Primer composition and kit for detecting highly pathogenic zoonosis avian influenza virus and application

Abstract

The invention provides a primer composition and a kit for detecting high-pathogenicity zoonosis avian influenza virus and application, and belongs to the technical field of virus detection. The primer composition for detecting the highly pathogenic human-livestock avian influenza virus provided by the invention can be used for specifically detecting HA genes of H3N2 subtype, H5N6 subtype and H7N7 subtype of influenza A viruses, detection results can be obtained within 40 minutes, and the detection method is convenient, rapid and accurate. The loop-mediated isothermal amplification (LAMP) technology adopted by the invention has the characteristics of rapidness, high efficiency, low cost, high sensitivity, strong resistance and the like. The invention is a core link for critical and severe prevention, diagnosis and treatment and medication guidance of highly pathogenic influenza patients, and is a key technology for diagnosis of highly pathogenic human-livestock avian influenza.

Description

Technical Field

[0001] This invention relates to the field of virus detection technology, and in particular to a primer composition, kit, and application for detecting highly pathogenic zoonotic avian influenza virus. Background Technology

[0002] Influenza viruses are seasonal, prevalent in winter, and characterized by high infectivity, pathogenicity, and mortality. According to estimates by the World Health Organization, hundreds of thousands to millions of people die globally from influenza each year. Avian influenza viruses, which are zoonotic, not only circulate in their natural hosts but can also spread across species to humans. This cross-species transmission characteristic, coupled with the virus's high variability, makes it a major source of significant threat to human health.

[0003] Avian influenza occasionally spreads from waterfowl to poultry and other mammalian species, forming several stable avian influenza lineages. Certain subtypes (such as A / H5 and A / H7) may mutate into highly pathogenic (HPAIV) variants. Clinical symptoms in infected hosts range widely, from asymptomatic infection to conjunctivitis or influenza-like symptoms, and may even develop into severe acute respiratory illness. For specific pathogenic subtypes, such as A / H5 and A / H7, infection in immunocompromised or high-risk hosts can lead to high morbidity, respiratory distress, or multiple organ failure, and in severe cases, death.

[0004] Highly pathogenic avian influenza, a zoonotic disease, not only exhibits high pathogenicity but also demonstrates strong potential for human-to-human transmission under certain circumstances. Antiviral treatment is the core measure in influenza treatment, requiring accurate early identification of the influenza virus. Therefore, rapid and accurate point-of-care testing (POCT) technology for influenza virus is crucial for the diagnostic detection of pathogens in sputum, urine, and blood samples from infected individuals.

[0005] The H3N2, H5N6, and H7N7 subtypes all belong to the genus *Influenza A* within the family Orthomyxoviridae. Their nucleic acid consists of segmented, single-stranded, negative-sense RNA encoding 11 proteins in eight segments, each segment encoding a different protein, including RNA polymerases (PB1, PB2, PA), hemagglutinin (HA), nucleoprotein (NP), neuraminidase (NA), matrix protein (MP), and non-structural proteins (NS1 and NEP / NS2). H3N2 influenza virus typically causes severe seasonal influenza, and its virulence depends on the characteristics of the viral strain and the host's immune status. H3N2 virus is primarily transmitted through droplets and is highly contagious. Droplets released by infected individuals when they sneeze or cough contain the virus; others can become infected by inhaling these droplets or touching contaminated surfaces and then touching their mouth, nose, or eyes. H3N2 often causes widespread transmission during peak seasonal influenza seasons. Infection with H3N2 can lead to severe respiratory symptoms, including cough, flu-like symptoms, shortness of breath, and even pneumonia. Patients may experience symptoms including high fever, chills, muscle and joint pain, and headache. In susceptible populations, H3N2 infection may lead to more serious complications, such as pneumonia or exacerbation of pre-existing chronic diseases.

[0006] H5N6 is a result of the recombination of the H5 A / goose / Guangdong / 1 / 1996 (GsGd) virus in poultry, introducing several subtypes including N1, N6, and N8. H5N6 was first reported in Laos in 2013 and quickly broke out in China, Laos, and Vietnam, with a mortality rate as high as 65.2%. Common symptoms after human infection with H5N6 influenza include fever, cough, sputum production, and sore throat. The probability of severe illness and the risk of death are high.

[0007] H7N7, a highly pathogenic avian influenza virus, was first reported in humans in the Netherlands in 2003. It is prevalent in North America, Europe, and China and surrounding regions. The H7N7 subtype is characterized by a mutation at position 627 of the PB2 protein, where lysine replaces glutamic acid (E627K mutation). At temperatures similar to those in the human upper respiratory tract, this mutation increases the activity and replication capacity of viral polymerases in mammalian cell lines, significantly enhancing the transmissibility and pathogenicity of avian influenza in mammals. Furthermore, H7N7 can cause severe pneumonia in ferrets. Considering the physiological similarities between humans and ferrets, H7N7 may pose a serious infection risk to humans.

[0008] In clinical practice, the conventional methods for diagnosing highly pathogenic avian influenza pathogens include isolation and culture, smear microscopy, serological testing, PCR, RT-PCR, or next-generation sequencing. These methods are time-consuming, have poor inhibitory resistance, are costly, and their detection sensitivity needs improvement. Therefore, there is an urgent need to provide a rapid, efficient, low-cost, highly sensitive, and highly inhibitory diagnostic technology for highly pathogenic avian influenza pathogens. Summary of the Invention

[0009] The purpose of this invention is to provide a primer composition, kit, and application for detecting highly pathogenic zoonotic avian influenza virus, which can conveniently, quickly, and accurately detect results within 40 minutes.

[0010] To achieve the above-mentioned objectives, the present invention provides the following technical solution:

[0011] This invention provides a primer composition for detecting highly pathogenic zoonotic avian influenza virus, wherein the primer composition for detecting highly pathogenic zoonotic avian influenza virus detects the HA gene of influenza A virus subtypes H3N2, H5N6 and H7N7.

[0012] The primer composition for detecting the HA gene of influenza A virus H3N2 subtype includes the following primers:

[0013] F3 (SEQ ID NO.1):AAAAGGGGGACCTGCTAAC;

[0014] B3 (SEQ ID NO.2): TCTTCCTGAGGCTTGAAC;

[0015] FIP (SEQ ID NO.3):

[0016] CGTTTAACACTGGGTATGCGTGGTTTCTTCAGTAGATTGAATTGG; BIP (SEQ ID NO.4):

[0017] ATGCCAAACAATGACAATTTTGACACTGGTTTGTTCTTGATTTGTACT;

[0018] The primer composition for detecting the HA gene of influenza A virus H5N6 subtype includes the following primers:

[0019] F3 (SEQ ID NO.5):ATGACTCAAATGTCAAGAACC;

[0020] B3 (SEQ ID NO.6): CCAGTTTCACTCCGCTTA;

[0021] FIP (SEQ ID NO.7):

[0022] GAAACAACCATTACCCAGCTCCTTTATGACAAAGTCCGACTACA; BIP (SEQ ID NO.8):

[0023] GGAAAGTGTAAGAAATGGGACGTCCTTTTTAATCTTGCTTCTTCTGAA;

[0024] The primer composition for detecting the HA gene of influenza A virus H7N7 subtype includes the following primers:

[0025] F3 (SEQ ID NO.9): AGGGACAATAATAAGTAACTTGC;

[0026] B3 (SEQ ID NO.10): CCCGTCAATCAGACCTTC;

[0027] FIP (SEQ ID NO.11):

[0028] TGCCAGCATCAGACTCTCCTCCTTTCAGAACATAAATAGCAGA;

[0029] BIP (SEQ ID NO.12):

[0030] AGGAATGAAGAATGTTCCCGAAACCATCCATTTTCAATGAAACC.

[0031] Preferably, the primer composition comprises a DNA molecule having the same function as the described nucleotide sequence after substitution and / or deletion and / or addition of one or more nucleotides of the nucleotide sequence shown in SEQ ID NO.1 to SEQ ID NO.12.

[0032] Preferably, the primer composition can be used to detect the HA gene of influenza A virus subtypes H3N2, H5N6 and H7N7 via loop-mediated isothermal amplification.

[0033] Preferably, the reaction conditions for the loop-mediated isothermal amplification are a constant temperature of 60–65°C for 40 min.

[0034] Preferably, during loop-mediated isothermal amplification, the molar ratio of primers F3, B3, FIP, and BIP is 1:1:4 to 16:4 to 16.

[0035] The present invention also provides a kit containing a primer composition for detecting highly pathogenic zoonotic avian influenza virus.

[0036] The present invention also provides a gene chip comprising a primer composition for detecting highly pathogenic zoonotic avian influenza virus.

[0037] The present invention also provides the application of the kit or the gene chip in the detection of highly pathogenic zoonotic avian influenza virus.

[0038] Preferably, the detection steps of the kit or gene chip include:

[0039] (1) Extract genomic nucleic acid from the virus to be tested or other types of samples to be tested;

[0040] (2) Using the gene extracted in step (1) as a template, the HA gene of influenza A virus subtypes H3N2, H5N6 and H7N7 is reverse transcribed and loop-mediated isothermal amplification is performed using primer combinations in the kit or gene chip.

[0041] The beneficial effects of this invention compared to the prior art are as follows:

[0042] (1) The loop-mediated isothermal amplification (LAMP) technique used in this invention has the characteristics of being fast, efficient, low-cost, highly sensitive, and resistant to inhibition. This invention is a core component for the prevention, diagnosis, treatment, and medication guidance of critically ill patients with highly pathogenic influenza, and is a key technology for the diagnosis of highly pathogenic zoonotic avian influenza.

[0043] (2) The primer composition provided by the present invention for detecting highly pathogenic zoonotic avian influenza virus can specifically detect the HA gene of influenza A virus subtypes H3N2, H5N6 and H7N7, and can obtain the detection results within 40 minutes. The detection method is convenient, fast and accurate. Attached Figure Description

[0044] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0045] Figure 1 The typical fluorescence curves for the amplification of the HA gene of the influenza A virus H3N2 subtype in Example 1 are compared with the fluorescence curves for the HA gene of the influenza A virus H5N1 subtype, the influenza A virus H5N6 subtype, the influenza A virus H7N7 subtype, the influenza A virus H7N9 subtype, the human genome, and the blank control.

[0046] Figure 2 This is a fluorescence curve illustrating the detection sensitivity of the HA gene primers for the H3N2 subtype of influenza A virus in Example 1 of this invention.

[0047] Figure 3Example 2 shows the typical fluorescence curves of HA gene amplification of influenza A virus H5N6 subtype, and the fluorescence curves of HA gene amplification of influenza A virus H3N2 subtype, influenza A virus H5N1 subtype, influenza A virus H7N7 subtype, influenza A virus H7N9 subtype, human genome, and blank control.

[0048] Figure 4 This is a fluorescence curve illustrating the detection sensitivity of the HA gene primers for the H5N6 subtype of influenza A virus in Example 1 of this invention.

[0049] Figure 5 Example 3 shows the typical fluorescence curves of HA gene amplification of influenza A virus H7N7 subtype, and the fluorescence curves of HA gene amplification of influenza A virus H3N2 subtype, influenza A virus H5N1 subtype, influenza A virus H5N6 subtype, influenza A virus H7N9 subtype, human genome, and blank control.

[0050] Figure 6 This is a fluorescence curve illustrating the detection sensitivity of the HA gene primers for the H7N7 subtype of influenza A virus in Example 3 of this invention. Detailed Implementation

[0051] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0052] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Every smaller range between any stated value or intermediate value within a stated range, and any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0053] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0054] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.

[0055] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0056] Unless otherwise specified, the test methods used in the following implementations are all commonly used test methods in this field;

[0057] Unless otherwise specified, the test materials used in the following implementations are all commonly used test materials in this field.

[0058] This invention provides a method for detecting influenza A virus subtypes H3N2, H5N6, and H7N7, specifically including the following steps:

[0059] (1) Extract genomic nucleic acid from the virus to be tested or other types of samples to be tested;

[0060] (2) Using the gene extracted in step (1) as a template, reverse transcription and loop-mediated isothermal amplification were performed using primers for detecting the HA gene of influenza A virus subtypes H3N2, H5N6 and H7N7. The amplification results were used to determine whether influenza A virus subtypes H3N2, H5N6 and H7N7 infection occurred.

[0061] Example 1

[0062] In Example 1 of this invention, an H3N2-HA plasmid containing the HA gene of the H3N2 subtype of influenza A virus was constructed. Using H5N1-HA plasmid, H5N6-HA plasmid, H7N7-HA plasmid, H7N9-HA plasmid, water, and human genome as controls, detection was performed using primers shown in SEQ ID NO. 1 to SEQ ID NO. 4. The specific method is as follows:

[0063] F3 (SEQ ID NO.1):AAAAGGGGGACCTGCTAAC;

[0064] B3 (SEQ ID NO.2): TCTTCCTGAGGCTTGAAC;

[0065] FIP (SEQ ID NO.3):

[0066] CGTTTAACACTGGGTATGCGTGGTTTCTTCAGTAGATTGAATTGG;

[0067] BIP (SEQ ID NO.4):

[0068] ATGCCAAACAATGACAATTTTGACACTGGTTTGTTCTTGATTTGTACT.

[0069] Following the system shown in Table 1, loop-mediated isothermal amplification was performed at 65℃ for 40 min to detect the HA gene of influenza A virus H3N2 subtype. The results are as follows: Figure 1 and Figure 4 As shown.

[0070] Table 1 Reaction System

[0071]

[0072] Depend on Figure 1 It is known that the plasmid fluorescence curve of the HA gene of the influenza A virus H3N2 subtype is a specific S-shaped curve; the HA gene of the influenza A virus H5N1 subtype, the HA gene of the influenza A virus H5N6 subtype, the HA gene of the influenza A virus H7N7 subtype, the HA gene of the influenza A virus H7N9 subtype, human genomic cDNA, and the blank control curve serve as baselines. Therefore, the primer combination of this invention for detecting the HA gene of the influenza A virus H3N2 subtype can specifically detect the HA gene of the influenza A virus H3N2 subtype.

[0073] Further, using the human genome and a blank control as comparisons, 10 were amplified. 4 copies / μL of the HA gene of influenza A virus H3N2 subtype, 10 3 copies / μL of the HA gene of influenza A virus H3N2 subtype, 10 2 The HA gene of influenza A virus H3N2 subtype was measured in copies / μL, and the detection sensitivity was as follows: Figure 2 As shown.

[0074] Figure 2 As shown, the primer combinations of SEQ ID NO.1 to SEQ ID NO.4 of this invention can be used in 10 2 With a template concentration of copies / μL, the HA gene of the H3N2 subtype of influenza A virus was detected within 40 minutes, demonstrating high sensitivity.

[0075] Example 2

[0076] Example 2 of this invention constructed an H5N6-HA plasmid containing the HA gene of the H5N6 subtype of influenza A virus. Using primers shown in SEQ ID NO.5 to SEQ ID NO.8, and following the reaction system and procedure of Example 1, the HA gene of the H5N6 subtype of influenza A virus was detected. The results are as follows: Figure 3 and Figure 4 As shown.

[0077] F3 (SEQ ID NO.5):ATGACTCAAATGTCAAGAACC;

[0078] B3 (SEQ ID NO.6): CCAGTTTCACTCCGCTTA;

[0079] FIP (SEQ ID NO.7):

[0080] GAAACAACCATTACCCAGCTCCTTTATGACAAAGTCCGACTACA;

[0081] BIP (SEQ ID NO.8):

[0082] GGAAAGTGTAAGAAATGGGACGTCCTTTTTAATCTTGCTTCTTCTGAA.

[0083] Depend on Figure 3 It is known that the plasmid fluorescence curve of the HA gene of influenza A virus H5N6 subtype is a specific S-shaped curve; the HA gene of influenza A virus H3N2 subtype, influenza A virus H5N1 subtype, influenza A virus H7N7 subtype, influenza A virus H7N9 subtype, human genomic cDNA, and blank control curves serve as baselines. Therefore, the primer combination of this invention for detecting the HA gene of influenza A virus H5N6 subtype can specifically detect the HA gene of influenza A virus H5N6 subtype.

[0084] Further, using the human genome and a blank control as comparisons, 10 were amplified. 4 copies / μL of the HA gene of influenza A virus H5N6 subtype, 10 3 copies / μL of the HA gene of influenza A virus H5N6 subtype, 10 2 The HA gene of influenza A virus H5N6 subtype was measured in copies / μL, and the detection sensitivity was as follows: Figure 4 As shown.

[0085] Figure 4 As shown, the primer combinations shown in SEQ ID NO.5 to SEQ ID NO.8 of this invention can be used in 102 With a template concentration of copies / μL, the HA gene of influenza A virus H5N6 subtype was detected within 40 minutes, demonstrating high sensitivity.

[0086] Example 3

[0087] In Example 3 of this invention, an H7N7-HA plasmid containing the HA gene of the H7N7 subtype of influenza A virus was constructed. Using primers shown in SEQ ID NO.9 to SEQ ID NO.12, and following the reaction system and procedure of Example 1, the HA gene of the H5N6 subtype of influenza A virus was detected. The results are as follows: Figure 5 and Figure 6 As shown.

[0088] F3 (SEQ ID NO.9): AGGGACAATAATAAGTAACTTGC;

[0089] B3 (SEQ ID NO.10): CCCGTCAATCAGACCTTC;

[0090] FIP (SEQ ID NO.11):

[0091] TGCCAGCATCAGACTCTCCTCCTTTCAGAACATAAATAGCAGA;

[0092] BIP (SEQ ID NO.12):

[0093] AGGAATGAAGAATGTTCCCGAAACCATCCATTTTCAATGAAACC.

[0094] Depend on Figure 5 It is known that the plasmid fluorescence curve of the HA gene of the influenza A virus H7N7 subtype is a specific S-shaped curve; the HA gene of the influenza A virus H3N2 subtype, the influenza A virus H5N1 subtype, the influenza A virus H5N6 subtype, the influenza A virus H7N9 subtype, human genomic cDNA, and the blank control curve serve as baselines. Therefore, the primer combination of this invention for detecting the HA gene of the influenza A virus H7N7 subtype can specifically detect the HA gene of the influenza A virus H7N7 subtype.

[0095] Further, using the human genome and a blank control as comparisons, 10 were amplified. 4 copies / μL of the HA gene of influenza A virus H7N7 subtype, 10 3 copies / μL of the HA gene of influenza A virus H7N7 subtype, 10 2The HA gene of influenza A virus H7N7 subtype was measured in copies / μL, and the detection sensitivity was as follows: Figure 6 As shown.

[0096] Figure 6 As shown, the primer combinations shown in SEQ ID NO. 9 to SEQ ID NO. 12 of this invention can be used in 10 2 With a template concentration of copies / μL, the HA gene of influenza A virus H5N6 subtype was detected within 40 minutes, demonstrating high sensitivity.

[0097] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A primer composition for detecting highly pathogenic zoonotic avian influenza virus, characterized in that, The primer composition for detecting highly pathogenic zoonotic avian influenza virus detects the HA gene of influenza A virus subtypes H3N2, H5N6, and H7N7. The primer composition for detecting the HA gene of influenza A virus H3N2 subtype includes the following primers: F3-SEQ ID NO.1:AAAAGGGGACCTGCTAAC; B3-SEQ ID NO.2:TCTTCCTGAGGCTTGAAC; FIP-SEQ ID NO.3: CGTTTAACACTGGGTATGCGTGGTTTCTTCAGTAGATTGAATTGG; BIP-SEQ ID NO.4: ATGCCAAACAATGACAATTTTGACACTGGTTTGTTCTTGATTTGTA CT; The primer composition for detecting the HA gene of influenza A virus H5N6 subtype includes the following primers: F3-SEQ ID NO.5: ATGACTCAAATGTCAAGAACC; B3-SEQ ID NO.6: CCAGTTTCACTCCGCTTA; FIP-SEQ ID NO.7: GAAACAACCATTACCCAGCTCCTTTATGACAAAGTCCGACTACA; BIP-SEQ ID NO.8: GGAAAGTGTAAGAAATGGGACGTCCTTTTTAATCTTGCTTCTTCTG AA; The primer composition for detecting the HA gene of influenza A virus H7N7 subtype includes the following primers: F3-SEQ ID NO.9): AGGGACAATAATAAGTAACTTGC; B3-SEQ ID NO.10): CCCGTCAATCAGACCTTC; FIP-SEQ ID NO.11: TGCCAGCATCAGACTCTCCTCCTTTCAGAACATAAATAGCAGA; BIP-SEQ ID NO.12: AGGAATGAAGAATGTTCCCGAAACATCCATTTTCAATGAAACC.

2. The primer composition for detecting highly pathogenic zoonotic avian influenza virus according to claim 1, characterized in that, The primer composition comprises a DNA molecule having the same function as the described nucleotide sequence after substitution and / or deletion and / or addition of one or more nucleotides of the nucleotide sequence shown in SEQ ID NO.1 to SEQ ID NO.

12.

3. The primer composition for detecting highly pathogenic zoonotic avian influenza virus according to claim 1, characterized in that, The primer composition can detect the HA gene of influenza A virus subtypes H3N2, H5N6 and H7N7 via loop-mediated isothermal amplification.

4. The primer composition for detecting highly pathogenic zoonotic avian influenza virus according to claim 3, characterized in that, The reaction conditions for the loop-mediated isothermal amplification are 60–65 °C for 40 min.

5. The primer composition for detecting highly pathogenic zoonotic avian influenza virus according to claim 3, characterized in that, During loop-mediated isothermal amplification, the molar ratio of primers F3, B3, FIP, and BIP is 1:1:4 to 16:4 to 16.

6. A reagent kit, characterized in that, The kit includes the primer composition for detecting highly pathogenic zoonotic avian influenza virus as described in any one of claims 1 to 2.

7. A gene chip, characterized in that, The gene chip includes the primer composition for detecting highly pathogenic zoonotic avian influenza virus as described in any one of claims 1 to 2.

8. The use of the kit of claim 6 or the gene chip of claim 7 in the detection of highly pathogenic zoonotic avian influenza virus.

9. The application according to claim 8, wherein the detection steps of the kit or gene chip include: (1) Extract genomic nucleic acid from the virus to be tested or other types of samples to be tested; (2) Using the gene extracted in step (1) as a template, the HA gene of influenza A virus subtypes H3N2, H5N6 and H7N7 is reverse transcribed and loop-mediated isothermal amplification is performed using primer combinations in the kit or gene chip.

Images