Fucoidin nucleic acid aptamer OUC-Fx11-5T and application thereof

Abstract

The application discloses a nucleic acid aptamer OUC-Fx11-5T of fucoxanthin and application thereof, and belongs to the technical field of nucleic acid aptamer. The nucleic acid aptamer OUC-Fx11-5T of fucoxanthin has a nucleotide sequence as shown in SEQ ID NO. 19. The nucleic acid aptamer OUC-Fx11-5T of fucoxanthin is applied to the recognition or detection of fucoxanthin. The nucleic acid aptamer OUC-Fx11-5T of fucoxanthin has an affinity dissociation constant of 68.2 nM with fucoxanthin by isothermal titration calorimetry, has no obvious affinity to structural analogs of fucoxanthin such as violaxanthin, neoxanthin, zeaxanthin and beta-carotene, has high affinity and good specificity to fucoxanthin, and can be used for the recognition or detection of fucoxanthin.

Description

Technical Field

[0001] This invention relates to a fucoxanthin nucleic acid aptamer OUC-Fx11-5T and its application, belonging to the field of nucleic acid aptamer technology. Background Technology

[0002] Fucoxanthin (Fx), also known as fucoxanthin, is one of the most representative lutein compounds, accounting for about 10% of the total production of natural carotenoids. It has functions such as anti-oxidation, anti-inflammation, anti-tumor, anti-obesity, and anti-diabetic effects.

[0003] Utilizing nucleic acid aptamers for specific target detection is currently a hot research topic. Nucleic acid aptamers are single-stranded DNA or RNA molecules that specifically recognize corresponding targets, obtained through in vitro screening using the Systematic Evolution of Ligands by Exponential Enrichment (SELEX) technique. They possess advantages such as high affinity, strong specificity, and ease of preparation and modification. Currently, there are no reports on nucleic acid aptamers that specifically recognize fucoxanthin. Summary of the Invention

[0004] In view of the above-mentioned prior art, the present invention provides a fucoxanthin nucleic acid aptamer OUC-Fx11-5T and its application, which belongs to the field of nucleic acid aptamer technology.

[0005] This invention is achieved through the following technical solution:

[0006] A fucoxanthin nucleic acid aptamer OUC-Fx11-5T, the nucleotide sequence of which is shown in SEQ ID NO.19.

[0007] The application of the fucoxanthin nucleic acid aptamer OUC-Fx11-5T in the identification or detection of fucoxanthin.

[0008] The fucoxanthin nucleic acid aptamer OUC-Fx11-5T of this invention was obtained through screening. The technical principle is as follows: a screening library was designed based on a strategy of dynamic functional base pre-embedding and co-terminal locking; nucleic acid aptamers with affinity for fucoxanthin were enriched using graphene oxide-index enrichment ligand system evolution technology (GO-SELEX) and analyzed by high-throughput sequencing; biomembrane interferometry (BLI) was used for preliminary screening of nucleic acid aptamers using high-throughput sequencing; and isothermal titration calorimetry (ITC) was used to determine the affinity and specificity of the nucleic acid aptamers. The affinity dissociation constant of the fucoxanthin nucleic acid aptamer OUC-Fx11-5T of this invention was determined by isothermal titration calorimetry. K dThe molecular weight was 68.2 nM, and it showed no significant affinity for structural analogs of fucoxanthin, such as zeaxanthin, neoxanthin, zeaxanthin, and β-carotene. This indicates that the nucleic acid aptamer has high affinity and good specificity for fucoxanthin and can be used for the identification or detection of fucoxanthin.

[0009] This invention proposes for the first time an aptamer screening method based on a dynamic functional base pre-embedding and synergistic end-locking strategy. This method embeds specific key bases into random regions of the library, which can not only effectively reduce the false rejection rate of high-potential sequences in the early screening, but also does not affect the formation of novel secondary structures and key functional domains of nucleic acid aptamers in the later stage. At the same time, by limiting the flexibility of nucleic acid aptamers through end-locking, the conformation of nucleic acid aptamers is stabilized, enhancing stability and improving screening efficiency.

[0010] The various terms and phrases used in this invention have their general meanings known to those skilled in the art. Attached Figure Description

[0011] Figure 1 : Schematic diagram of secondary structure prediction for primer-binding regions in a library.

[0012] Figure 2 Fitted curves of relative fluorescence enrichment rates for different screening rounds.

[0013] Figure 3 Bar chart showing the relative fluorescence enrichment rates for different screening rounds.

[0014] Figure 4 : Schematic diagram of the affinity measurement results between OUC-Fx9-8T and fucoxanthin. The upper part represents the heat change when the aptamer binds to fucoxanthin, and the lower part represents the enthalpy change when the aptamer binds to fucoxanthin.

[0015] Figure 5 : Schematic diagram of the affinity measurement results between OUC-Fx11-10T and fucoxanthin. The upper part represents the heat change when the aptamer binds to fucoxanthin, and the lower part represents the enthalpy change when the aptamer binds to fucoxanthin.

[0016] Figure 6 : Schematic diagram of the affinity measurement results between OUC-Fx11-5T and fucoxanthin. The upper part represents the heat change when the aptamer binds to fucoxanthin, and the lower part represents the enthalpy change when the aptamer binds to fucoxanthin.

[0017] Figure 7: Schematic diagram of the affinity measurement results between OUC-Fx13-12T and fucoxanthin. The upper part represents the heat change when the aptamer binds to fucoxanthin, and the lower part represents the enthalpy change when the aptamer binds to fucoxanthin.

[0018] Figure 8 Schematic diagram of secondary structure prediction for OUC-Fx11-10T.

[0019] Figure 9 Schematic diagram of secondary structure prediction for OUC-Fx11-5T.

[0020] Figure 10 : Schematic diagram of the affinity measurement results between OUC-Fx11-10T and fucoxanthin. The upper part represents the heat change when the aptamer binds to fucoxanthin, and the lower part represents the enthalpy change when the aptamer binds to fucoxanthin.

[0021] Figure 11 : Schematic diagram of the affinity measurement results between OUC-Fx11-10T and neoxanthin. The upper part represents the heat change when the aptamer binds to fucoxanthin, and the lower part represents the enthalpy change when the aptamer binds to fucoxanthin.

[0022] Figure 12 : Schematic diagram of the affinity determination results between OUC-Fx11-10T and zeaxanthin. The upper part represents the heat change when the aptamer binds to fucoxanthin, and the lower part represents the enthalpy change when the aptamer binds to fucoxanthin.

[0023] Figure 13 : Schematic diagram of the affinity determination results between OUC-Fx11-10T and β-carotene. The upper part represents the heat change when the aptamer binds to fucoxanthin, and the lower part represents the enthalpy change when the aptamer binds to fucoxanthin.

[0024] Figure 14 : Schematic diagram of the affinity measurement results between OUC-Fx11-5T and fucoxanthin. The upper part represents the heat change when the aptamer binds to fucoxanthin, and the lower part represents the enthalpy change when the aptamer binds to fucoxanthin.

[0025] Figure 15 : Schematic diagram of the affinity measurement results between OUC-Fx11-5T and neoxanthin. The upper part represents the heat change when the aptamer binds to fucoxanthin, and the lower part represents the enthalpy change when the aptamer binds to fucoxanthin.

[0026] Figure 16: Schematic diagram of the affinity determination results between OUC-Fx11-5T and zeaxanthin. The upper part represents the heat change when the aptamer binds to fucoxanthin, and the lower part represents the enthalpy change when the aptamer binds to fucoxanthin.

[0027] Figure 17 : Schematic diagram of the affinity determination results between OUC-Fx11-5T and β-carotene. The upper part represents the heat change when the aptamer binds to fucoxanthin, and the lower part represents the enthalpy change when the aptamer binds to fucoxanthin. Detailed Implementation

[0028] The present invention will be further described below with reference to embodiments. However, the scope of the present invention is not limited to the following embodiments. Those skilled in the art will understand that various changes and modifications can be made to the present invention without departing from the spirit and scope thereof.

[0029] Unless otherwise specified, the instruments, reagents, and materials used in the following embodiments are all conventional instruments, reagents, and materials already available in the prior art and can be obtained through legitimate commercial channels. Unless otherwise specified, the experimental methods and detection methods used in the following embodiments are all conventional experimental methods and detection methods already available in the prior art.

[0030] This invention employs a biomembrane interferometer to perform high-throughput determination of the affinity between nucleic acid aptamers and fucoxanthin, enabling preliminary screening of nucleic acid aptamers. The biomembrane interferometer is a tool for real-time analysis and detection of interactions between biomolecules. The detection method involves modifying one end of the nucleic acid aptamer with biotin, and using the binding of biotin to streptavidin to immobilize the aptamer on the sensor surface. The instrument parameters are set as follows: sensor equilibration 180 s, nucleic acid aptamer immobilization 300 s, equilibration 180 s, target binding and dissociation both 300 s, temperature 25℃, and frequency 2 Hz. Fitting the obtained curve yields the affinity dissociation constant (…). K d value).

[0031] This invention employs an isothermal titration microcalorimeter to further determine the affinity and specificity of nucleic acid aptamers with fucoxanthin. Isothermal titration microcalorimetry is a gold standard technique for studying molecular interactions in solution, allowing for continuous and accurate monitoring and recording of heat changes, providing complete thermodynamic curves. The detection method involves: thoroughly degassing the sample, placing the nucleic acid aptamer solution in the sample cell, and placing the target solution in the titration needle. The instrument program is set as follows: 25 drops of sample solution, 2 μL per drop, titration interval 180 s, temperature 25℃, stirring speed 350 r / min. The target solution is then added to the nucleic acid aptamer solution. Fitting the obtained curve yields the desired results.K d value.

[0032] Example 1: Screening of nucleic acid aptamers that specifically bind to fucoxanthin

[0033] Aptamer end locking is a method to enhance the stability and affinity of aptamers by fixing their end structures. However, for small molecules, the screening process still suffers from low screening efficiency and insufficient affinity of the screened aptamers. Therefore, this invention proposes a screening method based on a dynamic functional base pre-embedding synergistic end locking strategy. During the construction of the screening library, specific key bases are embedded in random regions of the library, and end locking is applied to these random regions to improve screening efficiency and the quality of candidate sequences.

[0034] (1) Constructing a screening library of random oligonucleotides

[0035] Select a nucleic acid aptamer that can recognize β-carotene (a structural analog of fucoxanthin) and simulate its binding with fucoxanthin using the molecular docking simulation software Autodock.

[0036] The nucleotide sequence of the nucleic acid aptamer selected in this invention to recognize β-carotene is shown in SEQ ID NO.1, as shown below (direction 5'-3'):

[0037] CAGCTCAGAAGCTTGATCCTCCCACAATTATCACGTAGTGTGCGGGTCACGCAATCTGACGACTCGAAGTCGTGCATCTG.

[0038] Based on clustering results and the principle of minimum energy, the key sites for the interaction between nucleic acid aptamers and fucoxanthin are predicted to be C32, G35, G38, T39, T41, and T47.

[0039] Based on the base spacing, key bases are embedded into the selected random regions, and six pairs of complementary GC sequences are used to lock the ends of the random regions. The design of the random oligonucleotide library for screening is as follows (direction 5'-3'):

[0040] AGCGTCGAATAACCACTACAG-GGCGGG-N21CN2GN2GTNTN5TN3-CCCGCC-CTAATGGAGCTCGTGGTCAG.

[0041] In this context, "N" represents any base (A, C, G, or T), and "N2", "N3", "N5", and "N21" represent 2, 3, 5, and 21 consecutive arbitrary bases, respectively.

[0042] The online tool "the mfold web server" was used to predict the secondary structure of the primer-free binding regions in the screened library. A schematic diagram of the secondary structure prediction for the primer-free binding regions of the screened library is shown below. Figure 1 As shown, the random regions of the filtered library form an end-locked structure.

[0043] The specific primers required for PCR amplification are designed based on the screening library. The nucleotide sequence of the forward primer is shown in SEQ ID NO.2, and it is labeled with the fluorescent group FAM at the 5' end. The nucleotide sequence of the reverse primer is shown in SEQ ID NO.3, and it is modified with biotin at the 5' end.

[0044] The nucleotide sequence of the forward primer is shown below (direction 5'-3'): AGCGTCGAATACCACTACAG.

[0045] The nucleotide sequence of the reverse primer is shown below (direction 5'-3'): CTGACCACGAGCTCCATTAG.

[0046] (2) Forward screening of graphene oxide (GO)

[0047] Library-target binding: The screening library was denatured by heating at 95°C for 10 min and immediately cooled on ice for 10 min before use. The screening library (2 nmol for the first round; 200 pmol for subsequent rounds) was incubated with fucoxanthin (20 nmol) at 25°C for 2 h in 600 μL binding buffer (50 mM Tris, pH 7.5, 150 mM NaCl, 2 mM MgCl2·6H2O). During incubation, sequences with affinity for fucoxanthin bound to it, while unbound sequences remained free in the solution.

[0048] GO was added to the above mixture and incubated at 25°C for 40 min, where unbound sequences were adsorbed onto the GO surface. The supernatant containing the fucoxanthin-bound sequences was collected by centrifugation and used as a template for subsequent PCR amplification. The precipitate containing the unbound sequences adsorbed on GO was discarded.

[0049] (3) Preparation of secondary libraries

[0050] Using the supernatant containing the sequence bound to fucoxanthin obtained in (2) above as a template, PCR amplification was performed; the correctness of the band position and the success of the amplification were verified by 3% agarose gel electrophoresis. The PCR amplification reaction system was as follows: 5 μL template, 1 μL each of forward and reverse primers, 0.25 μL Taq DNA polymerase (5 U / μL), 5 μL 10×PCR buffer (20 mM), 4 μL dNTPs, and ultrapure water to a final volume of 50 μL. The amplification conditions were as follows: 95℃ pre-denaturation for 1.5 min; 95℃ denaturation for 0.5 min, 55℃ annealing for 0.5 min, 72℃ extension for 1.5 min, denaturation, annealing, and extension constitute one cycle, and 18 cycles were performed (the number of cycles for each round of screening depends on the electrophoresis results); 75℃ extension for 5 min; and cooling at 4℃.

[0051] Preparation and purification of single-stranded DNA: The PCR products obtained from the previous screening were mixed with streptavidin microspheres and reacted at room temperature for 20 min. Since streptavidin reacts with biotin, the biotin-modified double-stranded DNA will detach from the streptavidin microspheres. The supernatant was discarded after centrifugation. 500 μL of 200 mM NaOH solution was added and reacted for 15 min. NaOH disrupts the double-stranded structure of the DNA, causing the unlabeled DNA strand to detach from the streptavidin microspheres and remain in the supernatant. The supernatant was collected by centrifugation and desalted using a desalting column to obtain the desired single-stranded DNA.

[0052] The concentration of desalted single-stranded DNA at 260 nm is measured. Based on the concentration, the corresponding volume of DNA solution is taken out and diluted to form a secondary library, which is the screening library for the next round.

[0053] (4) Multiple rounds of screening

[0054] The above operations (2) and (3) were repeated using the secondary library as the next round of screening, for a total of 15 rounds of screening. To ensure the specificity of the candidate aptamers, analogues such as zeaxanthin, neoxanthin, zeaxanthin and β-carotene were added for reverse screening in the 7th, 10th and 13th rounds of screening.

[0055] Determination of the optimal number of sequencing rounds: In this study, FAM-labeled forward primers were used for PCR amplification to obtain FAM-labeled secondary libraries. After GO screening, the relative fluorescence enrichment rate (F2 / F1×100%) was calculated to determine the optimal number of sequencing rounds. Here, F1 is the fluorescence intensity of the library before the target was added in each round, and F2 is the fluorescence intensity of the supernatant after GO adsorption with the target.

[0056] The fitted curves of relative fluorescence enrichment rates for different screening rounds are shown below. Figure 2As shown in the bar chart, the relative fluorescence enrichment rates for different screening rounds are as follows: Figure 3 As shown, the fitting curves tended to stabilize after the 8th round of screening, suggesting that the sequences binding to fucoxanthin reached relatively sufficient enrichment after the 8th round. This indicates that the dynamic functional base pre-embedding synergistic end-locking strategy of this invention can effectively improve screening efficiency. Meanwhile, the 9th, 11th, and 13th rounds of screening showed the highest relative fluorescence enrichment rates; therefore, the PCR products obtained from the 9th, 11th, and 13th rounds of screening were subjected to high-throughput sequencing.

[0057] (5) Analysis of high-throughput sequencing results

[0058] Based on homology, base number, frequency of occurrence, and free energy, 14 candidate nucleic acid aptamers were screened from the library pool. Five were selected in round 9, five in round 11, and four in round 13. The names and nucleotide sequences of these 14 candidate nucleic acid aptamers are shown below.

[0059] OUC-Fx9-8, the nucleotide sequence is shown in SEQ ID NO.4, as shown below (direction 5'-3') (the underlined region indicates the primer binding region, the same below):

[0060] AGCGTCGAATACCACTACAG GGCGGGCTCGCCTTTCTATGCATAGGACATGTGGTGTGTGAGTCCTCCCGCC CTAATGGAGCTCGTGGTCAG .

[0061] OUC-Fx9-3, the nucleotide sequence is shown in SEQ ID NO.5, as shown below (direction 5'-3'):

[0062] AGCGTCGAATACCACTACAG GGCGGGTTTTTGTAAATCCGAATATCTCATGACGTCTAACCGTGCTCCCGCC CTAATGGAGCTCGTGGTCAG .

[0063] OUC-Fx9-9, the nucleotide sequence is shown in SEQ ID NO.6, as shown below (direction 5'-3'):

[0064] AGCGTCGAATACCACTACAG GGCGGGTTCGCTCTGCCCTGGCTACTACACGGAGTCTTCCATTCTACCCGCC CTAATGGAGCTCGTGGTCAG .

[0065] OUC-Fx9-12, the nucleotide sequence is shown in SEQ ID NO.7, as shown below (direction 5'-3'):

[0066] AGCGTCGAATACCACTACAGGGCGGGTCTCTGGGGTACCGCTCCCGACCCGTGGTTTTCAAATTCGCCCGCC CTAATGGAGCTCGTGGTCAG .

[0067] OUC-Fx9-20, the nucleotide sequence is shown in SEQ ID NO.8, as shown below (direction 5'-3'):

[0068] AGCGTCGAATACCACTACAG GGCGGGAAGGCTCCACGCTTAGGTTACTAGAAGTCTTAATGTAAGCCCGCC CTAATGGAGCTCGTGGTCAG .

[0069] OUC-Fx11-7, the nucleotide sequence of which is shown in SEQ ID NO.9, as shown below (direction 5'-3'):

[0070] AGCGTCGAATACCACTACAG GGCGGGATCGTCAGATCACTTGTGACCGCTGGTTGTGTCCGGCTTGCCCCGCC CTAATGGAGCTCGTGGTCAG .

[0071] OUC-Fx11-13, the nucleotide sequence of which is shown in SEQ ID NO.10, is as follows (direction 5'-3'):

[0072] AGCGTCGAATACCACTACAG GGCGGGTACATCGGGGCCTATCCGTGGCGCGCCGTGTTAAGTTACCCCCGCC CTAATGGAGCTCGTGGTCAG .

[0073] OUC-Fx11-10, the nucleotide sequence is shown in SEQ ID NO.11, as shown below (direction 5'-3'):

[0074] AGCGTCGAATACCACTACAG GGCGGGCATCTGGCATCCATCGTCGTACGCGTTGTGTTATTTTAAACCCGCC CTAATGGAGCTCGTGGTCAG .

[0075] OUC-Fx11-14, the nucleotide sequence is shown in SEQ ID NO.12, as shown below (direction 5'-3'):

[0076] AGCGTCGAATACCACTACAG GGCGGGCCCTTGGTACGGGTTTCTGCACACGGGGTATTGGACTGTACCCGCC CTAATGGAGCTCGTGGTCAG .

[0077] OUC-Fx11-5, the nucleotide sequence is shown in SEQ ID NO.13, as shown below (direction 5'-3'):

[0078] AGCGTCGAATACCACTACAG GGCGGGCGTATGACCGCACATGGTACTCGTGCAGTGTATGGTTTGACCCGCC CTAATGGAGCTCGTGGTCAG .

[0079] OUC-Fx13-3, the nucleotide sequence is shown in SEQ ID NO.14, as shown below (direction 5'-3'):

[0080] AGCGTCGAATACCACTACAG GGCGGGATCGCTAGGCCAGTGGTGGTTCTTGAGGTCTAAAATTCAGCCCGCC CTAATGGAGCTCGTGGTCAG .

[0081] OUC-Fx13-12, the nucleotide sequence is shown in SEQ ID NO.15, as shown below (direction 5'-3'):

[0082] AGCGTCGAATACCACTACAG GGCGGGTACCCTGTGTATCTCGGTACCCTTGGCGTGTGGGACTGGTCCCGCC CTAATGGAGCTCGTGGTCAG .

[0083] OUC-Fx13-4, the nucleotide sequence of which is shown in SEQ ID NO.16, as shown below (direction 5'-3'):

[0084] AGCGTCGAATACCACTACAG GGCGGGTCGACTCCGCTGCTATCAGCTCGAGACGTCTGTAAGTACTCCCGCC CTAATGGAGCTCGTGGTCAG .

[0085] OUC-Fx13-9, the nucleotide sequence is shown in SEQ ID NO.17, as shown below (direction 5'-3'):

[0086] Figure 4 GGCGGGAACGCCGCGTGCTCGGTGTTCCATGTGGTGTGCATTTTACCCCGCC Figure 5 .

[0087] Example 2: Determination of the affinity between nucleic acid aptamers and fucoxanthin

[0088] The affinity of 14 candidate nucleic acid aptamers screened in Example 1 for fucoxanthin was determined using a biomembrane interference molecular interaction analyzer in high throughput. The results are shown in Table 1.

[0089] Then, the sequences of the nucleic acid aptamers were further enhanced by removing the primer-binding regions at the beginning and end of the full-length aptamer sequence. The affinity of the primer-free aptamer for fucoxanthin was determined using a biomembrane interferometer, and the results are shown in Table 1.

[0090]

[0091] As shown in Table 1, the four nucleic acid aptamers OUC-Fx9-8T, OUC-Fx11-10T, OUC-Fx11-5T, and OUC-Fx13-12T exhibit the best affinity.

[0092] The affinity of the above four nucleic acid aptamers for fucoxanthin was further determined using isothermal titration microcalorimetry. A schematic diagram of the affinity determination results between OUC-Fx9-8T and fucoxanthin is shown below. Figure 6 As shown in the diagram, the results of the affinity determination between OUC-Fx11-10T and fucoxanthin are as follows. Figure 7 As shown in the diagram, the results of the affinity determination between OUC-Fx11-5T and fucoxanthin are as follows. Figure 8 As shown in the diagram, the results of the affinity determination between OUC-Fx13-12T and fucoxanthin are as follows. Figure 9 As shown, the affinity dissociation constants of OUC-Fx9-8T, OUC-Fx11-10T, OUC-Fx11-5T, and OUC-Fx13-12T are 480 nM, 86.1 nM, 68.2 nM, and 317 nM, respectively. These values ​​differ from the affinity dissociation constants measured in Table 1, which is within expectations (the measurement methods are different). The results indicate that OUC-Fx11-10T and OUC-Fx11-5T have excellent binding ability to fucoxanthin, with OUC-Fx11-5T exhibiting the best affinity. This also demonstrates that the dynamic functional base pre-embedding synergistic end-locking strategy of this invention effectively improves the problem of insufficient affinity of nucleic acid aptamers screened by existing technologies.

[0093] The nucleotide sequence of OUC-Fx11-10T is shown in SEQ ID NO.18, as follows (direction 5'-3'):

[0094] GGCGGGCATCTGGCATCCATCGTCGTACGCGTTGTGTTATTTTAAACCCGCC.

[0095] The nucleotide sequence of OUC-Fx11-5T is shown in SEQ ID NO.19, as follows (direction 5'-3'):

[0096] GGCGGGCGTATGACCGCACATGGTACTCGTGCAGTGTATGGTTTGACCCGCC.

[0097] The secondary structure prediction diagram of OUC-Fx11-10T is shown below. Figure 10 As shown in the figure, the secondary structure prediction diagram of OUC-Fx11-5T is as follows: Figure 11 As shown.

[0098] Example 3: Determination of the specificity of nucleic acid aptamers

[0099] The affinity of the two nucleic acid aptamers (OUC-Fx11-10T and OUC-Fx11-5T) obtained in Example 2 for structural analogs of fucoxanthin (azoxanthin, neoxanthin, zeaxanthin and β-carotene) was determined using an isothermal titration microcalorimeter.

[0100] The schematic diagram of the affinity determination results between OUC-Fx11-10T and xanthocyanin is shown below. Figure 12 As shown in the diagram, the results of the affinity determination between OUC-Fx11-10T and neoxanthin are as follows. Figure 13 As shown in the diagram, the results of the affinity determination between OUC-Fx11-10T and zeaxanthin are as follows. Figure 14 As shown in the diagram, the results of the affinity determination between OUC-Fx11-10T and β-carotene are as follows. Figure 15 As shown in the diagram. The results of the affinity determination between OUC-Fx11-5T and xanthocyanin are illustrated below. Figure 16 As shown in the diagram, the results of the affinity determination between OUC-Fx11-5T and neoxanthin are illustrated below. Figure 17 As shown in the diagram, the results of the affinity determination between OUC-Fx11-5T and zeaxanthin are illustrated below. ​ As shown in the diagram, the results of the affinity determination between OUC-Fx11-5T and β-carotene are as follows. ​ As shown.

[0101] The results showed that OUC-Fx11-10T had no significant affinity for fucoxanthin, neoxanthin, zeaxanthin, or β-carotene, indicating that it has good specificity for fucoxanthin. OUC-Fx11-5T also had no significant affinity for fucoxanthin, neoxanthin, zeaxanthin, or β-carotene, indicating that it has good specificity for fucoxanthin.

[0102] The above embodiments are provided to those skilled in the art to fully disclose and describe how the claimed implementations can be carried out and used, and are not intended to limit the scope of the disclosure herein. Modifications that will be obvious to those skilled in the art will be within the scope of the appended claims.

Claims

1. A nucleic acid aptamer of fucoxanthin, OUC-Fxl l-5T, characterized in that: The nucleotide sequence is shown as SEQ ID NO.

19.

2. Use of the nucleic acid aptamer OUC-Fx11-5T of fucoxanthin according to claim 1 in recognizing or detecting fucoxanthin.

Images