrafish

[0077] To assess the expression of immune genes in vivo, kidney and spleen tissues were collected and analyzed by RT-qPCR. Zebrafish were first anesthetized with MS-222 (final concentration 100 mg / L), followed by intraperitoneal injection of RCA-1826 or RCA-DZ (1 μg). Tissue samples were collected at 6, 12, and 24 hours post-transfection for RT-qPCR detection, using the same methods as above. -ΔΔCt The expression levels of relevant genes were calculated using the method. The primers used are shown in Table 2.

[0078] like Figure 6 A and Figure 6 As shown in Figure B, after administration of RCA-1826 or RCA-DZ, the transcriptional levels of IL-6, TNF-α, and IL-1β in the somatic kidney were significantly upregulated. Figure 6 A), and similar results were also reflected in spleen tissue, where the transcriptional levels of IL-6, TNF-α, and IL-1β were significantly upregulated. Figure 6 B), therefore, both RCA-1826 and RCA-DZ can stimulate the innate immunity of zebrafish and upregulate the expression of various cytokines, thus possessing the potential to serve as vaccine adjuvants.

[0079] (3) Evaluation of the efficacy of single-stranded DNA adjuvant combined with inactivated vaccine in fish

[0080] Edwardsiella tarda vaccine was prepared using the formalin inactivation method. Resuscitated bacteria EIB202 (CCTCC No. M208068) were inoculated into TYB (1% (v / v) of resuscitated bacteria EIB202) and cultured (30°C, 12 h); then the bacterial suspension was treated with 0.2% (v / v) formalin under constant stirring (200 rpm) for 24 h to obtain the inactivated Edwardsiella tarda vaccine.

[0081] Zebrafish (2.5–3.5 cm in length) were randomly divided into two groups of 30 each. They were intraperitoneally injected with 10 μL of an inactivated vaccine (FKC, 10 μL) formulated with different adjuvants. 7 CFU / tail). Specific groupings include: PBS (as negative control), FKC (10...). 7 CFU / tail), HACC(5μg)+FKC (as vector control), HACC(5μg)+ODN 1826(1μg)+FKC, HACC(5μg)+poly(I:C)(1μg)+FKC, HACC(5μg)+c-di-GMP(1μg)+FKC, RCA-1826(1μg)+FKC, RCA-DZ(1μg)+FKC.

[0082] The nucleic acid adjuvant (ODN1826, polyI:C, c-di-GMP) was mixed with HACC at a ratio of 5:1 (w / w), incubated for 20 min, and then combined with FKC for immunization of the fish. Twenty-eight days after immunization, each group of zebrafish (n=30) was intraperitoneally injected with 10 μL of Edwardsiella tarda EIB202 (CCTCC No. M208068, 10...). 6 (CFU / tail). Zebrafish survival rate was monitored for 7 consecutive days.

[0083] Combining single-stranded DNA adjuvants with inactivated vaccines provides the following immunoprotective effect: Figure 6 As shown in Figure C, the mortality rate in the PBS group reached 60% within 7 days post-infection, while both the RCA-1826+FKC and RCA-DZ+FKC groups significantly improved the resistance of zebrafish to Edwardsiella pneumoniae, with RPS reaching 94.44% and 88.88%, respectively, significantly superior to other adjuvants. Therefore, single-stranded DNA sequences prepared using RCA technology have the potential to serve as vaccine adjuvants, significantly enhancing the immunoprotective effect of inactivated vaccines in fish.

[0084] The above description of the embodiments is provided to enable those skilled in the art to understand and use the invention. It will be apparent to those skilled in the art that various modifications can be made to these embodiments, and the general principles described herein can be applied to other embodiments without inventive effort. Therefore, the present invention is not limited to the above embodiments, and any improvements and modifications made by those skilled in the art based on the interpretation of the present invention, without departing from the scope of the invention, should be within the protection scope of the present invention.

Claims

1. The use of a single-stranded DNA adjuvant in the preparation of vaccines that protect animals from pathogenic bacterial infection, characterized in that, The single-stranded DNA adjuvant comprises one or more ssDNA motifs; The ssDNA motif includes a HindIII restriction site sequence, a random ssDNA sequence, and a polyG sequence. The single-stranded DNA adjuvant has a circular structure.

2. The application according to claim 1, characterized in that, The ssDNA motif is selected from one of the following: RCA-DZ ssDNA motif, RCA-1826 ssDNA motif, RCA-2006 ssDNA motif, or RCA-2138 ssDNA motif.

3. The application according to claim 2, characterized in that, The ssDNA motif is the RCA-1826 ssDNA motif.

4. The application according to claim 1, characterized in that, Pathogenic bacteria include Edwardsiella tarda, Vibrio anguillarum, Aeromonas hydrophila, Vibrio harveyi, and Vibrio alginolyticus.

5. The application according to claim 1, characterized in that, The vaccine is an inactivated vaccine against Edwardsiella tarda.

6. A vaccine that protects animals from infection by pathogenic bacteria, characterized in that, The vaccine contains a single-stranded DNA adjuvant, which includes one or more ssDNA motifs. The ssDNA motif includes a HindIII restriction site sequence, a random ssDNA sequence, and a polyG sequence. The single-stranded DNA adjuvant has a circular structure.

7. A vaccine for protecting animals from pathogenic bacteria according to claim 6, characterized in that, The ssDNA motif is selected from one of the following: RCA-DZ ssDNA motif, RCA-1826 ssDNA motif, RCA-2006 ssDNA motif, or RCA-2138 ssDNA motif.

8. A vaccine for protecting animals from pathogenic bacteria according to claim 7, characterized in that, The ssDNA motif is the RCA-1826 ssDNA motif.

9. The use of a vaccine as described in any one of claims 6 to 8 for protecting animals from pathogenic bacteria infection in the preparation of a kit for protecting animals from pathogenic bacteria infection.

10. A kit for protecting animals from pathogenic bacterial infection, characterized in that, The kit contains the vaccine according to any one of claims 6 to 8 that protects animals from pathogenic bacteria infection.

Images