A rapid method for batch detection of genetically modified crops
By using multi-well plate array processing and digital interpretation technology, the problems of low efficiency and inaccurate results in the existing detection of genetically modified crops have been solved, and efficient and reliable batch detection has been achieved.
Patent Information
- Application Number
- CN202511384632.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-09-26
- Publication Date
- 2026-01-30
- Estimated Expiration
- 2045-09-26
AI Technical Summary
Existing methods for detecting genetically modified crops rely on manual operation, resulting in low detection efficiency, inability to process multiple samples simultaneously, and high risk of uneven results and cross-contamination due to manual grinding, which affects the accuracy and consistency of test results.
The process employs a multi-well plate array, combined with mechanized grinding, batch liquid addition, and centrifugation techniques to ensure uniform sample breakage and impurity precipitation. Image acquisition and digital interpretation technologies are used to improve detection efficiency and accuracy.
It enables efficient batch processing of genetically modified crop testing, ensuring sample consistency and reliability of test results, reducing the risk of cross-contamination, and improving testing throughput and result repeatability.
Smart Images

Figure CN120870547B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the technical field of plant transgene detection, in particular to a method for rapid batch transgenic crop detection. BACKGROUND
[0002] Currently, the commonly used method for transgenic crop on-site or preliminary screening is the test strip method based on colloidal gold immunochromatography technology. This method is widely used in the first line of field, acquisition site and production and processing due to its advantages of simple operation, no need for complex instruments, relatively low cost and fast qualitative results. The operation process of the traditional test strip method usually includes: sampling the crop tissue to be tested, then manually grinding the sample in a sample bag or centrifuge tube with a manual grinding rod, adding a matching buffer solution for oscillation to extract the target protein, and finally inserting the test strip into the untreated crude extract solution for reaction, and observing the color development of the detection line and the control line to determine the result.
[0003] However, the method in the prior art has the following technical problems in actual application:
[0004] The transgenic test strip method in the prior art relies heavily on manual operation one by one, and the detection efficiency is low, which cannot realize the synchronous processing of multiple samples, and cannot easily meet the increasing application demand of large-scale crop sample screening.
[0005] The prior art mainly uses manual grinding in the sample pretreatment link, and the manual grinding speed is slow, and the uniformity of the grinding effect cannot be easily guaranteed. The processing difference between different samples and the potential cross-contamination risk directly affect the accuracy and consistency of the final detection result.
[0006] The sample processing solution obtained by the prior art often contains plant tissue debris impurities, which will hinder the chromatography process of the detection solution on the test strip, cause the background color of the test strip to be turbid, and make it difficult to accurately read the results of the detection line and the control line, thereby seriously affecting the reliability of the detection.
[0007] Therefore, the present application provides a method for rapid batch transgenic crop detection to solve the above problems. SUMMARY
[0008] In view of the shortcomings of the prior art, the present application provides a method for rapid batch transgenic crop detection to solve the problems in the background art.
[0009] To achieve the above purpose, the present application realizes the following technical scheme: a method for rapid batch transgenic crop detection, comprising:
[0010] Step 1, place the centrifuge tubes containing the crop samples to be tested in an array in a multi-well plate to complete the batched arrangement of the samples;
[0011] Step 2, perform overall mechanized processing based on the multi-well plate so that the crop samples in the centrifuge tubes are simultaneously ground into powder under the action of mechanical force;
[0012] Step 3, use batched liquid addition equipment to synchronously add buffer solution to the centrifuge tubes, and mix the powder and the buffer solution thoroughly through oscillation processing to form sample processing liquid;
[0013] Step 4, perform overall centrifugation based on the multi-well plate, and use centrifugal force to precipitate insoluble impurities in the sample processing liquid at the bottom of the centrifuge tube to obtain clear sample supernatant;
[0014] Step 5, insert the test strip into the clear sample supernatant in the centrifuge tube for reaction, and read the detection result;
[0015] The steps further comprise:
[0016] Sub-step , obtain the final volume of the clear sample supernatant , according to the minimum effective reaction volume of the selected test strip , use the condition judgment ≥ to verify whether the volume of the clear sample supernatant meets the detection requirements;
[0017] Sub-step , under the condition that the final volume meets the detection requirements, insert the test strip into the clear sample supernatant, start the timer for reaction, and after the reaction is completed, use an image acquisition device to obtain a digital image containing the quality control line area and the detection line area;
[0018] Sub-step , in the digital image, demarcate the quality control line area , the detection line area and the background area , and sequentially calculate the average pixel gray value in the area to obtain the quality control line gray value , the detection line gray value and the background gray value ;
[0019] Sub-step , calculate the effective signal strength of the quality control line using the following formula :
[0020] ,
[0021] wherein, is the effective signal intensity of the quality control line, is the gray value of the quality control line, is the background gray value;
[0022] sub-step , setting the minimum signal threshold value of the effective test strip , using conditional judgment ≥ to determine whether the current detection is effective, and the detection result meeting the condition can be included in the final interpretation;
[0023] sub-step , for the detection result determined by the effectiveness, the signal response ratio of the detection line is calculated using the following formula :
[0024] ,
[0025] wherein, is the signal response ratio, is the gray value of the detection line;
[0026] sub-step , setting the response threshold value of positive determination , using the final conditional judgment ≥ to read the detection result of the sample of the crop to be tested, and when the final determination condition is met, the detection result is read as positive.
[0027] Preferably, before the sample is batched and plated, the method comprises using a leaf puncher to sample the leaves of the crop to be tested, and placing the obtained leaf discs in a centrifuge tube.
[0028] Preferably, the mechanized processing comprises: adding grinding steel balls to the centrifuge tube, liquid nitrogen freezing treatment is performed on the multi-well plate, and then the multi-well plate is placed in a tissue grinder for oscillation grinding.
[0029] The oscillation grinding has a pendulum frequency of 30 Hz / s and a grinding time of 45 s.
[0030] Preferably, after being ground into powder, the mechanized processing comprises performing a first centrifugation on the multi-well plate for collecting the powder at the bottom of the centrifuge tube.
[0031] The first centrifugation has a rotation speed of 1200 rpm / min and a centrifugation time of 15 s.
[0032] Preferably, the oscillation process uses a vortex oscillator with an oscillation frequency of 1200 times / min and an oscillation time of 30 seconds.
[0033] The centrifugation step for obtaining the clarified sample supernatant involves a centrifugation speed of 1200 rpm / min and a centrifugation time of 15 s.
[0034] Preferably, the test strip is inserted into the supernatant of the clarified sample, reacted for 1 minute, and then removed and the test result is read.
[0035] Preferably, the steps In addition, it further includes:
[0036] Sub-step Get the total number of rows of the selected perforated plate. With total number of columns And determine the total number of crop samples to be tested in this batch. Total number of required quality control samples ;
[0037] Sub-step Based on the total number of rows With total number of columns The total number of holes in the perforated plate was calculated. Based on the following layout effectiveness evaluation formula, calculate the layout effectiveness score of this sample PCB. :
[0038] ,
[0039] in, To score the effectiveness of the layout, This represents the total number of crop samples to be tested. The total number of quality control samples. The total number of holes, through Calculated;
[0040] Sub-step Pre-set layout validity threshold Conditional judgment ≥ To determine whether the sample plate meets the minimum throughput requirement for batch processing, subsequent steps can be carried out only if this condition is met.
[0041] Sub-step For sample plates that pass the aforementioned criteria, a preset serpentine or row-by-row filling algorithm is used to generate unique well coordinates for both the crop sample to be tested and the quality control sample. To form the initial layout matrix ;
[0042] sub-step , based on the initial layout matrix , calculating the cross-contamination risk index of any to-be-tested crop sample according to the following cross-contamination risk index evaluation formula :
[0043] ,
[0044] wherein, is the cross-contamination risk index borne by the to-be-tested crop sample , n is the total number of positive quality control samples in the quality control sample, is the inherent pollution weight coefficient of the positive quality control sample, is the Euclidean distance between the well position coordinates of the to-be-tested crop sample and the well position coordinates of the nth positive quality control sample in the initial layout matrix . sub-step , setting a cross-contamination risk safety threshold
[0045] , using the final layout verification algorithm to confirm that the initial layout matrix is the final layout scheme when the cross-contamination risk index of all to-be-tested crop samples satisfies the determination condition .
[0046] sub-step , according to the well position coordinates determined by the final layout scheme, placing the centrifuge tube containing the to-be-tested crop sample into the corresponding well position in the multi-well plate to complete the batch layout operation of the sample.
[0047] Preferably, in the step , further comprising:
[0048] sub-step , obtaining the initial mass of the to-be-tested crop sample , according to the preset tissue toughness coefficient of the crop, using the following formula to calculate the target crushing threshold of the to-be-tested crop sample:
[0049] ,
[0050] wherein, is the target crushing threshold, is the initial mass of the to-be-tested crop sample, coefficient of tissue toughness;
[0051] sub-step , according to the equipment performance coefficient of the selected tissue grinder , set the chatter frequency of the grinder and grinding time , the set crushing work value of this mechanical treatment is calculated by the following formula :
[0052] ,
[0053] wherein, the set crushing work value, the equipment performance coefficient, the chatter frequency, the grinding time;
[0054] sub-step 3, using the condition judgment ≥ to verify whether the set crushing work value reaches the target crushing threshold, and if this condition is met, the grinding parameters are confirmed to be effective to enter the subsequent liquid nitrogen freezing treatment;
[0055] sub-step , after completing the liquid nitrogen freezing treatment, the current temperature of the sample in the multi-well plate is monitored in real time before starting the tissue grinder , whether the sample reaches an effective grinding state is judged according to the following condition:
[0056] ≤ ,
[0057] wherein, the current temperature of the sample, the critical embrittlement temperature of the crop sample;
[0058] sub-step , after the current temperature of the sample meets the judgment condition of the critical embrittlement temperature, the tissue grinder is immediately started to perform grinding operation, and after the grinding is completed, the multi-well plate is subjected to first centrifugation, so that all the powders generated in the centrifuge tubes are compacted at the bottom of the tubes to form a powder column with a specific bulk volume ;
[0059] sub-step , based on the initial mass of the crop sample to be tested and the bulk volume of the powder column , the crushing efficiency index of this grinding operation is calculated by the following formula :
[0060] ,
[0061] wherein, is the pulverization efficiency index, is the initial mass of the crop sample to be tested, is the bulk volume of the powder column;
[0062] sub-step , setting a minimum pulverization mass criterion , using a final condition judgment:
[0063] ≥ to determine whether the pulverization efficiency index meets the criterion, and when the final judgment condition is met, it is determined that the crop sample is simultaneously ground into qualified powder.
[0064] Preferably, the step further comprises:
[0065] sub-step , based on the initial mass of the crop sample to be tested and according to the preset target lysis concentration of the target to be tested and the lysis efficiency coefficient of the buffer selected , the standard liquid addition amount required for the centrifuge tube is calculated using the following formula: :
[0066] ,
[0067] wherein, is the standard liquid addition amount, is the initial mass of the crop sample to be tested; is the target lysis concentration, is the lysis efficiency coefficient;
[0068] sub-step , setting the effective working volume of the centrifuge tube and the optimal reaction volume of the test strip , using condition judgment ≤ and ≥ to verify whether the standard liquid addition amount is within the effective volume range;
[0069] sub-step , based on the specific surface area coefficient of the powder and the fluid viscosity coefficient of the buffer , the minimum oscillation energy threshold required for the powder and the buffer to reach a fully mixed state is calculated using the following formula: :
[0070] ,
[0071] wherein, is the lowest oscillation energy threshold, is the mixed system correction factor, is the specific surface area coefficient of the powder, is the fluid viscosity coefficient of the buffer solution;
[0072] sub-step , setting the oscillation frequency of the vortex shaker used in the oscillation treatment and the oscillation time , according to the energy conversion factor inherent to the equipment , the actual oscillation energy provided by the present oscillation treatment is calculated by the following formula :
[0073] ,
[0074] wherein, is the actual oscillation energy, is the energy conversion factor, is the oscillation frequency, is the oscillation time;
[0075] sub-step , using the conditional judgment ≥ to determine whether the actual oscillation energy reaches the lowest oscillation energy threshold, and the oscillation treatment parameters are confirmed to be valid if the condition is met;
[0076] sub-step , after the standard liquid addition amount and the oscillation treatment parameters are verified, the batch liquid addition equipment is used to synchronously add the standard liquid addition amount of buffer solution into the centrifugal tube, and immediately the valid oscillation treatment parameters are used for oscillation to obtain the mixed liquid;
[0077] sub-step , after the oscillation treatment is completed, the light scattering turbidity value of the mixed liquid is detected , and the upper limit of the standard clarity is set , when the conditional judgment ≤ is met, the mixed liquid is finally confirmed as the qualified sample treatment liquid.
[0078] Preferably, in the step , further comprising:
[0079] sub-step , obtaining the sample treatment liquid by the step The average particle size of the insoluble impurities in the sample processing fluid formed The density of the impurities , obtaining the fluid density of the sample processing fluid The viscosity of the fluid , calculating the settling characteristic coefficient of the insoluble impurities according to the following formula :
[0080] ,
[0081] wherein, is the settling characteristic coefficient, is the average particle size of the insoluble impurities, is the density of the impurities, is the fluid density of the sample processing fluid, is the fluid viscosity of the sample processing fluid;
[0082] Sub-step , setting the maximum acceptable turbidity corresponding to the ideal supernatant clarity for the subsequent test strip reaction , calculating the minimum separation factor required for the sample processing fluid to reach the maximum acceptable turbidity according to the settling characteristic coefficient , using the following formula :
[0083] ,
[0084] wherein, is the minimum separation factor, is the correction constant, is the distance from the liquid surface to the rotation center, is the distance from the bottom of the centrifuge tube to the rotation center;
[0085] Sub-step , setting the rotation speed of the centrifuge and the centrifugation time , obtaining the effective rotation radius of the centrifuge rotor , calculating the set separation factor of the current centrifugation operation using the following formula :
[0086] ,
[0087] wherein, is the set separation factor, is the effective rotation radius, is the rotation speed of the centrifuge, is the centrifugation time;
[0088] Sub-step , using conditional judgment ≥ to determine whether the set separation factor reaches the minimum separation factor, and only when the condition is met, the centrifugal parameters are confirmed to be effective and the centrifugal operation is started;
[0089] sub-step , under the effective centrifugal parameters, the multi-well plate is subjected to overall centrifugation to obtain centrifuged liquid containing supernatant and bottom precipitate, and the actual turbidity of the supernatant is measured ;
[0090] sub-step , a precipitate resuspension risk threshold is set , according to the deceleration angular acceleration of the centrifuge and the actual turbidity of the supernatant , the precipitate stability index of the centrifugal operation is calculated by the following formula :
[0091] ,
[0092] wherein, is the precipitate stability index, is the deceleration angular acceleration of the centrifuge;
[0093] sub-step , the final condition is determined ≤ and ≥ , when the actual turbidity of the supernatant and the precipitate stability index both meet the determination condition, the supernatant is finally confirmed as a qualified clear sample supernatant.
[0094] The present application provides a method for rapid batch detection of transgenic crops. It has the following beneficial effects:
[0095] 1. The present application uses independent centrifuge tubes arranged in a multi-well plate to form an array, and uses a tissue grinder, batch liquid adding equipment and a centrifuge to perform synchronous processing of all samples in an integrated operation process, thereby significantly improving the detection throughput and efficiency. Compared with the manual one-by-one operation processing method in the prior art, the present application solves the problem of low detection efficiency and the difficulty in achieving synchronous processing of multiple samples, thereby meeting the large-scale crop sample screening demand.
[0096] 2、The technical scheme that the application adopts liquid nitrogen freezing combined with mechanical batch grinding of a tissue grinder achieves the technical effect of ensuring that all samples are fully and uniformly broken into powder under a unified standard, compared with the manual grinding method in the prior art, solving the problems of slow processing speed, uneven grinding effect, cross contamination risk and the like, which directly affect the accuracy and consistency of the final detection results.
[0097] 3、The technical scheme that the application adopts whole centrifugation of the multi-well plate after the sample treatment liquid is formed and before the test strip reaction is performed achieves the technical effect of effectively precipitating and separating insoluble impurities such as plant tissue debris, and obtaining clear sample supernatant, compared with the prior art of directly using the sample treatment liquid containing impurities for detection, solving the problems of impurities hindering the chromatography process of the detection liquid on the test strip, resulting in turbid background color development of the test strip, and making the detection line and the quality control line difficult to be accurately read, which seriously affects the detection reliability. BRIEF DESCRIPTION OF DRAWINGS
[0098] Figure 1 is a flowchart of the application;
[0099] Figure 2 is the powder of the corn leaf sample in example 1 ground in a 96-well plate;
[0100] Figure 3 is the reaction result of the corn leaf sample in example 1 after being added to the test strip;
[0101] Figure 4 is the test strip detection result of the corn 12 groups of leaf powder samples in example 1;
[0102] Figure 5 is the corn 12 groups of leaf samples in example 1 verified by molecular markers. DETAILED DESCRIPTION
[0103] In order for those skilled in the art to understand the application scheme, the technical solutions in the embodiments of the application will be described clearly and completely below in conjunction with the drawings of the embodiments of the application. Obviously, the described embodiments are part of the embodiments of the application, rather than all the embodiments. Based on the embodiments in the application, other embodiments obtained by those skilled in the art without creative labor should be within the protection scope of the application.
[0104] The application will be described in detail below in conjunction with the drawings:
[0105] Example 1:
[0106] Please refer to the drawings Figure 1The embodiment of the present application provides a kind of fast batch transgenic crop detection method, comprising:
[0107] Step 1, the centrifugal tube of being equipped with the crop sample to be measured is placed in the array form in multi-well plate, and the batch of sample is completed;
[0108] Step 2, based on the mechanical treatment of multi-well plate as a whole, the crop sample in centrifugal tube is ground into powder under the action of mechanical force simultaneously;
[0109] Step 3, batch liquid adding equipment is used, and buffer solution is added into centrifugal tube simultaneously, and powder and buffer solution are fully mixed by oscillation treatment, to form sample processing liquid;
[0110] Step 4, based on the overall centrifugation of multi-well plate, the insoluble impurities in sample processing liquid are precipitated at the bottom of centrifugal tube by centrifugal force, and clear sample supernatant is obtained;
[0111] Step 5, test strip is inserted into the clear sample supernatant of centrifugal tube to react, and detection result is read;
[0112] Step Further comprising:
[0113] Substep , the total number of rows of multi-well plate selected is obtained And total column number , and the total number of crop samples to be measured to be treated in this batch is determined And the total number of necessary quality control samples ;
[0114] Substep , the total number of holes of multi-well plate is calculated based on total number of rows And total column number , the layout effectiveness score of sample layout in this time is calculated according to the following layout effectiveness evaluation formula :
[0115] ,
[0116] Among them, It is layout effectiveness score, It is the total number of crop samples to be measured, It is the total number of quality control samples, It is the total number of holes, which is obtained by calculation ;
[0117] Substep , layout effectiveness threshold value is preset , condition judgment ≥ to determine whether the sample layout meets the minimum throughput requirement for batch processing, and when the condition is met, the subsequent steps can be continued;
[0118] Substep For the sample layout determined by the condition, a preset serpentine or row-by-row filling algorithm is used to generate unique well coordinates for the crop samples to be tested and the quality control samples to form an initial layout matrix ;
[0119] Substep Based on the initial layout matrix , the cross-contamination risk index of any crop sample to be tested is calculated according to the following cross-contamination risk index evaluation formula :
[0120] ,
[0121] wherein, is the cross-contamination risk index of the crop sample to be tested , n is the total number of positive quality control samples in the quality control samples, is the inherent contamination weight coefficient of the positive quality control sample, is the Euclidean distance between the well coordinates of the crop sample to be tested and the well coordinates of the nth positive quality control sample in the initial layout matrix .
[0122] Substep Set a cross-contamination risk safety threshold , and use a final layout verification algorithm. When the cross-contamination risk index of all crop samples to be tested satisfies the determination condition , the initial layout matrix is confirmed as the final layout scheme.
[0123] Substep According to the well coordinates determined by the final layout scheme, the centrifuge tubes containing the crop samples to be tested are placed in the corresponding wells of the multi-well plate to complete the batch layout operation of the samples.
[0124] Step further comprises:
[0125] Substep Obtain the initial mass of the crop sample to be tested , and according to the preset tissue toughness coefficient of the crop corresponding to the crop The target crushing threshold of the sample of the crop to be tested is calculated using the following formula :
[0126] ,
[0127] wherein, is the target crushing threshold, is the initial mass of the sample of the crop to be tested, is the tissue toughness coefficient;
[0128] Sub-step According to the equipment performance coefficient of the selected tissue grinder , the pendulum frequency of the grinder is set and the grinding time The set crushing work value of the mechanical treatment is calculated using the following formula :
[0129] ,
[0130] wherein, is the set crushing work value, is the equipment performance coefficient, is the pendulum frequency, is the grinding time;
[0131] Sub-step 3, using the condition judgment ≥ to verify whether the set crushing work value reaches the target crushing threshold, and the grinding parameters are confirmed to be effective only when the condition is met to enter the subsequent liquid nitrogen freezing treatment;
[0132] Sub-step After completing the liquid nitrogen freezing treatment, the current temperature of the sample in the multi-well plate is monitored in real time before starting the tissue grinder According to the following condition, it is determined whether the sample reaches an effective grinding state:
[0133] ≤ ,
[0134] wherein, is the current temperature of the sample, is the critical embrittlement temperature of the sample of the crop;
[0135] Sub-step After the current temperature of the sample meets the determination condition of the critical embrittlement temperature, the tissue grinder is immediately started to perform the grinding operation, and after the grinding is completed, the multi-well plate is subjected to a first centrifugation, so that all the powders generated in the centrifuge tubes are compacted at the bottom of the tubes to form a specific packing volume Powder column;
[0136] Sub-step Based on the initial mass of the crop sample to be tested With the packing volume of the powder column The grinding efficiency index of this grinding operation is calculated using the following formula. :
[0137] ,
[0138] in, The grinding efficiency index, The initial mass of the crop sample to be tested. This represents the packing volume of the powder column;
[0139] Sub-step Set minimum crushing quality standards The final condition is used for judgment:
[0140] ≥ The grinding efficiency index is used to determine whether the grinding efficiency index meets the standard. When this final judgment condition is met, the crop sample is considered to have been ground into qualified powder.
[0141] step In addition, it further includes:
[0142] Sub-step Based on the initial mass of the crop sample to be tested And based on the preset target pyrolysis concentration of the analyte. The lysis efficiency coefficient with the selected buffer solution The required standard liquid volume for centrifuge tubes can be calculated using the following formula. :
[0143] ,
[0144] in, Standard dosage The initial mass of the crop sample to be tested; For the target pyrolysis concentration, This is the pyrolysis efficiency coefficient;
[0145] Sub-step Set the effective working volume of the centrifuge tube. Optimal reaction volume with test strip Conditional judgment ≤ and ≥ to verify whether the standard liquid addition amount is in the effective volume interval;
[0146] sub-step , based on the specific surface area coefficient of the powder and the fluid viscosity coefficient of the buffer , the minimum oscillation energy threshold required for the powder and the buffer to reach a fully mixed state is calculated using the following formula :
[0147] ,
[0148] wherein, is the minimum oscillation energy threshold, is the mixing system correction factor, is the specific surface area coefficient of the powder, is the fluid viscosity coefficient of the buffer;
[0149] sub-step , the oscillation frequency of the vortex oscillator used for the oscillation treatment is set and the oscillation time , according to the energy conversion factor inherent to the equipment , the actual oscillation energy provided by the current oscillation treatment is calculated using the following formula :
[0150] ,
[0151] wherein, is the actual oscillation energy, is the energy conversion factor, is the oscillation frequency, is the oscillation time;
[0152] sub-step , a conditional judgment ≥ is used to determine whether the actual oscillation energy reaches the minimum oscillation energy threshold, and the oscillation treatment parameters are confirmed to be valid if the condition is met;
[0153] sub-step , after the standard liquid addition amount and the oscillation treatment parameters are verified, the batch liquid addition equipment is used to simultaneously add the standard liquid addition amount of buffer into the centrifuge tube, and immediately use the effective oscillation treatment parameters for oscillation to obtain the mixed liquid;
[0154] sub-step , after the oscillation treatment is completed, the light scattering turbidity value of the mixed liquid is detected , the upper limit of the standard clarity is set , and when the conditional judgment ≤ The mixed liquid is finally confirmed as a qualified sample processing liquid.
[0155] Step Further comprising:
[0156] Sub-step Obtaining the average particle size of the insoluble impurities in the sample processing liquid formed by step Obtaining the fluid density of the sample processing liquid Obtaining the fluid viscosity of the sample processing liquid Obtaining the settling characteristic coefficient of the insoluble impurities according to the following formula :
[0157] ,
[0158] Wherein, is the settling characteristic coefficient, is the average particle size of the insoluble impurities, is the impurity density, is the fluid density of the sample processing liquid, is the fluid viscosity of the sample processing liquid;
[0159] Sub-step Setting the maximum acceptable turbidity corresponding to the ideal supernatant clarity for subsequent test strip reaction According to the settling characteristic coefficient , the minimum separation factor required for the sample processing liquid to reach the maximum acceptable turbidity is calculated using the following formula :
[0160] ,
[0161] Wherein, is the minimum separation factor, is the correction constant, is the distance from the liquid surface to the rotation center, is the distance from the bottom of the centrifuge tube to the rotation center;
[0162] Sub-step Setting the rotation speed of the centrifuge and the centrifugation time Obtaining the effective rotation radius of the centrifuge rotor The set separation factor of this centrifugation operation is calculated using the following formula :
[0163] ,
[0164] Wherein, to set the separation factor, to set the effective radius of rotation, to set the rotation speed of the centrifuge, to set the centrifugation time;
[0165] sub-step , using conditional judgment ≥ to determine whether the set separation factor reaches the minimum separation factor, and if the condition is met, the centrifuge parameters are confirmed to be effective and the centrifuge operation is started;
[0166] sub-step , under the effective centrifuge parameters, the multi-well plate is subjected to overall centrifugation to obtain the centrifuged liquid containing supernatant and bottom precipitate, and the actual turbidity of the supernatant is measured ;
[0167] sub-step , setting a precipitate resuspension risk threshold , according to the deceleration angular acceleration of the centrifuge and the actual turbidity of the supernatant , using the following formula to calculate the precipitate stability index of the centrifuge operation :
[0168] ,
[0169] wherein, is the precipitate stability index, is the deceleration angular acceleration of the centrifuge;
[0170] sub-step , using the final conditional judgment ≤ and ≥ , when the actual turbidity of the supernatant and the precipitate stability index both meet the judgment condition, the supernatant is finally confirmed as a qualified clear sample supernatant.
[0171] in step , further comprising:
[0172] sub-step , obtaining the final volume of the obtained clear sample supernatant , according to the minimum effective reaction volume of the selected detection test strip , using conditional judgment ≥ to verify whether the volume of the clear sample supernatant meets the detection requirements;
[0173] sub-step Under the condition that the final volume meets the detection requirements, the test strip is inserted into the supernatant of the clarified sample, a timer is started for reaction, and after the reaction is completed, a digital image containing the quality control line area and the detection line area is obtained by using an image acquisition device;
[0174] Substep In the digital image, the quality control line area is demarcated , the detection line area and the background area are demarcated, and the average pixel gray value in the area is calculated in sequence to obtain the quality control line gray value , the detection line gray value and the background gray value ;
[0175] Substep The effective signal intensity of the quality control line is calculated by using the following formula :
[0176] ,
[0177] Among them, is the effective signal intensity of the quality control line, is the quality control line gray value, is the background gray value;
[0178] Substep Set the minimum signal threshold value of the test strip effective, and use the condition judgment ≥ to determine whether the current detection is effective. The detection result meeting the condition can be included in the final interpretation;
[0179] Substep For the detection result determined by the effectiveness, the signal response ratio of the detection line is calculated by using the following formula :
[0180] ,
[0181] Among them, is the signal response ratio, is the detection line gray value;
[0182] Substep Set the response threshold value of positive determination , and use the final condition judgment ≥ to read the detection result of the crop sample to be tested. When the final judgment condition is met, the detection result is read as positive.
[0183] By introducing layout effectiveness evaluation, cross-contamination risk index calculation and automatic layout algorithm, the traditional random sample placement is changed into a data-driven and optimized scientific layout process, which ensures the utilization rate of multi-well plates from the source, meets the basic requirements of high-throughput, and most importantly, greatly improves the reliability of the whole plate detection results and the repeatability between batches by quantifying and avoiding the potential contamination risk of positive quality control samples to ordinary samples.
[0184] By means of accurate calculation of target crushing threshold and set crushing power value, and real-time monitoring of sample critical embrittlement temperature, standardization and quality control of mechanical grinding process are realized, and the final crushing efficiency index is used for quantitative verification, which completely solves the core technical pain point of traditional method that the sample pretreatment quality is uneven due to different operations.
[0185] By theoretical calculation and verification of standard liquid addition amount and minimum oscillation energy, the high consistency of all sample reaction systems in the biochemical level is ensured, the efficiency and sufficiency of subsequent target cracking are ensured, and the detection of light scattering turbidity value is introduced as a process quality control point to ensure that the sample treatment liquid before centrifugation is qualified and consistent.
[0186] The centrifugal clarification process is improved from experience-dependent operation to purification step based on fluid mechanics and centrifugal dynamics precise control, so as to ensure that the clarity of the supernatant obtained is sufficient to meet the detection requirements, and through quantitative evaluation of the stability of the precipitate, it is ensured that the supernatant will not be contaminated again during transfer or use, which provides a decisive guarantee for obtaining a clear detection result.
[0187] By using image acquisition and gray value calculation, the traditional test strip result reading which depends on subjective judgment of human eyes is changed into an objective and quantitative digital interpretation method, the signal intensity of the quality control line is used to determine the detection effectiveness, the signal response ratio is used for normalization processing to eliminate the ambiguity and individual difference of human judgment, and the preset positive response threshold is used to make the final detection result accurate and reliable, and has high consistency and traceability.
[0188] Embodiment 2:
[0189] Please refer to the accompanying Figure 2 -Appendix Figure 5 The embodiment of the present application provides a rapid batch transgenic crop detection method, which comprises the following steps:
[0190] S1. Buffer preparation: take 1000ml water with a measuring cylinder, shake 20 grams of SEB4 powder buffer for 30 seconds, and stand at room temperature;
[0191] S2. Sampling, 96 plant leaves were collected from the insect-resistant transgenic maize inbred XB1621, 8 holes of each single leaf sample were taken by a leaf puncher, and the samples were placed in 1.2 ml centrifuge tubes according to the sample number arrangement diagram, and then placed in the corresponding holes of the 96-well deep well plate;
[0192] S3. Adding steel ball cover silica gel cover, adding 1 steel ball to each 1.2 ml centrifuge tube by using a 96-well deep well plate steel ball separator, and then covering with a silica gel cover and rolling with a centrifuge tube holder;
[0193] S4. Liquid nitrogen freezing, placing the 96-well deep well plate covered with a silica gel cover into a foam box containing liquid nitrogen, and freezing for 2 min;
[0194] S5. Grinding, placing the frozen 96-well deep well plate into a tissue grinder sample groove symmetrically, covering with a sample cover, fixing a bolt, covering with a grinder cover, setting a vibration frequency of 30 Hz and a time of 45 s, and grinding;
[0195] S6. Centrifugation and standing, taking the ground sample from the grinder, placing it into a horizontal centrifuge, centrifuging for 15 s at a speed of 1200 rpm / min, and then opening the cover and standing at room temperature for 5 min as shown in the formula; Figure 2
[0196] S7. Adding buffer, opening the 96-well deep well plate cover, adding 300 ul buffer by using a liquid treatment workstation, covering with a 96-well silica gel cover, pressing a blank 96-well PCR plate, and shaking by using a vortex shaker at a frequency of 1200 / min for 30 s;
[0197] S8. Centrifugation, centrifuging by using a centrifuge for 15 s at a speed of 1200 rpm / min;
[0198] S9. Adding BT cry1Ab / cry1Ac test strip, slowly inserting the test strip into the centrifuge tube, keeping the liquid surface not exceeding the uppermost liquid level scale line of the test strip, and taking out the test strip after 1 min;
[0199] S10. Reading results, positive result: the test strip detection T line and C line both appear visible color development, indicating that the sample contains transgenic components, and the result is expressed as "the sample detects transgenic components, and the detection result is positive";
[0200] Negative result: refers to that the test strip detection T line does not appear visible color development, and the C line appears visible color development, indicating that the sample does not contain transgenic components, and "the sample does not detect transgenic components, and the detection result is negative";
[0201] S11. Result verification, extract A1, B2, C3, D4, E5, F6, G7, H8, G9, F10, E11, D12 samples on 96-well plate, read test strip detection results are positive, negative, positive, positive, positive, positive, negative, positive, negative, positive, positive, negative in turn;
[0202] S12. Extract DNA of the above 12 groups of samples, then use anti-insect gene ND207 detection marker amplification verification, marker sequence is:
[0203] ND207_F: AACGTGAACAAGGGTGAAGCTCTACG;
[0204] ND207_R: AGTCCAGGATGGGCTTCATGTACTC.
[0205] The results of detection with anti-insect gene ND207 molecular marker are positive, negative, positive, positive, positive, positive, negative, positive, negative, positive, positive, negative in turn, which is consistent with the test strip detection results.
[0206] Although the embodiments of the present application have been shown and described, it can be understood by those skilled in the art that various changes, modifications, replacements and variations can be made to these embodiments without departing from the principles and spirits of the present application, and the scope of the present application is defined by the appended claims and their equivalents.
Claims
1. A method for rapid batched detection of genetically modified crops, characterized in that, The method comprises the following steps: Step 1: placing centrifuge tubes containing crop samples to be tested in an array in a multi-well plate to complete batched sample plate arrangement; Step 2: performing overall mechanized processing based on the multi-well plate, so that the crop samples in the centrifuge tubes are simultaneously ground into powder under the action of mechanical force; Step 3: synchronously adding buffer solution to the centrifuge tubes using batched liquid adding equipment, and fully mixing the powder and the buffer solution through oscillation processing to form sample processing liquid; Step 4: performing overall centrifugation based on the multi-well plate, and using centrifugal force to precipitate insoluble impurities in the sample processing liquid at the bottom of the centrifuge tube to obtain clear sample supernatant; Step 5: inserting a detection test strip into the clear sample supernatant in the centrifuge tube for reaction, and reading the detection result. The steps Further comprising: Sub-step , obtaining the final volume of the obtained clarified sample supernatant , according to the minimum effective reaction volume of the selected test strip , using conditional judgment ≥ to verify whether the volume of the clarified sample supernatant meets the detection requirements; Sub-step Under the condition that the final volume meets the detection requirement, the test strip is inserted into the supernatant of the clarified sample, a timer is started for reaction, and after the reaction is completed, a digital image containing the quality control line region and the detection line region is acquired by using an image acquisition device. Sub-step In the digital image, calibrate the quality control line region , the detection line region , and the background region , and calculate the average pixel gray value in the region to obtain the quality control line gray value , the detection line gray value , and the background gray value ; Sub-step The effective signal intensity of the quality control line is calculated using the following formula : , wherein, is the effective signal intensity of the quality control line, is the gray value of the quality control line, is the background gray value; Sub-step , set the minimum signal threshold of the test strip , adopt conditional judgment ≥ to determine whether the current test is valid, and the test result meeting the condition can be included in the final interpretation; Sub-step For the detection result by the validity determination, the signal response ratio of the detection line is calculated using the following formula : , wherein, is the signal response ratio, is the detection line gray value; Sub-step Setting a response threshold for positive determination Adopting a final condition determination ≥ The detection result of the sample of the crop to be detected is read, and when the final determination condition is met, the detection result is read as positive.
2. The method for rapid batched detection of genetically modified crops according to claim 1, characterized in that, Before the sample batched plate arrangement, the method comprises the following steps: sampling crop leaves using a leaf puncher, and placing the obtained leaf discs in the centrifuge tubes.
3. The method of claim 1, wherein the method is a rapid batch method for detecting genetically modified crops. The mechanized processing comprises the following steps: adding grinding steel balls to the centrifuge tubes, performing liquid nitrogen freezing processing on the multi-well plate, and then placing the multi-well plate in a tissue grinder for oscillation grinding. The oscillation grinding has a swing frequency of 30 Hz / s and a grinding time of 45 s.
4. The method of claim 3, wherein the method is a rapid batch method for detecting genetically modified crops. After the grinding into powder, the mechanized processing comprises the following step: performing first centrifugation on the multi-well plate to collect the powder at the bottom of the centrifuge tube. The first centrifugation has a rotation speed of 1200 rpm / min and a centrifugation time of 15 s.
5. The method of claim 1, wherein the method is a rapid batch method for detecting genetically modified crops. The oscillation processing uses a vortex shaker, and has an oscillation frequency of 1200 times / min and an oscillation time of 30 s. The centrifugation for obtaining clear sample supernatant has a centrifugation rotation speed of 1200 rpm / min and a centrifugation time of 15 s.
6. The method of claim 1, wherein the method is a rapid batch method for detecting genetically modified crops. The detection test strip is inserted into the clear sample supernatant, taken out after 1 min of reaction, and the detection result is read.
7. The method of claim 1, wherein the method is a rapid batch method for detecting genetically modified crops. The steps Further comprising: Sub-step , obtaining the total number of rows of the selected multi-well plate and the total number of columns , and determining the total number of the to-be-tested crop samples to be processed in the batch and the total number of the necessary quality control samples ; Sub-step , based on the total row number and the total column number , the total well number of the multi-well plate is calculated , according to the layout effectiveness evaluation formula, the layout effectiveness score of the sample layout of this time is calculated : , wherein, is the layout validity score, is the total number of crop samples to be tested, is the total number of quality control samples, is the total number of wells, obtained by calculation. Sub-step , pre-setting layout validity access threshold , using conditional judgment ≥ to judge whether the current sample layout meets the minimum throughput requirement of batch processing, and when the condition is met, the subsequent steps can be continued. Sub-step For the sample layout determined by the condition, a preset serpentine or row-by-row filling algorithm is used to generate unique well position coordinates for the crop samples to be tested and the quality control samples , forming an initial layout matrix ; Sub-step , based on the initial layout matrix , the cross-contamination risk index of any to-be-tested crop sample is calculated according to the following cross-contamination risk index evaluation formula : , wherein, is the total number of positive quality control samples in the quality control samples, is the cross contamination risk index of the crop sample to be tested, is the total number of positive quality control samples in the quality control samples, is the inherent contamination weight coefficient of the positive quality control sample, is the total number of positive quality control samples in the quality control samples, is the Euclidean distance between the well coordinates of the crop sample to be tested is the Euclidean distance between the well coordinates of the positive quality control sample in the initial layout matrix, in the initial layout matrix. Sub-step , setting a cross-contamination risk safety threshold , using a final layout verification algorithm, when the cross-contamination risk indexes of all the samples of the crops to be tested all satisfy the determination condition , confirming that the initial layout matrix is the final layout scheme; Sub-step According to the hole position coordinates determined by the final layout scheme, the centrifuge tube containing the sample of the crop to be tested is placed into the corresponding hole position in the multi-well plate, and the batch layout operation of the sample is completed.
8. The method of claim 1, wherein the method is a rapid batch method for detecting genetically modified crops. The steps Further comprising: Sub-step , obtaining initial quality of the sample of the crop to be tested , according to the preset tissue toughness coefficient corresponding to the crop , the target crushing threshold of the sample of the crop to be tested is calculated by using the following formula : , wherein, is a target crushing threshold, is an initial mass of the crop sample to be measured, is a tissue toughness coefficient; Sub-step , according to the equipment performance coefficient of the selected tissue grinder , set the chatter frequency of the grinder and grinding time , the set crushing work value of this mechanical treatment is calculated by the following formula : , wherein, is a specific grinding energy, is a performance coefficient of the device, is a pendulum frequency, is a grinding time; Sub-step 3, using conditional judgment ≥ to verify whether the set crushing work value reaches the target crushing threshold, and only when this condition is met can the grinding parameters be confirmed to be valid to enter the subsequent liquid nitrogen freezing treatment. sub-step monitoring the current temperature of the samples in the multi-well plate in real time after the liquid nitrogen freezing process is completed before starting the tissue grinder determining whether the samples have reached an effective grinding state according to the following conditions: ≤ , wherein, is the current temperature of the sample, is the critical embrittlement temperature of the crop sample; Sub-step Upon the determination that the current temperature of the sample meets the critical embrittlement temperature condition, immediately initiate the tissue grinder to perform a grinding operation, and after the grinding operation is completed, perform a first centrifugation of the multi-well plate, so that the powders generated in all the centrifuge tubes are compacted at the bottom of the tubes to form a powder column having a specific bulk volume sub-step based on the initial mass of the sample of the crop to be tested with the bulk volume of the powder column The grinding efficiency index of the present grinding operation is calculated using the following formula : , wherein, is a pulverization efficiency index, is an initial mass of the sample of the crop to be tested, is a bulk volume of the powder column; Sub-step , setting a minimum pulverization quality criterion , using a final condition criterion: ≥ , to determine whether the pulverization performance index meets the standard, and when the final determination condition is met, it is determined that the crop sample is simultaneously ground into qualified powder.
9. The method of claim 1, wherein the method is a rapid batch method for detecting genetically modified crops. The steps Further comprising: Sub-step , based on the initial mass of the sample of the crop to be tested , and in accordance with the preset target lysis concentration of the target object to be tested and the lysis efficiency coefficient of the selected buffer , the standard liquid addition amount required for the centrifugal tube is calculated using the following formula : , wherein, is a standard addition volume, is an initial mass of the crop sample to be tested; is a target lysis concentration, is a lysis efficiency coefficient; sub-step , set the effective working volume of the centrifugal tube and the optimal reaction volume of the test strip , adopt conditional judgment ≤ and ≥ to verify whether the standard liquid volume is in the effective volume interval sub-step , based on the specific surface area coefficient of the powder and the fluid viscosity coefficient of the buffer , the minimum oscillation energy threshold required to achieve a state of perfect mixing of the powder and the buffer is calculated using the following formula : , wherein, is the lowest oscillation energy threshold, is the hybrid system correction factor, is the specific surface area coefficient of the powder, is the fluid viscosity coefficient of the buffer; Sub-step , setting the oscillation frequency of the vortex shaker used for the oscillation treatment and the oscillation time , according to the energy conversion factor inherent to the apparatus , the actual oscillation energy provided by this oscillation treatment is calculated using the following formula : , wherein, is the actual oscillation energy, is the energy conversion factor, is the oscillation frequency, is the oscillation time; Sub-step , using conditional determination ≥ to determine whether the actual oscillation energy reaches the minimum oscillation energy threshold, and the oscillation processing parameter is confirmed to be valid if the condition is met. Sub-step After the standard liquid addition amount and the effective oscillation treatment parameter are verified, a batch liquid addition device is used to add the standard liquid addition amount of buffer solution into the centrifugal tube, and immediately the effective oscillation treatment parameter is used for oscillation to obtain mixed liquid. Sub-step After the end of the oscillation treatment, the light scattering turbidity value of the mixed liquid is detected The upper limit of the standard clarity is set When the condition determination is satisfied ≤ The mixed liquid is finally confirmed as a qualified sample treatment liquid.
10. The method of claim 1, wherein the method is a rapid batch method for detecting genetically modified crops. The steps Further comprising, in the method, sub-step , obtaining the average particle size of the insoluble impurities in the sample treatment liquid formed by the step , obtaining the fluid density of the sample treatment liquid , calculating the sedimentation characteristic coefficient of the insoluble impurities according to the following formula : , wherein, is a settling characteristic coefficient, is an average particle size of the insoluble impurities, is an impurity density, is a fluid density of the sample treatment fluid, is a fluid viscosity of the sample treatment fluid; sub-step , setting a maximum acceptable turbidity corresponding to a desired supernatant clarity for subsequent test strip reactions , determining the sedimentation characteristic coefficient , calculating the minimum separation factor required to achieve the maximum acceptable turbidity for the sample processing fluid using the following equation : , wherein, is the minimum separation factor, is the correction factor, is the distance of the liquid surface to the rotation center, is the distance of the centrifuge tube bottom to the rotation center; Sub-step , setting the rotational speed of the centrifuge and centrifugation time , obtaining the effective radius of rotation of the centrifuge rotor , calculating the set separation factor for the present centrifugation operation using the following formula : , wherein, is the separation factor, is the effective radius of rotation, is the rotational speed of the centrifuge, is the centrifugation time; Sub-step , using conditional judgment ≥ to determine whether the set separation factor reaches the minimum separation factor, and if this condition is met, the centrifugal parameters are confirmed to be effective and the centrifugal operation is started. sub-step subjecting the multiwell plate to bulk centrifugation at said effective centrifugation parameter, obtaining a post-centrifugation liquid comprising supernatant and bottom pellet, measuring the actual turbidity of the supernatant ; sub-step , setting a threshold value for the risk of re-suspension of the precipitate , depending on the deceleration angle acceleration of the centrifuge and the actual turbidity of the supernatant , calculating a precipitate stability index for the centrifugation operation using the following formula : , wherein, is the sedimentation stability index, is the deceleration angle acceleration of the centrifuge; Sub-step , using the final condition determination ≤ and ≥ When both the actual turbidity of the supernatant and the sediment stability index satisfy the determination condition, the supernatant is finally confirmed as a qualified clear sample supernatant.
Citation Information
Patent Citations
Method for rapidly detecting transgenic product with nucleic acid chromatography
CN108828230A