Recombinant collagen type i and uses thereof

Abstract

The application relates to a recombinant type I collagen and application thereof, which utilizes the characteristics of Pichia pastoris capable of secreting and expressing recombinant proteins, secretes the recombinant type I collagen on the culture medium supernatant, and reduces the difficulty of protein purification. In addition, the integrin site RGD is inserted into the collagen to form a recombinant type I collagen with high stability and high expression. According to the relative proliferation of cells and the relative adhesion experiment of cells, it can be seen that the recombinant type I collagen has the effects of promoting the proliferation of skin fibroblasts, improving the skin, promoting wound healing, promoting the adhesion of fibroblasts in the skin layer and the like. Therefore, the recombinant type I collagen has great potential applications in the fields of skin care and beauty, medical treatment and the like.

Description

TECHNICAL FIELD

[0001] The present disclosure relates to the field of bioengineering, in particular to a recombinant collagen type I and application thereof. BACKGROUND

[0002] Collagen is the most abundant protein in the human body (25-30%), widely distributed in skin, bone, tendon and other tissues, with functions of maintaining tissue morphology and promoting repair. The global collagen market size reached 103 billion yuan in 2019, and is expected to continue to grow to 152 billion yuan in the future, mainly applied in medical cosmetology, functional skincare, tissue engineering and other fields.

[0003] Traditional collagen is mainly extracted from animal tissues by acid, alkali or enzyme method, but there are problems such as animal source disease risk (such as viral contamination), high immunogenicity, long production cycle (3-5 months), and strong dependence on animal resources for large-scale production. Now the mainstream is to obtain by gene recombinant expression, and the gene engineering technology produces recombinant collagen by microorganism or eukaryotic expression system, which has the following advantages:

[0004] High safety: avoid animal source pathogen risk, low immunogenicity;

[0005] Customization: humanized sequences or truncated fragments can be designed to optimize functions (such as promoting cell adhesion and triple helix structure stability);

[0006] High production efficiency: microorganism (such as Pichia pastoris) culture cycle only needs 2-3 days, suitable for industrialization amplification.

[0007] However, at present, prokaryotic expression has the problem of insufficient post-translational modification, which makes it difficult to realize the hydroxylation and glycosylation of natural collagen, affects the function, and needs multiple purification means to reach the medical device level requirement, in addition, the cost of endotoxin control is high. The cost of plant cell culture and mammalian cell culture is high, and the culture medium and process need to be further optimized. In addition, the existing collagen type I generally has a degradation verification in the fermentation process, which leads to purification difficulty. SUMMARY

[0008] In order to solve the above problems, the present application provides a recombinant collagen type I and application thereof.

[0009] In one aspect of the present application, a recombinant collagen type I is provided, and a preparation method of the recombinant collagen type I, the method comprising the following steps:

[0010] Selecting amino acid monomers meeting the high activity sequence condition and repeating 8 times to obtain an optimized human collagen type I amino acid sequence;

[0011] The gene sequence is reversely designed based on the amino acid sequence of human type I collagen;

[0012] The gene sequence is removed at least one enzyme cutting site based on the codon pair direction required by the host cell expression and synthesized to obtain the optimized target gene;

[0013] The enzyme cutting site is re-introduced into the target gene and inserted into the expression vector, the recombinant plasmid is recombined and transferred into the host cell for expression, and the recombinant type I collagen is obtained by secretion.

[0014] Preferably, the amino acid sequence of the human type I collagen amino acid sequence is shown as SEQ ID NO: 1.

[0015] Preferably, the nucleotide sequence of the target gene is shown as SEQ ID NO: 2.

[0016] Preferably, the enzyme cutting site of the removal treatment includes Xhol and NotI enzyme cutting sites.

[0017] Preferably, the enzyme cutting site re-introduced into the target gene includes Xhol and NotI enzyme cutting sites.

[0018] Preferably, the expression vector is pPIC9K.

[0019] In another aspect of the present application, a recombinant type I collagen is prepared by the preparation method described above.

[0020] In another aspect of the present application, a host cell comprising the recombinant type I collagen prepared by the preparation method described above or the recombinant type I collagen described above is also provided.

[0021] Preferably, the host cell is Pichia pastoris.

[0022] In another aspect of the present application, the application of the recombinant type I collagen in the preparation of medicines, cosmetics or medical devices is also provided.

[0023] The technical effects of the present application are as follows:

[0024] The present application utilizes the characteristics of Pichia pastoris that can secrete and express recombinant proteins, and secretes the recombinant type I collagen in the culture supernatant, reduces the difficulty of protein purification, and utilizes artificial intelligence to predict high activity, high expression and high stability sites. In addition, the integrin site RGD is ingeniously inserted into the collagen protein (the Xhol and NotI double enzyme cutting sites are introduced into the target gene and inserted into the expression vector pPIC9K), forming a recombinant type I collagen with high stability and high expression.

[0025] From the above cell relative proliferation and cell relative adhesion experiments, it can be seen that the recombinant collagen type I has the effects of promoting skin fibroblast proliferation, improving skin, promoting wound healing, promoting skin layer fibroblast adhesion and the like. Therefore, the recombinant collagen type I has great potential applications in skin care and beauty, medical treatment and the like.

[0026] Other features and aspects of the present disclosure will become apparent from the following detailed description of exemplary embodiments, taken in conjunction with the accompanying drawings. BRIEF DESCRIPTION OF DRAWINGS

[0027] The accompanying drawings, which are incorporated in and constitute a part of this specification, illustrate exemplary embodiments, features, and aspects of the present disclosure and serve to explain the principles of the present disclosure.

[0028] Figure 1 It is a schematic diagram of recombinant plasmid construction;

[0029] Figure 2 It is a genomic sequencing diagram of expression strain (horizontal placement);

[0030] Figure 3 It is a schematic diagram of SDS-PAGE running of expression strain fermentation product;

[0031] Figure 4 It is a schematic diagram of SDS-PAGE running of target protein after purification of recombinant collagen type I product;

[0032] Figure 5 It is a schematic diagram of HSF cell relative adhesion rate (100%);

[0033] Figure 6 It is a schematic diagram of HSF cell relative proliferation rate (100%). DETAILED DESCRIPTION

[0034] Various exemplary embodiments, features, and aspects of the present disclosure will be explained hereinafter with reference to the accompanying drawings. Like reference numerals in the drawings denote like elements or components. Although various aspects of the embodiments are illustrated in the drawings, the drawings are not necessarily drawn to scale unless specifically indicated.

[0035] The word "exemplary" is used herein to mean "serving as an example, instance, or illustration." Any implementation described herein as "exemplary" is not necessarily to be construed as preferred or advantageous over other implementations.

[0036] In addition, for better illustration of the present disclosure, numerous specific details are given in the following detailed description. Those skilled in the art will understand that the present disclosure can be practiced without certain specific details. In some instances, well-known means, elements and circuits are not described in detail in order to emphasize the principles of the present disclosure.

[0037] The reagents, devices, etc. used in the present application can be provided by the laboratory or purchased on the market.

[0038] The present application adopts the Pichia expression system, which can secrete and express recombinant proteins. The recombinant collagen type I is secreted in the culture supernatant, which reduces the difficulty of protein purification. Artificial intelligence is used to predict high activity, high expression and high stability site. In addition, the integrin site RGD is inserted into the collagen protein to form a recombinant collagen type I with high stability and high expression.

[0039] Example 1, construction of Pichia expression system containing recombinant collagen type I

[0040] Taking pPIC9K (purchased from Invitrogen Company) as the backbone, the optimized gene sequence was introduced into the multiple cloning site (Xhol and NotI) respectively to obtain pPIC9K-COll-I, and finally transformed into Pichia GS115. The detailed steps are as follows:

[0041] 1. According to the human collagen type I mature peptide sequence published by the protein resource database UniProt (website https: / / www.uniprot.org / ), a high-activity sequence (GERGAAGLPGPKGDRGDAGPKGADGSPGPAGPQGPRGDKGETGEQGDRGIKGERGAAGLPGPKGDRGDAGPKGADGSPGPAGPQGPRGDKGETGEQGDRGIKGERGAAGLPGPKGDRGDAGPKGADGSPGPAGPQGPRGDKGETGEQGDRGIK) was selected and repeated 8 times to obtain the optimized human collagen type I amino acid sequence as shown in SEQ ID NO: 1.

[0042] Among them, the operation steps of selecting a high-activity sequence and repeating multiple times can refer to the following embodiments:

[0043] Step 1: Obtain human collagen type I mature peptide sequence

[0044] Use keyword search: In the search box of the UniProt database, enter keywords related to "human type I collagen mature peptide sequence", such as "Homo sapiens type I collagen mature peptide sequence", and then filter out the results related to the target sequence.

[0045] Confirm sequence information: Carefully review the search results to confirm whether the obtained sequence information is the human type I collagen mature peptide sequence, including species information, sequence length, sequence annotation, etc., to ensure the accuracy and integrity of the sequence.

[0046] Step 2: Understand the characteristics of high-activity sequences

[0047] Consult literature: Use academic search engines such as PubMed, Web of Science, etc. to search for research literature on human type I collagen high-activity sequences. These literatures may report some high-activity sequences with specific functions (such as promoting cell proliferation, enhancing collagen synthesis, etc.) and their characteristics.

[0048] Analyze sequence structure and function relationship: Understand the structure and function characteristics of human type I collagen, as well as the relationship between different sequence regions and activity. For example, certain specific amino acid composition, sequence pattern or domain may be related to high activity.

[0049] Refer to existing research results: Refer to the characteristics and standards of high-activity sequences determined in existing researches to provide reference for subsequent sequence selection.

[0050] Step 3: Select high-activity sequences

[0051] Sequence alignment and analysis: Use bioinformatics software such as ClustalW, MAFFT, etc. to align the obtained human type I collagen mature peptide sequence with known high-activity sequences. Through alignment analysis, find out the similar regions with high-activity sequences.

[0052] Evaluate sequence activity potential: According to the characteristics and standards of high-activity sequences, evaluate each region in the human type I collagen mature peptide sequence. Consider factors such as amino acid composition, sequence length, structural characteristics, etc. to predict the activity potential of each region.

[0053] Determine high-activity sequences: Based on the results of sequence alignment and activity evaluation, select a sequence with high activity potential as the target high-activity sequence. Record the start and end positions of the sequence and the specific amino acid sequence.

[0054] Step 4: Repeat the selected high-activity sequence

[0055] Manual copy-paste: If the number of repetitions is small, you can manually copy the selected high-activity sequence and paste it into a suitable text editing tool, repeating the paste as many times as needed.

[0056] Script programming: If the number of repetitions is large, you can use a programming language (such as Python, Perl, etc.) to write a script to perform sequence repetition operations. The following is an example code using Python to implement sequence repetition:

[0057] # Define the selected high-activity sequence

[0058] active_sequence = "ABCDE" # Replace with the actual selected high-activity sequence

[0059] # Define the number of repetitions

[0060] repeat_times = 5 # Replace with the actual number of repetitions needed

[0061] # Repeat the sequence

[0062] repeated_sequence = active_sequence repeat_times

[0063] print(repeated_sequence).

[0064] Step 5: Verify the accuracy of the repeated sequence

[0065] Sequence length check: Calculate the length of the repeated sequence to ensure that its length meets expectations. The length of the repeated sequence should be equal to the length of the selected high-activity sequence multiplied by the number of repetitions.

[0066] Sequence content check: Carefully check the content of the repeated sequence to ensure that the amino acid sequence of each repeated unit is consistent with the selected high-activity sequence, without errors or omissions.

[0067] Use sequence verification tools: You can use bioinformatics software or online tools, such as the seqret tool of EMBOSS, to verify the repeated sequence to ensure its format and content accuracy.

[0068] Use the online design tool Jcat (http: / / www.jcat.de / ) to design the gene sequence in reverse, targeting the preferred codons required for expression in the host Pichia pastoris. Remove the Xhol and NotI enzyme cutting sites during the design process. Commission Jinersi Biological Technology Co., Ltd. to synthesize the optimized COll-I gene. The optimized gene sequence is shown in SEQ ID NO:2.

[0069] Construction of recombinant strain: the target gene shown in SEQ ID NO. 2 was introduced into Xhol and Notl double enzyme cutting sites and inserted into expression vector pPIC9K to obtain a recombinant plasmid (schematic diagram see Figure 1 ), the linearized recombinant plasmid was respectively electroporated into Pichia pastoris GS115, identified by colony PCR and sent to Beijing Qikexing Biotechnology Co., Ltd. for sequencing (schematic diagram see Figure 2 ) The base sequences of primers F and R are shown in SEQ ID NO: 3 and SEQ ID NO: 4 respectively:

[0070] SEQ ID NO: 3, tttataaatactactattgccagcat;

[0071] SEQ ID NO: 4, tgccggccctaaaggcgccgatggaa.

[0072] Example 2, screening of Pichia pastoris expression bacteria containing recombinant collagen type I

[0073] The recombinants were respectively coated on YPD solid plates containing G418 at concentrations of 0.5 mg / ml, 1 mg / ml, 2 mg / ml and 4 mg / ml, and placed in a 30°C incubator for 2-3 days, and the growth state of the recombinants was observed.

[0074] Example 3, preliminary expression of Pichia pastoris expression bacteria containing recombinant collagen type I

[0075] Take the identified positive strains (1#, 2#, 3#, 4#) 50 μl into the conical flask containing 10 ml BMGY, 30°C, 220r / min overnight culture, shake to OD600=2-6 (logarithmic growth, about 16-18h); centrifuge at room temperature at 5000r / min for 5min, collect the cells, remove the supernatant, resuspend the cells with 10ml BMMY, and perform induction expression; take 1ml sample from the culture medium every 24h, and add methanol to a final concentration of 0.5% to continue induction; centrifuge the samples at 10000r / min for 2min at the following time points 0, 24, 48, 72, 96h to collect the supernatant, and perform 96h SDS-PAGE gel verification (schematic diagram see Figure 3 , Lane is the lane, Lane1 is the control group, Lane2-5 are four positive clones respectively), and the results show that after 96h of shaking flask induction, protein SDS-PAGE gel verification shows that 2-4 positive clones are expressed.

[0076] Example 4, purification of recombinant collagen type I product

[0077] The fermentation broth of the 2# strain in Example 3 was centrifuged to collect the supernatant, which was filtered through a filter membrane and then purified by gel column chromatography, and the finished product was obtained by freeze-drying. The specific purification steps of the above human recombinant collagen protein are as follows: centrifuge the fermentation broth at 4200 rpm for 30 min, collect the supernatant, concentrate and wash the supernatant with ultrafiltration membrane to remove salt and pigment, take an appropriate amount of the above collagen protein solution, purify it by SP resin column chromatography, collect the eluate containing collagen protein, and wash, desalt and concentrate the eluate with ultrafiltration membrane. The target protein is collected by freeze-drying machine, and the SDS-PAGE running gel verification is shown in Figure 4 The results show that after cationic purification, only one target band appears in the SDS-PAGE gel, and the purity is ≥95%).

[0078] Example 5, Relative Proliferation Rate of Recombinant Type I Collagen Protein Cells

[0079] Take the logarithmic growth phase HSF cells (human skin fibroblasts) and inoculate them in a 96-well plate at a density of 1×10 5 6 / mL, 100 μL per well, and divide them into control and experimental groups. Place in a carbon dioxide cell culture incubator at 37°C, 5% CO2, and culture normally for 24 h. Prepare a recombinant type I collagen protein sample solution obtained from Example 4 with a concentration of 0.5 mg / ml using serum-free culture medium, and filter the solution through a 0.22 μm filter to remove bacteria. After the HSF cells are cultured normally for 24 h, discard the old culture medium, add 100 μL of serum-free culture medium to the control group, and add 100 μL of the recombinant type I collagen protein sample solution to the experimental group, with 3 parallel samples in each group. Continue to culture for 24 h, then discard the culture medium, and add 100 μL of CCK-8 (purchased from Shengong Bioengineering (Shanghai) Co., Ltd.) diluted 10 times with serum-free culture medium to each well, and place in a cell culture incubator for 2 h of incubation. The relative proliferation rate of the cells was detected by CCK-8 method, and the absorbance was measured at 450 nm wavelength by an enzyme marker. The cell proliferation rate (RGR) % = experimental group absorbance value / normal control group absorbance value × 100% (as shown in Figure 6 The results show that the recombinant type I collagen protein has a certain cell proliferation ability and no cytotoxicity within the selected concentration range.

[0080] Example 6, Adhesion Experiment of Recombinant Type I Collagen Protein

[0081] Take the logarithmic growth phase HSF cells (human skin fibroblasts) and inoculate them in a 96-well plate at a density of 1×10 5The HSF cells were inoculated in a 96-well plate at a density of 1,000 cells / mL, 100 μL per well, and divided into a control group and an experimental group. The plate was placed in a carbon dioxide cell incubator and cultured at 37°C and 5% CO2 for 24 hours. A solution of the recombinant collagen type I sample obtained in Example 4 was prepared at a concentration of 0.5 mg / mL using serum-free culture medium, and the solution was filtered through a 0.22 μm filter to remove bacteria. After the HSF cells were cultured for 24 hours, the old culture medium was discarded, 100 μL of serum-free culture medium was added, and the control group was added with an equal amount of serum-free culture medium, and the experimental group was added with 100 μL of the recombinant collagen type I sample solution, with three parallel samples in each group. After 24 hours of continuous culture, the culture medium was discarded, 100 μL of CCK-8 (purchased from Shengong Bioengineering (Shanghai) Co., Ltd.) diluted 10 times with serum-free culture medium was added to each well, and the plate was placed in a cell incubator for 2 hours of incubation. The absorbance was measured at a wavelength of 450 nm using a microplate reader. The relative cell adhesion rate was calculated (see the schematic diagram Figure 5 , and DMEM represents serum-free culture medium). The cell adhesion rate can reflect the activity of the collagen. The higher the activity of the protein, the better the external environment provided for the cells in a short time, and the better the cell adhesion. The cell adhesion rate can reflect the activity of the collagen. Taking the adhesion rate of the blank group as 1, the relative cell adhesion activity of the triple-helical structure recombinant collagen type I can be calculated.

[0082] From the above cell relative proliferation and cell relative adhesion experiments, it can be seen that the recombinant collagen type I of the present application not only has the ability to promote skin fibroblast proliferation, but also has the effects of improving skin, promoting wound healing, and promoting skin layer fibroblast adhesion, etc. Moreover, by utilizing the characteristics of Pichia pastoris that can secrete and express recombinant proteins, the recombinant collagen type I is secreted in the culture medium supernatant, reducing the difficulty of protein purification, and by utilizing artificial intelligence to predict high activity, high expression, and high stability sites, in addition, the integrin site RGD is ingeniously inserted into the collagen protein to form a recombinant collagen type I with high stability and high expression. The recombinant collagen type I can support and structure, improve skin barrier, and promote wound healing, and can be well applied in, for example, medical and cosmetic fields.

[0083] The above is only a general description and implementation method of the present application, and does not limit the patent protection scope of the present application, but any equivalent changes made according to the specification and drawings of the present application, or direct or indirect use of the present patent to other related technical fields, are considered to be within the protection scope of the present patent.

[0084] The choice of terms used herein is intended to best explain the principles of the embodiments, practical applications, or improvements to the technology in the market, or to enable other ordinary skilled persons in the art to understand the embodiments disclosed herein.

Claims

1. A method for producing a recombinant collagen type I, characterized by, The method comprises the following steps: selecting amino acid monomers satisfying the high-activity sequence condition and repeating 8 times to obtain an optimized recombinant collagen type I amino acid sequence, the recombinant collagen type I amino acid sequence being shown as SEQ ID NO: 1; reverse designing a gene sequence based on the recombinant collagen type I amino acid sequence; removing at least one enzyme cutting site from the reverse-designed gene sequence based on a required codon of a host cell and synthesizing to obtain an optimized target gene; reintroducing an enzyme cutting site to the target gene and inserting into an expression vector to obtain a recombinant plasmid and transferring to a host cell for expression, and secreting to obtain the recombinant collagen type I.

2. The production method according to claim 1, characterized by, The nucleotide sequence of the target gene is shown as SEQ ID NO:

2.

3. The preparation method according to claim 1, characterized in that, The removed enzyme cutting site comprises Xhol and NotI enzyme cutting sites.

4. The method of claim 1, wherein, The reintroduced enzyme cutting site to the target gene comprises Xhol and NotI enzyme cutting sites.

5. The preparation method according to claim 1, characterized in that, The expression vector is pPIC9K. 6.A recombinant collagen type I prepared by the preparation method of any one of claims 1-5. 7.A host cell comprising the recombinant collagen type I prepared by the preparation method of any one of claims 1-5 or the recombinant collagen type I of claim 6.

8. The host cell of claim 7, wherein, The host cell is Pichia pastoris.

Images