Method for regulating and controlling liquid-liquid phase separation capacity and function of DUX4 and application of method

By mutating the intrinsic disordered region of the DUX4 protein, its liquid-liquid phase separation ability was regulated, which solved the problem of abnormal DUX4 aggregation in FSHD and realized the potential therapeutic effect on FSHD.

CN120865375APending Publication Date: 2025-10-31NORTHWEST A & F UNIV
View PDF 0 Cites 1 Cited by

Patent Information

Application Number
CN202510966624.7
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-07-14
Publication Date
2025-10-31

AI Technical Summary

Technical Problem

The lack of effective methods to regulate the liquid-liquid phase separation ability and function of DUX4 in the current technology leads to the formation of pathological aggregates in FSHD, affecting muscle tissue, and there are no effective treatments.

Method used

By mutating the intrinsic disordered region of the DUX4 protein, especially arginine at position 71 or 73, to alanine, an intracellular liquid-liquid phase separation model was constructed, and its liquid-liquid phase separation ability and function were regulated by overexpression technology.

Benefits of technology

It effectively disrupts the liquid-liquid phase separation ability of DUX4 and significantly inhibits the expression of DUX4-activated pluripotent genes and FSHD-related genes, providing insights for the research and treatment of FSHD.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120865375A_ABST
    Figure CN120865375A_ABST
Patent Text Reader

Abstract

The invention relates to the technical field of biomedicine, in particular to a method for regulating and controlling the liquid-liquid phase separation capacity and function of DUX4 and application of the method, and the liquid-liquid phase separation capacity and function of the DUX4 are regulated and controlled by mutating an internal disordered region of the DUX4. The invention finds that the mutation has a remarkable inhibition effect on expression of DUX4 activated totipotent genes and FSHD related genes; according to the method, an intracellular liquid-liquid phase separation model is constructed through intracellular overexpression of DUX4; a research basis and a model are provided for subsequent LLPS research of DUX4, and thinking and mechanism explanation are provided for research of DUX4-mediated facial shoulder brachial muscular dystrophy (FSHD) and development of treatment targets.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biomedical technology, and in particular to a method for regulating the liquid-liquid phase separation capability and function of DUX4 and its application. Background Technology

[0002] Liquid-liquid phase separation (LLPS) is a crucial physicochemical process in which biomolecules form dynamic, membrane-free structures within cells through multivalent interactions. Intrinsically disordered regions (IDRs) are not the sole promoters of these interactions; lacking stable 3D structures, their structural heterogeneity allows interacting molecules to engage in forces from multiple directions, leading to unstable binding and separation, ultimately mediating protein LLPS. LLPS participates in key biological events such as gene transcription, signal transduction, and organelle function by regulating the spatial aggregation of components like proteins and nucleic acids. Studies have shown that abnormalities in LLPS are closely related to various diseases: in neurodegenerative diseases, altered phase-separation abilities of RNA-binding proteins such as TDP-43 and FUS can lead to the formation of pathological aggregates; in tumorigenesis, oncogenes (such as MED1) abnormally enrich transcriptional regulatory complexes through phase separation, driving the overactivation of oncogenes. Recent studies have found that various transcription factors can form "transcriptional condensates" through LLPS, dynamically regulating chromatin accessibility and gene expression programs. Notably, dysregulation of LLPS under pathological conditions may participate in disease progression through mechanisms such as enhancing the aggregation stability of toxic proteins, disrupting cellular homeostasis, or abnormally activating signaling pathways.

[0003] Facioscapulohumeral Muscular Dystrophy (FSHD) is the third most common hereditary muscle disease, with a prevalence of approximately 1 in 8,333 people. This disease exhibits a significant age-related pattern, with peak clinical incidence occurring during adolescence and early adulthood. Its core pathological changes are progressive muscle weakness, accompanied by fibrotic remodeling and fatty infiltration of muscle tissue (Cohen J et al., 2021). Notably, FSHD patients show a characteristic pattern of muscle involvement: initially affecting facial muscles, shoulder girdle muscles, and upper arm muscles, it gradually extends to both lower limbs as the disease progresses. Typical cases often begin with distal lower limb muscles, followed by proximal lower limbs and pelvic girdle muscles (Jordan B et al., 2011). Clinical manifestations include inability to raise the upper limb horizontally, incomplete eyelid closure, inability to puff out the cheeks, winged scapula, "Popeye arms," ​​and "multiple mounds." Approximately 20%–30% of patients may also experience extramuscular manifestations such as ptosis, retinal microvascular disease, high-frequency hearing loss, and dysphagia; a few cases may even involve the respiratory and cardiovascular systems. Of particular concern is the asymmetrical involvement of bilateral muscle groups commonly observed in FSHD patients; this differential damage has become an important diagnostic criterion. FSHD patients generally exhibit a slow but steady progression of muscle weakness, which typically does not affect lifespan but significantly impacts quality of life. By age 50, approximately 20% of patients require wheelchair use. Therefore, accelerating medical research on FSHD is urgently needed.

[0004] FSHD is an epigenetic disorder whose core pathogenic mechanism lies in the abnormal activation of the embryonic development-specific gene DUX4 and the cascade of pathological reactions it triggers. Normally, the DUX4 gene is silenced by epigenetic mechanisms after regulating myogenic differentiation in early embryonic development. However, in FSHD patients, genetic defects in the D4Z4 repeat sequence at the 4q35 chromosome terminal or mutations in epigenetic regulatory factors lead to abnormal decompression of the chromatin three-dimensional structure, causing DUX4 to be re-expressed in adult skeletal muscle. FSHD type 1 (95% of cases) originates from a significant deletion (≤10 repeats) of large D4Z4 repeat sequences, while FSHD type 2 (5% of cases) is associated with mutations in chromatin-silencing genes such as SMCHD1 and LRIF1. Both types release transcriptional repression of DUX4 by disrupting the heterochromatin stability of the D4Z4 region. The DUX4 protein, a dual homeobox transcription factor, specifically binds to the TAAT motif promoter, activating downstream pro-apoptotic genes (such as PITX1 and TRIM43), inflammatory cytokines (CCL2 and IL-6), and muscle atrophy-related pathways. Simultaneously, it inhibits the key muscle regeneration factor (MYOD1), inducing myocyte apoptosis, oxidative stress, and mitochondrial dysfunction. Both of these types lead to aberrant expression of the transcription factor DUX4 and cytotoxicity in skeletal muscle cells.

[0005] There is now a consensus on the root cause of FSHD (i.e., the presence of DUX4 in skeletal muscle). Currently, apart from symptomatic and supportive treatment, there is no effective way to cure FSHD. Does DUX4 in the skeletal muscle cell nucleus undergo LLPS? Does its IDR region affect the formation of LLPS in DUX4 protein? And does influencing its LLPS have a salvage effect on the FSHD it causes? Therefore, we have conducted in-depth research and provided a method for regulating the liquid-liquid phase separation ability and function of DUX4 to solve the above technical problems. Summary of the Invention

[0006] The technical problem to be solved by this invention is to provide a method and its application for regulating the liquid-liquid phase separation ability and function of DUX4. It was found that this mutation has a significant inhibitory effect on the expression of DUX4 activation totipotency genes and FSHD-related genes. By overexpressing DUX4 in cells, an intracellular liquid-liquid phase separation model was constructed. This provides a research basis and model for subsequent DUX4 LLPS research, and provides ideas and mechanistic explanations for the research and treatment of DUX4-related diseases.

[0007] To solve the above-mentioned technical problems, the present invention adopts the following technical solution:

[0008] A method for regulating the liquid-liquid phase separation capability and function of DUX4 is proposed, which involves mutating the inherent disordered region of DUX4 to regulate its liquid-liquid phase separation capability and function.

[0009] Preferably, this is achieved by mutating arginine at position 71 of DUX4 or arginine at position 73 to alanine.

[0010] The DUX4 encoding sequence is derived from the NCBI database, CDS sequence number: CCDS77990.1 GeneID: 100288687 ProteinID: NP_001292997.1 .

[0011] Preferably, molecular cloning is used to construct a fusion EGFP expression vector of wild type and mutant, with the coding sequence of DUX4 as the wild type control, and a mutant with arginine at position 71 or 73 mutated to alanine is constructed based on this.

[0012] Preferably, the eukaryotic expression vector fused with the EGFP expression vector uses the lentiviral vector pLVX-TetOn-EGFP-Neo as the backbone, with the inserted sequences being the protein coding regions of the gene DUX4 and its mutant, respectively, to construct overexpression vectors for DUX4 and its mutant, respectively.

[0013] The protein-coding region was inserted between the restriction sites Bamh1 and Hpa1 of the lentiviral vector pLVX-TetOn-EGFP-Neo to obtain their respective eukaryotic expression vectors.

[0014] Preferably, an intracellular liquid-liquid phase separation model of DUX4 and its mutants is established, and the intracellular protein expression of wild-type and mutants is carried out by using overexpression technology. Specifically, equal amounts of the above-mentioned expression vectors of DUX4 and its mutants are transfected into cells by liposome transfection, thereby expressing their protein products in the cells.

[0015] Intracellularly, protein products undergo liquid-liquid phase separation. The results are compared based on the liquid-liquid phase separation, and the protein products that have undergone liquid-liquid phase separation are subjected to fluorescence recovery testing after intracellular bleaching.

[0016] Preferably, the liquid-liquid phase separation of DUX4 is disrupted in a cell model by mutating the inherent disordered region of DUX4; the ability of DUX4 to activate pluripotent genes and FSHD-related genes was verified in a cell model.

[0017] Specifically, the expression of proteins in wild-type and mutant cells was carried out using overexpression technology, and then the expression of totipotency genes and FSHD-related genes in cells was detected by cell proliferation toxicity assay, dual-luciferase assay and real-time quantitative PCR (qPCR).

[0018] An amino acid that affects the liquid-liquid phase separation and function of DUX4 obtained by any of the methods described above, wherein the amino acid affecting the liquid-liquid phase separation and function of DUX4 is arginine at position 71 or arginine at position 73.

[0019] The above-mentioned amino acid that affects the liquid-liquid phase separation and function of DUX4 is used in the development of drugs for the treatment of FSHD by targeting the angle that affects the liquid-liquid phase separation of DUX4.

[0020] The application of the aforementioned amino acid that affects the liquid-liquid phase separation and function of DUX4 in an animal model of related mutations established through the single amino acid site.

[0021] The above-mentioned amino acid affecting the liquid-liquid phase separation and function of DUX4 is used in the preparation of drugs for treating DUX4-related diseases, wherein the drugs include compounds, peptides, proteins, gene therapy vectors, and drug development targets.

[0022] The beneficial effects of this invention are:

[0023] This invention provides a method for regulating the liquid-liquid phase separation capability and function of DUX4 by mutating the disordered region of DUX4. Specifically, it regulates the liquid-liquid phase separation capability and function by mutating arginine at position 71 or arginine at position 73.

[0024] 2. The purpose of this invention is to provide a method for regulating the liquid-liquid phase separation ability and function of DUX4 by mutating a single amino acid site. First, an intracellular liquid-liquid phase separation model is constructed by overexpressing DUX4. For the first time, it was discovered that DUX4 possesses liquid-liquid phase separation characteristics. Furthermore, experiments verified that mutating arginine at position 71 or 73 can effectively disrupt its liquid-liquid phase separation ability. Moreover, this mutation was found to significantly inhibit the expression of DUX4-activated totipotency genes and FSHD-related genes.

[0025] 3. This invention has found that this mutation has a significant inhibitory effect on the expression of DUX4 activation pluripotency genes and FSHD-related genes, which is helpful for the development of related drugs. It is expected that by regulating the polymerization ability and function of DUX4 protein, intervention and treatment of FSHD can be achieved.

[0026] 4. This invention constructs an intracellular liquid-liquid phase separation model by overexpressing DUX4 in cells; it provides a research foundation and model for subsequent LLPS research of DUX4, and provides ideas and mechanistic explanations for the research and treatment of DUX4-related diseases. Attached Figure Description

[0027] Figure 1 This invention aims to validate the liquid-liquid phase separation properties of the DUX4 protein within cells and to construct a liquid-liquid phase separation mutant.

[0028] Figure A shows the IDR sequence of DUX4 predicted by the online server: https: / / iupred2a.elte.hu / .

[0029] Image B: A representative image of DUX4-EGFP expression in NIH3T3 cells, showing DUX4-EGFP forming punctate aggregates within the cell nucleus. The blue DAPI markers indicate the cell nuclei. Magnification: 60 × 10, Scale bar: 5 μm.

[0030] Figure C: Time-lapse image of DUX4-EGFP in 293T cells during photobleaching recovery experiments. The white dashed line outlines the cell nucleus, and the white arrows indicate that after laser bleaching, the fluorescence of highly fluorescent aggregates disappeared and then rapidly recovered within 1 minute. Magnification: 100×10, Scale bar: 5μm. Below are the curves showing the changes in relative fluorescence intensity (real-time fluorescence intensity / initial fluorescence intensity) recorded in the photobleaching experiments of the three aggregates.

[0031] Figure D: Representative image of the single-amino acid site mutant DUX4-EGFP expressed in NIH3T3 cells. The mutant is diffusely distributed within the cell nucleus without aggregate formation. Magnification: 60×10, Scale bar: 5μm.

[0032] Figure 2 This invention relates to the effect of the DUX4 mutant on the liquid-liquid phase separation function of DUX4.

[0033] Figure A shows the co-transfection of 293T cells with the DUX4 and single-amino acid site mutants and control plasmids, along with the totipotency gene luciferase reporter vector (MERVL 1-730LUC), followed by a dual-luciferase experiment.

[0034] Figures B and C: 293T cells were transfected with DUX4, single amino acid site mutants, and control plasmids, and then qPCR was performed on totipotency genes and FSHD-related genes (Figure B) and cell viability assay (Figure C). Detailed Implementation

[0035] To facilitate understanding by those skilled in the art, the present invention will be further described below with reference to embodiments and accompanying drawings. The content mentioned in the embodiments is not intended to limit the present invention.

[0036] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.

[0037] Unless otherwise specified, all materials and reagents used in the following examples are commercially available.

[0038] NIH3T3 cells: ATCC cell bank, #CRL-1658.

[0039] 293T cells: ATCC cell bank, #CRL-3216.

[0040] Firefly and Renalis Dual-Luciferase Reporter Gene Detection Kit: Beijing TransGen Biotech Co., Ltd., #FR201-01-v2.

[0041] Real-time fluorescence quantitative reagent kit: Jiangsu Bestway Biotechnology Co., Ltd., #EG15133S.

[0042] CCK8 reagent kit: Shanghai Beyotime Biotechnology Co., Ltd., #C0037.

[0043] Example 1

[0044] Intracellular validation of the liquid-liquid phase separation properties of DUX4 protein and construction of liquid-liquid phase separation mutants

[0045] The cells were NIH3T3 mouse embryonic fibroblasts and 293T human renal epithelial cells.

[0046] The transfected plasmids pLVX-TetOn-EGFP-DUX4-Neo and pLVX-TetOn-EGFP-DU X4(Mut)-Neo were constructed and preserved by the inventors.

[0047] The main verification methods are: 1. Formation of DUX4 aggregates in cells; 2. Photobleaching recovery of DUX4 aggregates; 3. Formation of DUX4 mutant aggregates in cells. These methods are important criteria for determining whether a protein molecule has undergone LLPS.

[0048] I. Construction of DUX4 and DUX4(Mut) fusion EGFP eukaryotic expression vectors

[0049] 1) PCR amplification of DUX4 and DUX4(Mut) fragments: Using the DUX4 plasmid preserved in the laboratory as a template, the sequence with homologous arms was amplified by PCR and purified using a universal DNA purification and recovery kit (Tiangen, #DP214).

[0050] 2) Enzyme digestion: The pLVX-TetOn-EGFP-Neo plasmid was mixed with restriction endonucleases Bamh1 and Hpa1 (Baori Biotechnology (Beijing) Co., Ltd.) and reaction buffer, and incubated at 37°C for 1 hour for double digestion; the DNA fragment was then purified by gel recovery.

[0051] 3) DNA fragment recombination: Mix the double-digested backbone plasmid with the DUX4 insert fragment and homologous recombination reagent, and incubate at 50°C for 1 hour.

[0052] 4) Transformation: The reconstituted vector was transformed into competent E. coli DH5α cells using a water bath heat shock and ice bath cooling method, and then screened with ampicillin.

[0053] 5) Sequencing: Select single clones for PCR identification, sequence the correct single clones, and select the plasmids with correct sequencing for subsequent experimental verification and preservation.

[0054] II. Verification of intracellular DUX4-EGFP aggregates

[0055] 1) Cell seeding: Seed NIH3T3 cells or 293T cells into confocal dishes one day before transfection.

[0056] 2) Plasmid transfection: The transfection system is based on liposome Lipo8000. TM Prepare the transfection reagent (Shanghai Beyotime Biotechnology Co., Ltd., #C0533) according to the instructions and add it to the culture dish. 24 hours after transfection, replace the medium with fresh medium and add 4 μg / mL Doxycycline (MCE, #HY-N0565B). Place the cells in an incubator and continue culturing for another 24 hours.

[0057] 3) Observation and imaging: Cells were removed at the above time points, fixed with 4% PFA, stained with DAPI, washed three times with PBS, and then observed and photographed under a fluorescence microscope.

[0058] 4) Photobleaching verification of DUX4-EGFP aggregates: Cells were harvested at the above time points, and FRAP measurements of intracellular aggregates were performed using the FRAP module of a Nikon super-resolution microscope system. DUX4-EGFP aggregates were bleached using a 488nm laser beam. The treatment time was adjusted according to the aggregate quenching effect, and time-lapse images were collected every 5 seconds. Fluorescence intensity was measured using a Nikon super-resolution microscope system. Fluorescence values ​​at each time point were calculated as relative to the fluorescence values ​​at the time points before bleaching.

[0059] Example 2

[0060] The impact of DUX4's disordered regions on DUX4 functionality

[0061] I. The Influence of Disordered Regions of DUX4 on the Totipotency Marker MERVL

[0062] The activation status of the MERVL luciferase vector, a marker of pluripotency, was detected using the firefly and kidney luciferase reporter gene assay kit from Beijing TransGen Biotech Co., Ltd.

[0063] The main principle is that firefly luciferase and Renilla luciferase catalyze the oxidation of luciferin or coelenterazine to form oxyluciferin or coelenteramide, respectively, generating biofluorescence in the process. This kit first detects the activity of the firefly luciferase reporter gene using a luciferin substrate, and then, while quenching the fluorescence reaction, detects the activity of the Renilla luciferase reporter gene using a coelenterazine substrate, allowing for highly efficient detection.

[0064] 1) Plasmid transfection: According to the above method, the control empty vector, DUX4 wild-type vector, and DUX4 single mutant vector were transfected into 293T cells with MERVL luciferase reporter vector and Helix reporter gene vector, respectively. After 24 hours of transfection, the culture medium was replaced with fresh medium and 4 μg / mL Doxycycline was added. The cells were then placed in an incubator and cultured for another 24 hours.

[0065] 2) Fluorescence detection: Discard the cell culture medium, add the prepared cell lysis buffer (freshly prepared), and lyse the cells on a shaker at room temperature for 30 minutes, following the instructions of the firefly and kidney luciferase reporter gene assay kit. After lysis, add Luciferase Reaction Reagent and Luciferase Reaction Reagent II, and then use a chemiluminescence analyzer to detect the activity of the firefly luciferase reporter gene and the kidney luciferase reporter gene, respectively.

[0066] 3) Calculate the ratio: Divide the activity reading of the firefly luciferase reporter gene by the activity reading of the kidney luciferase reporter gene, and normalize using the control empty vector ratio to finally obtain the activation status of MERVL by the DUX4 wild-type vector and mutant.

[0067] II. The Influence of the Disordered Regions of DUX4 on the Expression of Totipotency-Related Genes and FSHD-Related Genes

[0068] 1) Plasmid transfection: 293T cells were transfected with the control empty vector, DUX4 wild-type vector, and DUX4 single mutant vector according to the above method, and 4 μg / mL Doxycycline was added. The cells were then placed in an incubator and cultured for another 24 hours.

[0069] 2) Collect cells and extract RNA: Digest and centrifuge the cells from the culture dish to collect the cell pellet, and then extract RNA using the Total RNA Extraction Kit (#DP419) from Tiangen Biotech (Beijing) Co., Ltd.

[0070] 3) Reverse transcription and real-time quantitative PCR: The OD value of the extracted RNA was measured. 1 μg of RNA from each group was used for reverse transcription using the reverse transcription kit (#EG15133S) from Jiangsu Bestmate Biotechnology Co., Ltd. The obtained cDNA was used for real-time quantitative PCR to detect totipotency-related genes (hZscan4, hLEUTX) and FSHD-related genes (hPRAMEF12 and hTRIM43). The probe-based real-time quantitative PCR premix (#EG20118M) from Jiangsu Bestmate Biotechnology Co., Ltd. was used. The detection primers are as follows:

[0071] hActin-F:CATGTACGTTGCTATCCAGGC

[0072] hActinR: CTCCTTAATGTCACGCACGAT

[0073] hZscan4-F:TTTCAGTGTGAACCATCCGAG

[0074] hZscan4-R: AGCACCATTCTTGAGAACTCAG

[0075] hLEUTX-F:AAGGAGGAGACTCCCTCAGC

[0076] hLEUTX-R:AAAGAGAGTGGAGGCCCAAG

[0077] hPRAMEF12-F:TCACCTCTCAGTTCCTCAAGC

[0078] hPRAMEF12-R:CAGGCATTCGGTCATTACG

[0079] hTRIM43-F:ACCCATCACTGGACTGGTGT

[0080] hTRIM43-R:CACATCCTCAAAGAGCCTGA

[0081] DUX4-CA-F:TTCGAGCGCAATCCCTATCC

[0082] DUX4-CA-R:CCCAGTTTCTCTGGCGAGTT

[0083] III. The Influence of Disordered Regions of DUX4 on Cell Viability

[0084] DUX4 overexpression is toxic to cells, affecting cell viability and proliferation. The CCK8 kit from Beyotime Biotechnology Co., Ltd. was used.

[0085] Its main component, WST-8, is a compound similar to MTT. In the presence of electron coupling reagents, it can be reduced by certain dehydrogenases in mitochondria to produce orange-yellow formazan. The more and faster the cells proliferate, the darker the color; the greater the cytotoxicity, the lighter the color. For the same number of cells, the intensity of the color is linearly related to the number of cells.

[0086] 1) Plasmid transfection: 293T cells were transfected into 96-well plates with the control empty vector, DUX4 wild-type vector, and DUX4 single mutant vector according to the above method, and 4 μg / mL Doxycycline was added. The cells were then placed in an incubator and cultured for 24 hours.

[0087] 2) Measure absorbance: Add 10 μL of CCK-8 solution to each well, incubate in a cell culture incubator for 1 hour, measure absorbance at 450 nm using a microplate reader, and calculate the absorbance.

[0088] All technical features in this embodiment can be modified in appearance according to actual needs.

[0089] The above embodiments are preferred implementations of the present invention. In addition, the present invention can be implemented in other ways. Any obvious substitutions without departing from the concept of the present technical solution are within the protection scope of the present invention.

Claims

1. A method for regulating the liquid-liquid phase separation capability and function of DUX4, characterized in that: By mutating the inherent disordered region of DUX4, its liquid-liquid phase separation capability and function can be regulated.

2. The method for regulating the liquid-liquid phase separation capability and function of DUX4 according to claim 1, characterized in that: Specifically, by mutating arginine at position 71 of DUX4 or arginine at position 73 to alanine; The DUX4 encoding sequence is derived from the NCBI database, CDS sequence number: CCDS77990.1 GeneID: 100288687 ProteinID: NP_001292997.1 .

3. The method for regulating the liquid-liquid phase separation capability and function of DUX4 according to claim 2, characterized in that: Molecular cloning was used to construct fusion EGFP expression vectors of wild type and mutant, with the coding sequence of DUX4 as the wild type control. Based on this, mutants with arginine at position 71 or 73 being mutated to alanine were constructed.

4. The method for regulating the liquid-liquid phase separation capability and function of DUX4 according to claim 3, characterized in that: The eukaryotic expression vector fused with the EGFP expression vector uses the lentiviral vector pLVX-TetOn-EGFP-Neo as the backbone, with the inserted sequences being the protein coding regions of the gene DUX4 and its mutant, respectively, and overexpression vectors of DUX4 and its mutant are constructed respectively. The protein-coding region was inserted between the restriction sites Bamh1 and Hpa1 of the lentiviral vector pLVX-TetOn-EGFP-Neo to obtain their respective eukaryotic expression vectors.

5. The method for regulating the liquid-liquid phase separation capability and function of DUX4 according to claim 4, characterized in that: Intracellular liquid-liquid phase separation model of DUX4 and its mutants was established. Intracellular protein expression of wild-type and mutants was carried out by overexpression technology. Specifically, equal amounts of the above-mentioned expression vectors of DUX4 and its mutants were transfected into cells by liposome transfection, thereby expressing their protein products in cells. Intracellularly, protein products undergo liquid-liquid phase separation. The results are compared based on the liquid-liquid phase separation, and the protein products that have undergone liquid-liquid phase separation are subjected to fluorescence recovery testing after intracellular bleaching.

6. The method for regulating the liquid-liquid phase separation capability and function of DUX4 according to claim 1, characterized in that: By mutating the inherent disordered region of DUX4, the liquid-liquid phase separation of DUX4 was disrupted in a cell model; the ability of DUX4 to activate pluripotency genes and FSHD-related genes was also verified in a cell model. Specifically, the expression of proteins in wild-type and mutant cells was carried out using overexpression technology, and then the expression of totipotency genes and FSHD-related genes in cells was detected by cell proliferation toxicity assay, dual-luciferase assay and real-time quantitative PCR (qPCR).

7. An amino acid that affects the liquid-liquid phase separation and function of DUX4, obtained by the method for regulating the liquid-liquid phase separation ability and function of DUX4 as described in any one of claims 1-6, characterized in that: The amino acid that affects the liquid-liquid phase separation and function of DUX4 is arginine at position 71 or arginine at position 73.

8. The application of the amino acid that affects the liquid-liquid phase separation and function of DUX4 as described in claim 7 in the development of drugs for the treatment of FSHD by targeting the angle affecting the liquid-liquid phase separation of DUX4.

9. The application of an amino acid that affects the liquid-liquid phase separation and function of DUX4 according to claim 7 in an animal model of related mutations established through the single amino acid site.

10. The application of an amino acid affecting the liquid-liquid phase separation and function of DUX4 according to claim 7 in the preparation of a drug for treating DUX4-related diseases, characterized in that: The drugs include compounds, peptides, proteins, gene therapy vectors, and drug development targets.

Citation Information

Cited By

  • Application of OsvWA36 gene in regulation and control of grain shape and yield of rice

    CN121160791A