L-arginine producing strain, construction method and application thereof

Abstract

The application provides an L-arginine production strain and a construction method and application thereof, and the corynebacterium glutamicum is reformed through a metabolic engineering method AJC , an arginine synthesis path is optimized, carbon sources are efficiently flowed to arginine through promoter replacement and multiple copies, and the like; an exogenous gene is introduced pyrAB E949* , supply of a precursor substance carbamoyl phosphate is strengthened; an exogenous gene is introduced pntAB , a new direction is provided for supply of coenzyme NADPH, and a large amount of reducing power is provided for synthesis of arginine; an exogenous gene is introduced fxpk , a NOG system is constructed, an acetyl coenzyme A pool is enriched, and a large amount of acetyl coenzyme A precursors are provided, the engineering bacteria have the characteristics of high yield and stability, and have good industrial application value in fermentation production of L-arginine.

Description

Technical Field

[0001] This invention relates to the field of metabolic engineering technology, and in particular to an L-arginine-producing strain, its construction method, and its application. Background Technology

[0002] L -arginine ( L - arginine It belongs to the non-essential amino acid family and can stimulate the secretion of growth hormone. It has wide applications in medicine and animal husbandry and has significant commercial value. Currently, L The main methods for producing arginine include enzymatic conversion, protein hydrolysis, and chemical synthesis. These methods are unsuitable for large-scale industrial production due to high costs, low yields, and environmental pollution. Microbial fermentation, however, overcomes these problems and is a green, environmentally friendly, and sustainable production method, thus becoming... L -A hot topic in arginine production.

[0003] Corynebacterium glutamicum, due to its relatively clear genetic background and ease of cultivation, is one of the important engineered strains for amino acid production. In Corynebacterium glutamicum, the metabolic pathway of arginine is quite complex, with intricate relationships between unknown intracellular metabolic networks and functional sites, directly affecting the growth and production of arginine-producing bacteria. Therefore, a high-yield, high-efficiency, and stable strain has been independently developed. L - The strains that produce arginine are a technical problem that urgently needs to be solved. Summary of the Invention

[0004] The technical problem to be solved by the present invention is to provide an L-arginine producing strain.

[0005] Another technical problem to be solved by the present invention is to provide a method for constructing the above-mentioned L-arginine producing strain.

[0006] Another technical problem to be solved by the present invention is to provide the application of the above-mentioned L-arginine producing strain.

[0007] To solve the above-mentioned technical problems, the technical solution of the present invention is as follows:

[0008] A strain that produces L-arginine, named strain ARG-8, is derived from Corynebacterium glutamicum (… Corynebacterium glutamicum AJC was used as the starting strain, and gene editing was performed using metabolic engineering techniques to obtain the genome with the repressor protein knocked out. argR repressor protein farR lactate dehydrogenase gene ldh Overexpression of the argJ gene B.subtilis 168 pyrAB E949* Genes, glutamate dehydrogenasegdh Derived from Escherichia coli Escherichia coli MG1655 pyridine nucleotide transferase pntAB and transport proteins lysE and use tuf The starter replaces the original starter of the operator argCJBDF.

[0009] Preferably, the above-mentioned L-arginine producing strain, wherein argR The nucleotide sequence is shown in SEQ ID NO.1 of the sequence listing. farR The nucleotide sequence is shown in SEQ ID NO.2 of the sequence listing. ldh The nucleotide sequence is shown in the sequence listing SEQ ID NO.3.

[0010] Preferably, the above-mentioned L-arginine producing strain, wherein argJ The nucleotide sequence of the gene is shown in SEQ ID NO.4 of the sequence listing. pyrAB E949* The nucleotide sequence of the gene is shown in SEQ ID NO.6 of the sequence listing. gdh The nucleotide sequence is shown in SEQ ID NO.7 of the sequence listing. pntAB The nucleotide sequence is shown in SEQ ID NO.8 of the sequence listing. lysE The nucleotide sequence is shown in the sequence listing SEQ ID NO.9.

[0011] Preferably, the above-mentioned L-arginine producing strain, wherein tuf The nucleotide sequence of the promoter is shown in SEQ ID NO.5.

[0012] The specific steps for constructing the above-mentioned L-arginine-producing strain are as follows:

[0013] (1) Corynebacterium glutamicum ( Corynebacterium glutamicum ) AJC Using the starting strain as an example, the repressor protein argR was knocked out to construct strain ARG-1;

[0014] (2) Continue to modify strain ARG-1, knock out the repressor protein farR, and obtain strain ARG-2;

[0015] (3) Continue to modify strain ARG-2, knock out the lactate dehydrogenase gene ldh, and at the same time, use at this site tuf Overexpression of argJ via the promoter yielded strain ARG-3.

[0016] (4) Continue to modify strain ARG-3 and use tufThe promoter was replaced with the original promoter of the operon argCJBDF to achieve overexpression and obtain strain ARG-4;

[0017] (5) Continue to modify strain ARG-4, using tuf Promoter overexpression originates from B.subtilis 168 pyrAB E949* Genes were extracted to obtain strain ARG-5;

[0018] (6) Continue to modify strain ARG-5, using tuf Promoter overexpression of glutamate dehydrogenase gdh strain ARG-6 was obtained;

[0019] (7) Continue to modify strain ARG-6, using tuf Promoter overexpression originates from E. coli Escherichia coli MG1655 pyridine nucleotide transferase pntAB strain ARG-7 was obtained;

[0020] (8) Continue to modify strain ARG-7 and use tuf Promoter overexpression of transport proteins lysE strain ARG-8 was obtained.

[0021] A strain for L-arginine production, named strain ARG-9-1, is based on strain ARG-8 mentioned above as the starting strain. sod Promoter overexpression of phosphatosterolase fxpk Obtained.

[0022] Preferably, the above-mentioned L-arginine producing strain, wherein fxpk The nucleotide sequence is shown in SEQ ID NO.11 of the sequence listing.

[0023] Preferably, the above-mentioned L-arginine producing strain, wherein sod The nucleotide sequence of the promoter is shown in the sequence listing SEQ ID NO.10.

[0024] The specific steps for constructing the above-mentioned L-arginine-producing strain are as follows: Using the above-mentioned strain ARG-8 as the starting strain, using... sod Promoter overexpression of phosphatosterolase fxpk The strain ARG-9-1 was obtained.

[0025] A strain producing L-arginine, named strain ARG-9, is derived from strain ARG-8 mentioned above and uses the tuf promoter to overexpress phosphatidylcholinease. fxpk Obtained.

[0026] The specific steps for constructing the above-mentioned L-arginine-producing strain are as follows: Using the above-mentioned strain ARG-8 as the starting strain, using... tuf Promoter overexpression of phosphatosterolase fxpk The strain ARG-9 (Corynebacterium glutamicum strain ARG-9) was obtained.

[0027] The above-mentioned phosphatidyl alcoholase gene fxpk Expression was achieved in chromosomes using metabolic engineering techniques, without the use of plasmids.

[0028] Application of the above-mentioned L-arginine-producing strains in the fermentation production of L-arginine.

[0029] Preferably, the above application includes the process of culturing a fermentation broth to obtain arginine products in a suitable culture medium, including but not limited to fermentation culture in shake flasks or fermenters for production. The culture medium used includes, but is not limited to, carbon sources, nitrogen sources, inorganic salts, vitamins, etc. Fermentation conditions include fermentation temperature, fermentation pH, fermentation dissolved oxygen conditions, fermentation pressure, fermentation time, etc. The culture medium can be obtained by conventional methods and used for arginine production. The fermentation conditions can be adjusted to suit the production characteristics of the strain.

[0030] Preferably, the above application uses fermentation in a fermenter, and the specific steps are as follows:

[0031] (1) Take the strain of Corynebacterium glutamicum and inoculate it into BHI solid slant from a 20% glycerol preservation tube at -80℃ for culture. The culture conditions are 32℃ and 12h. After two generations of activation, the bacteria on the second generation solid slant are used as the starting bacteria for the seed tank.

[0032] (2) Seed culture in the fermenter: Second-generation solid slant cells were washed off with sterile physiological saline and all were inoculated into a 5L fermenter for culture. The culture medium was brought to a final volume of 2L. The culture conditions were 32℃, pH 7.0, dissolved oxygen 30-50%, and cultured until OD reached 2000. 600 nm Reaching 15;

[0033] (3) Fermentation culture in a fermenter, the inoculation amount is 20% of the seed tank, the culture medium is fixed at 3 L, the culture conditions are 32℃, dissolved oxygen 30-50%, and ammonium sulfate is added simultaneously during the fermentation process.

[0034] Preferably, in the above application, the slant culture medium used in step (1) is BHI culture medium.

[0035] Preferably, in the above application, the seed culture medium used in step (2) is: MgSO4·7H2O 0.8-2g / L, yeast powder 4-5g / L, peptone 1.5-3g / L, K2HPO4·3H2O 2-6g / L, glutamic acid 1.3g / L, FeSO4·7H2O 4-8mg / L, MnSO4 4-8mg / L, VB1, VB3, and VB5 2-3mg / L each, and ammonium sulfate 5-8g / L.

[0036] Preferably, in the above application, the fermentation medium used in step (3) is: MgSO4·7H2O 1.5-3g / L, yeast powder 4-5g / L, peptone 2-3g / L, K2HPO4·3H2O 3-6g / L, glutamic acid 1.3g / L, FeSO4·7H2O 20-30mg / L, MnSO4 10-15mg / L, VB1, VB3 and VB5 each 2-3mg / L, ammonium sulfate 8-15g / L, and the concentration of added ammonium sulfate is 3g / L.

[0037] Preferably, the above application uses shake flask fermentation for production, and the specific steps are as follows:

[0038] ① Take the strain of Corynebacterium glutamicum, inoculate it into a seed shaker tube from a 20% glycerol preservation tube at -80℃ and culture it under the conditions of 32℃ for 12h, and use it as the starting strain for shake flask fermentation;

[0039] ② Shake flask fermentation culture, with an inoculum of 5 mL and a culture medium volume of 30 mL. The culture conditions are 32℃, 220 rpm, and pH 7.0.

[0040] Preferably, in the above application, the culture medium used in step ① is BHI culture medium.

[0041] Preferably, in the above application, the shake-flask fermentation medium used in step ② is: yeast extract 4 g / L, peptone 2 g / L, MgSO4·7H2O 2 g / L, (NH4)2SO4 5 g / L, KH2PO4 3 g / L, V B1 V B3 V B5 and V B12 1.5 mg / L each, Biotin 0.5 mg / L, FeSO4 5 mg / L, MnSO4 10 mg / L, Glucose 20 g / L, Phenol Red 20 mL / L, and 1 drop of defoamer.

[0042] All of the above-mentioned culture media can be prepared using standard methods.

[0043] Beneficial effects:

[0044] The above-mentioned L-arginine-producing strain was modified using metabolic engineering methods to produce Corynebacterium glutamicum (… Corynebacterium glutamicum ) AJC The construction strategy includes: 1. Removing the connection between argR and farR. L - Repression of the arginine synthesis operon; 2. Reduction of byproduct formation; 3. L -Enhancement of the arginine synthesis operon 4, strengthening L - Supply of arginine synthesis precursors; 5. Enhance NADPH supply; 6. L Overexpression of arginine transporter protein. This engineered bacterium exhibits high yield and stability, making it valuable for industrial applications.

[0045] This application optimizes the arginine synthesis pathway by using promoter substitution and multiple copying techniques to efficiently direct carbon sources to arginine; and by introducing exogenous genes. pyrAB E949* This enhanced the supply of the precursor carbamoyl phosphate; and by introducing exogenous genes pntAB This provides a new direction for the supply of coenzyme NADPH and a large amount of reducing power for arginine synthesis; by introducing exogenous genes fxpk A NOG (non-oxidative glycolysis) system was constructed, enriching the acetyl-CoA pool and providing a large amount of acetyl-CoA precursors. Furthermore, this strain can utilize glucose, which has low production costs, as a carbon source, exhibiting low production costs and high stability, and has the potential for large-scale arginine production. Attached Figure Description

[0046] Figure 1 This is the pK18mobsacB plasmid map. Detailed Implementation

[0047] To enable those skilled in the art to better understand the technical solution of the present invention, the technical solution of the present invention will be further described in detail below with reference to specific embodiments.

[0048] All technical means used in this invention are methods known to those skilled in the art. "Knockout" in this invention refers to the inactivation of a target gene through gene editing, while "introduction" refers to the insertion of a foreign gene into the genome of an engineered bacterium after linking it with a promoter and terminator through gene editing.

[0049] The starting strain used in the examples is Corynebacterium glutamicum ( Corynebacterium glutamicumAJC is the strain described in the Chinese journal "Construction of High-Yielding L-Arginine-Glutamate Corynebacterium" published in *Chinese Brewing*, and can also be obtained by purchasing from Tianjin University of Science and Technology. The corresponding promoters and genes are listed in the sequence listing. Primers used in the construction of the involved strains are listed in Table 1, and plasmids are listed in Table 2. The high-fidelity enzyme PCR system in the examples is shown in Table 3.

[0050] Table 1 Primers used in strain construction

[0051] Primer Name Sequence Number Primer Sequence (5’-3’) -US SEQ ID NO.17 TATGACATGATTACGAATTCCAGGCCTTAAGGGTAAGAAGGC -UA SEQ ID NO.18 GCCTTGAACTAGGGGCGCTGTCTTACCTCGGCTGGTTGGC -DS SEQ ID NO.19 GCCAACCAGCCGAGGTAAGACAGCGCCCCTAGTTCAAGGC -DA SEQ ID NO.20 TGCCTGCAGGTCGACTCTAGAACCGTTGAACTGCTTGCCAG [[ID=...]] -US SEQ ID NO.21 TATGACATGATTACGAATTCTCTAGATTGGAACCCTCCAGAA -UA SEQ ID NO.22 TACGGCGGTGACCGTTTGCCAAAATTTCACGAAGCTGCT -DS SEQ ID NO.23 AGCAGCTTCGTGAAATTTTGGCAAACGGTCACCGCCGTA -DA SEQ ID NO.2) TGCCTGCAGGTCGACTCTAGA GGTACCATTGTTAACATCCCA -US SEQ ID NO.25 TATGACATGATTACGAATTCAAAACAGCCAGGTTAGCAGCC -UA SEQ ID NO.26 GGATCTAAACGATCTGTTAACTTTCGATCCCACTTCCTGATTT P-S SEQ ID NO.27 GTTAACAGATCGTTTAGATCCGAAG P-A SEQ ID NO.28 -S TCCTCCTGGACTTCGTGGTG SEQ ID NO.29 ACCACGAAGTCCAGGAGGAATGGCAGAAAAAGGCATTACCG -A SEQ ID NO.30 GCCAACTAGGCCGCCAAAGATTTAAGAGCTGTACGCGGAGTTG -DS SEQ ID NO.31 ATCTTTGGCGCCTAGTTGGC -DA SEQ ID NO.32 TGCCTGCAGGTCGACTCTAGAGAGAATTTCGGCGTGCTCG P-US SEQ ID NO.33 TATGACATGATTACGAATTCCTGCAGCACTGGCCCTGTC P-UA SEQ ID NO.34 CGGATCTAAACGATCTGTTAACACGGGTTAGACATGCAAAAA PS SEQ ID NO.35 GTTAACAGATCGTTTAGATCCGAAG PA SEQ ID NO.36 TCCTCCTGGACTTCGTGGTG P-DS SEQ ID NO.37 CACCACGAAGTCCAGGAGGAATGATCATGCATAACGTGTATG P-DA SEQ ID NO.38 TGCCTGCAGGTCGACTCTAGAGGGAAACATCCTGGCACTGC -US SEQ ID NO.39 TATGACATGATTACGAATTCACGCGTTCAGGCTGTGGA -UA SEQ ID NO.40 GGATCTAAACGATCTGTTAACGGACACTCCTTTTCAATAAGAT PS SEQ ID NO.41 GTTAACAGATCGTTTAGATCCGAAG PA SEQ ID NO.42 TCCTCCTGGACTTCGTGGTG -1S SEQ ID NO.43 CACGAAGTCCAGGAGGAATGAAAGAGACGATTAGTACTGGAAAA -1A SEQ ID NO.44 GCAAGCCCTTCTTTGTCCTTATC -2S SEQ ID NO.45 GATAAGGACAAAGAAGGGCTTGC -2A SEQ ID NO.46 GCAATCCGTCGTGAGCCATTCATATAGTGACTGCCGCCTCC -DS SEQ ID NO.47 ATGGCTCACGACGGATTGC -DA SEQ ID NO.48 TGCCTGCAGGTCGACTCTAGACCAGCGATTTGGAACTTCTGC -US SEQ ID NO.49 TATGACATGATTACGAATTCTCGATGATTCCTTCGATGTGTTC -UA SEQ ID NO.50 CTTCGGATCTAAACGATCTGTTAACTCATTTTGAGGCCTTTCGAG P-S SEQ ID NO.51 GTTAACAGATCGTTTAGATCCGAAG P-A SEQ ID NO.52 TCCTCCTGGACTTCGTGGTG -S SEQ ID NO.53 CACCACGAAGTCCAGGAGGAATGACAGTTGATGAGCAGGTCTCT -A SEQ ID NO.54 CGCAATTTTCATTGTTGTTTCTTCTCTTAGATGACGCCCTGTGCCA -DS SEQ ID NO.55 GAGAAGAAACAACAATGAAAATTGCG -DA SEQ ID NO.56 TGCCTGCAGGTCGACTCTAGAGCTCCACCTTGAAGATCAACAAT -US SEQ ID NO.57 TATGACATGATTACGAATTCCGCCGTTGTGTCAGCAAAA -UA SEQ ID NO.58 CTTCGGATCTAAACGATCTGTTAACTTAGCTGCGTCCTCCTGCC P-S SEQ ID NO.59 GTTAACAGATCGTTTAGATCCGAAG P-A SEQ ID NO.60 TCCTCCTGGACTTCGTGGTG -S SEQ ID NO.61 CACCACGAAGTCCAGGAGGAATGCGAATTGGCATACCAAGA -A SEQ ID NO.62 GGTGGATCCTAACCAGGAGAGTTAATTTTTGCGGAACATTTTCA -DS SEQ ID NO.63 CTCTCCTGGTTAGGATCCACCA -DA SEQ ID NO.64 TGCCTGCAGGTCGACTCTAGAGGAGTGCGATGTCCCCTAGTT -US SEQ ID NO.65 TATGACATGATTACGAATTCCAAGAATCTCCAGGTTAAAGGTGC -UA SEQ ID NO.66 CGGATCTAAACGATCTGTTAACGCCCTGATGCCCTGTGGA P-S SEQ ID NO.67 GTTAACAGATCGTTTAGATCCGAAG P-A SEQ ID NO.68 TCCTCCTGGACTTCGTGGTG -S SEQ ID NO.69 CACCACGAAGTCCAGGAGGAATGGAAATCTTCATTACAGGTCTG -A SEQ ID NO.70 ACTGGCCTAACTCTCCGAGACTCTAACCCATCAACATCAGTTTGA -DS SEQ ID NO.71 AGTCTCGGAGAGTTAGGCCAGTT -DA SEQ ID NO.72 TGCCTGCAGGTCGACTCTAGATACCTGGACGATAATCCTCTGAC -US SEQ ID NO.73 TATGACATGATTACGAATTCCTGCGCGCTTTCATAGACCC -UA SEQ ID NO.74 CTTCGGATCTAAACGATCTGTTAACACATCGCCTTTCTAATTTCA Ptuf-fxpk-S SEQ ID NO.75 GTTAACAGATCGTTTAGATCCGAAG Ptuf-fxpk-A SEQ ID NO.76 TCCTCCTGGACTTCGTGGTG -S SEQ ID NO.77 CACCACGAAGTCCAGGAGGAATGGCGAGTCCTGTTACTG -A SEQ ID NO.78 GCCAGGGCGTGACCGGTGTTATCGCCAGCG -DS SEQ ID NO.79 CACCGGTCACGCCCTGGC -DA SEQ ID NO.80 TGCCTGCAGGTCGACTCTAGAGAGAACAAGATTCCGCCGTG --US SEQ ID NO.81 TATGACATGATTACGAATTCCTGCGCGCTTTCATAGACCC --UA SEQ ID NO.82 TTTTCGAAAGGAACATTCCTGTT ACATCGCCTTTCTAATTTCA P-S SEQ ID NO.83 AACAGGAATGTTCCTTTCGAAAA P-A SEQ ID NO.84 GGGTAAAAAATCCTTTCGTAGGTTT --S SEQ ID NO.85 ATGGCGAGTCCTGTTACTG --A SEQ ID NO.86 GCCAGGGCGTGACCGGTGTTATCGCCAGCG --DS SEQ ID NO.87 CACCGGTCACGCCCTGGC --DA SEQ ID NO.88 [[ID=

[0052] Table 2. Plasmids involved in the strain construction process.

[0053] ​ ​ ​ <![CDATA[Km R ]]> ​ <![CDATA[Cm R Carrying P ​ promoter fragments ​ <![CDATA[Km R Carrying P ​ promoter fragments ​ <![CDATA[Km R , carrying overlapping segments ∆ ​ ]]> ​ <![CDATA[Km R , carrying overlapping segments ∆ ​ ]]> pK18-::P <![CDATA[Km R Carrying overlapping segments ldh :: P tufargJ ]]> pK18- P::P <![CDATA[Km R Carrying overlapping fragment P argC ::P tufargC ]]> <![CDATA[pK18 mobsacB - adhE ::P tufpyrAB E949* ]]> <![CDATA[Km R Carrying overlapping fragments adhE ::P tufpyrAB E949* ]]> pK18-::P <![CDATA[Km R Carrying overlapping segments ocd ::P tufgdh ]]> pK18-::P <![CDATA[Km R Carrying overlapping segments ackA ::P tufpntAB ]]> pK18-::Ptuf-fxpk <![CDATA[Km R Carrying overlapping segments pta ::Ptuf-fxpk]]> pK18-::P <![CDATA[Km R Carrying overlapping segments pta ::P sod-fxpk ]]> pK18-::P <![CDATA[Km R Carrying overlapping segments amn ::P tuflysE ]]>

[0054] The above adhE The nucleotide sequence is shown in SEQ ID NO.12 of the sequence listing; ocd The nucleotide sequence is shown in SEQ ID NO.13 of the sequence listing; ackA The nucleotide sequence is shown in SEQ ID NO.14 of the sequence listing; pta The nucleotide sequence is shown in SEQ ID NO.15 of the sequence listing; amn The nucleotide sequence of the plasmid is shown in SEQ ID NO.16; the nucleotide sequence of the pK18mobsacB plasmid is shown in SEQ ID NO.89.

[0055] Table 3 Overlap PCR Amplification System

[0056] Component Volume (50 μL) Template 2.0 μL Forward primer (10 µmol / L) 1.0 μL Reverse primer (10 µmol / L) 1.0 μL dNTP mixture (10 mmol / L) 4.0 μL 5×Buffer 10.0 μL High-fidelity enzyme (5 U / μL) 0.5 μL ddH2O 31.5 μL

[0057] The construction steps of the L-arginine-producing strain in the following examples are as follows:

[0058] Step 1: Knock out the repressor protein argR ;

[0059] Step 2: Knock out the repressor protein farR ;

[0060] Step 3: Lactate dehydrogenase ldh Sites using P tuf Starter control argJ Gene overexpression;

[0061] Step 4: Place the operator argCJBDF The promoter is replaced with P tuf promoter;

[0062] Step 5: In alcohol dehydrogenase adh E site uses P tuf Starter controlpyrAB E949* Gene overexpression;

[0063] Step 6: Ornithine cyclization deaminase ocd Sites using P tuf Promoter controls glutamate dehydrogenase gdh Heterologous gene expression;

[0064] Step 7: In acetate kinase ackA Sites using P tuf Promoter controls pyridine nucleotide transhydrogenase pntAB Heterologous gene expression;

[0065] Step 8: At AMP nucleoside enzyme amn Sites using P tuf Promoter controls transport proteins lysE Overexpression; and / or

[0066] Step 9: At phosphorylated transacetylase pta The sites were used with P respectively tuf and P sod Promoter controls phosphatosterolase fxpk Gene overexpression.

[0067] Among them, exogenous genes pyrAB E949* Derived from Bacillus subtilis 168, exogenous gene pntAB Derived from Escherichia coli MG1655, exogenous gene fxpk It is derived from Bifidobacterium adolescentis.

[0068] The method for preparing the linear carrier in the embodiment is as follows: First, the carrier is placed in a container... Figure 1 The DH5α strain containing the pK18mobsacB plasmid was cultured in shake tubes for 12 hours at 37°C. The plasmid was then extracted and recovered using a plasmid extraction kit; detailed operating procedures were described in the instructions for the Plasmid Mini KitⅠ(200) manufactured by OMEGA (Guangzhou) Co., Ltd. A double digestion method was then used, with the digestion system incubated at 32°C for 30 minutes. The digestion system consisted of 2000 ng of recombinant plasmid, 1 μL each of the two restriction endonucleases, 5 μL of 10×Q.cut Buffer, and ddH2O to a final volume of 50 μL. Finally, using the linearized product from the double digestion as a template, PCR was used to amplify the linearized vector required for homologous recombination.

[0069] The recombinant DNA fragment preparation method in this embodiment is as follows: The recombinant DNA fragment generally needs to contain upstream and downstream homologous arms and the target gene fragment to be integrated (gene knockout does not require the target gene fragment). The upstream and downstream homologous arms of the cleavage site are obtained by PCR amplification using the genome of *Corynebacterium glutamicum* as a template. The target gene is obtained by PCR amplification using the genome of the strain to which the gene belongs as a template. Finally, the recombinant DNA fragment containing the upstream and downstream homologous arms of the cleavage site and the target gene fragment to be integrated is obtained by overlap PCR.

[0070] The method for recombining the ligated DNA fragment with the linearized vector in this embodiment: The recombinase from the ClonExpress® II OneStep Cloning Kit series was used to recombinant the ligated DNA fragment with the linearized pK18 vector. mobsacB Vector. The reaction system consisted of 4 μL of 5×CE II Buffer, 50 ng of linearized cloning vector, 20 ng of DNA fragment, 2 μL of Exnase® II, and ddH2O to a final volume of 20 μL. The mixture was incubated at 32°C for 30 minutes. The recombinant pGRB was then plasmidized and transformed into... E. coli DH5α Competent cells. Positive transformants were screened and cultured, and then plasmids were extracted and recovered using a plasmid extraction kit.

[0071] Example 1

[0072] Taking the knockout of the repressor protein argR gene as an example, this embodiment aims to illustrate the gene knockout steps of the present invention.

[0073] The specific steps for constructing strain ARG-1 are as follows: 1. Using the genome of Corynebacterium glutamicum 13032 as a template, primers were used to construct strain ARG-1. argR- US argR -UA as a group, with primers argR- DS argR -DA were grouped together, and the knockout genes were obtained separately using PCR amplification technology. argR The upstream and downstream homologous arms obtained in step 1 were purified and extracted using a DNA gel purification and recovery kit. 2. Using the upstream and downstream homologous arms obtained in step 1, ... argR- US argR -DA was used as primers, and PCR amplification was performed using overlap extension PCR technology. The DNA was then purified and extracted using a DNA gel purification and recovery kit to obtain the knockout DNA. argR 3. Extract pK18 fragments. mobsacB The plasmid was digested with XbaI and EcoRI to form a linear fragment, which was then recovered. 4. The obtained overlapping fragment was then combined with linearized pK18... mobsacBTransfected cells were transferred into DH5α competent cells, plated on 0.05 g / L kanamycin-resistant plates, and positive transformants were selected and pK18 was extracted. mobsacB -∆ argR 5. Plasmid. The constructed pK18 mobsacB -∆ argR The plasmid was transformed into Corynebacterium glutamicum by electroporation. Corynebacterium glutamicum AJC electrocompetent cells were plated on plates containing 0.01 g / L kanamycin and incubated at 32 °C for 24 hours. Colony PCR was performed, and agarose gel electrophoresis was used to verify the PCR fragments. Colonies growing on kanamycin-resistant plates were single colonies that had undergone single crossover. 6. The single colonies that successfully underwent single crossover were transferred to BHI medium and incubated at 32 °C. 50 μL of fermentation broth was transferred at 2 h, 4 h, and 6 h and plated on BHI plates containing 20% ​​sucrose, and incubated at 32 °C for 24 h. The single colonies were then spotted onto BHI plates containing 20% ​​sucrose and 0.01 g / L kanamycin-resistant plates. Single colonies that grew on the 20% sucrose BHI plates but not on the kanamycin-resistant plates were selected for colony PCR verification. If the PCR fragments were correct as confirmed by agarose gel electrophoresis, double crossover had occurred, and the successfully integrated single colony was identified as strain ARG-1. The gene knockout process was thus completed.

[0074] Knocking out the original farR promoter follows the same procedure as described above, the difference being the primers used. -US、 FarR -UA、 -DS、 FarR -DA.

[0075] Example 2

[0076] by ::P FarR For example, this embodiment aims to illustrate the steps of gene integration.

[0077] The specific steps are as follows: 1. Using the genome of Corynebacterium glutamicum 13032 as a template, and using primers... -US、 FarR -UA is a group, primers -S、 ldh -A is a group, primers -DS、 tufargJ -DA were grouped together, and P was obtained through PCR amplification. The upstream homologous arm, the target gene, and the downstream homologous arm; using pXT01 plasmid (nucleotide sequence as shown in SEQ ID NO. 90 in the sequence listing) as a template, and primer P... ldh -S、P -A is a group, and P is obtained. ldh The promoter was purified and extracted using a DNA gel purification and recovery kit. 2. The P obtained in step 1 was... The upstream homologous arm, promoter, target gene, and downstream homologous arm, to argJ US Using DA as primers, overlapping extension PCR amplification was performed, followed by purification and extraction using a DNA gel purification and recovery kit to obtain the integrated P. argJ 3. Extract pK18 fragments. The plasmid was digested with XbaI and EcoRI to form a linear fragment, which was then recovered. 4. The obtained overlapping fragment was then combined with linearized pK18... ldh Transfected cells were transferred into DH5α competent cells, plated on 0.05 g / L kanamycin-resistant plates, and positive transformants were selected and pK18 was extracted. - ldh ::P 5. Plasmid. The constructed pK18 tufargJ - ::P tufargJ The plasmid was transformed into ARG-2 electrocompetent cells via electroporation and plated on plates containing 0.01 g / L kanamycin, then incubated at 32 °C for 24 hours. Colony PCR was performed, and agarose gel electrophoresis was used to examine the PCR fragments. Colonies growing on kanamycin-resistant plates were single colonies that had undergone single crossover. The successfully crossovered single colonies were then transferred to BHI medium and incubated at 32 °C. At 2 h, 4 h, and 6 h, 50 μL of fermentation broth was transferred and plated on BHI plates containing 20% ​​sucrose, and incubated at 32 °C for 24 h. Single colonies were spotted onto BHI plates containing 20% ​​sucrose and 0.01 g / L kanamycin-resistant plates. Single colonies that grew on the 20% sucrose BHI plates but did not grow on the kanamycin-resistant plates were selected for colony PCR verification. Agarose gel electrophoresis was used to verify that the PCR fragments were correct, indicating that double crossover had occurred. The single colony that successfully integrated was identified as strain ARG-3. At this point, the gene integration work was completed.

[0078] Knocking out the original argC promoter and integrating the tuf promoter follows the same procedure as described above, the only difference being that the primer used is P. -US, P tufargJ -UA、P -S、P tufargJ -A, P -DS, P tufargJ -DA; similarly, knock out ocd and integrate P. The primers used are: ldh- -US、 -UA、Pldh -S、P -A、 tufargJ -S、 -A、 mobsacB -DS、 -DA; Knock out amn, integrate P mobsacB The primers used are: -US、 mobsacB -UA、P -S、P ldh -A、 -S、 tufargJ -A、 -DS、 mobsacB -DA.

[0079] Example 3

[0080] Taking the construction of ARG-5 as an example, this embodiment aims to illustrate the gene editing strategy of introducing exogenous genes.

[0081] The specific steps are as follows: 1. Using the genome of Corynebacterium glutamicum 13032 as a template, and using primers... -US、 ldh -UA as a group, with primers -DS、 tufargJ -DA were grouped together, and P was obtained through PCR amplification. E949* The upstream homologous arm; using pXT01 plasmid as a template, primer P... argCJBDF -S、P -A is a group, and P is obtained through PCR amplification technology. argCJBDF E949* The promoter; using the Bacillus subtilis 168 genome as a template, primers were used respectively. -1S, tufargCJBDF -1A is grouped together, with primers -2S, tufargCJBDF -2A were grouped together, and P was obtained through PCR amplification. E949* 1. The target gene fragment. 2. Using the P obtained in step 1... argCJBDF E949* The upstream homologous arm, promoter, target gene, and downstream homologous arm, to -US、 argCJBDF Using DA as primers, overlapping extension PCR amplification was performed, followed by purification and extraction using a DNA gel purification and recovery kit to obtain the integrated P. E949* 3. Extract pK18 fragments. tufgdhThe plasmid was digested with XbaI and EcoRI to form a linear fragment, which was then recovered. 4. The obtained overlapping fragment was then combined with linearized pK18... Transfected cells were transferred into DH5α competent cells, plated on 0.05 g / L kanamycin-resistant plates, and positive transformants were selected and pK18 was extracted. ocd - E949* 5. Plasmid. The constructed pK18 ocd - E949* The plasmid was transformed into ARG-4 electrocompetent cells via electroporation and plated on agar plates containing 0.01 g / L kanamycin, then incubated at 32 °C for 24 hours. Colony PCR was performed, and agarose gel electrophoresis was used to examine the PCR fragments. Colonies growing on kanamycin-resistant plates were single colonies that had undergone single crossover. The successfully crossovered single colonies were then transferred to BHI medium and incubated at 32 °C. At 2 h, 4 h, and 6 h, 50 μL of fermentation broth was transferred and plated on BHI plates containing 20% ​​sucrose, and incubated at 32 °C for 24 h. Single colonies were spotted onto BHI plates containing 20% ​​sucrose and 0.01 g / L kanamycin-resistant plates. Single colonies that grew on the 20% sucrose BHI plates but did not grow on the kanamycin-resistant plates were selected for colony PCR verification. Agarose gel electrophoresis confirmed that the PCR fragments were correct, indicating that double crossover had occurred. The single colony that successfully integrated the foreign gene was identified as strain ARG-5. Thus, the gene integration work of introducing the foreign gene was completed.

[0082] Knock out ackA and integrate exogenous P tufgdh The operation method is consistent with the above, the difference being that the primers used are... -US、 tufgdh -UA、P -S、P gdh gdh ocd ocd tuflysE amn amn tuflysE tufflysE lysE lysE amn amn adhE adhE adhE adhE tufpyrAB tufpyrAB tufpyrAB tufpyrAB pyrAB pyrAB pyrAB pyrAB tufpyrAB tufpyrAB adhE adhE tufpyrAB mobsacB mobsacB mobsacB adhE::PtufpyrAB mobsacB adhE::PtufpyrAB tufpntAB ackA ackA tufpntAB tufpntAB -A、 pntAB -S、 pntAB -A、 ackA -DS、 ackA -DA; Similarly, knocking out pta and integrating Ptuf-fxpk used primers that were... pta -US、 pta -UA、Ptuf-fxpk-S、Ptuf-fxpk-A、 fxpk -S、 fxpk -A、 pta -DS、 pta -DA; Knockout PTA, integration P sod-fxpk The primers used are Pta - sod -US、 Pta - sod -UA、Psod-fxpk -S、P sod-fxpk -A、 fxpk - sod -S、 fxpk - sod -A、 Pta - sod -DS、 Pta - sod -DA.

[0083] Example 4

[0084] The ARG-9 is constructed as follows:

[0085] By Corynebacterium glutamicum ( Corynebacterium glutamicum ARG-1 was obtained by knocking out argR from AJC, and the knockout was performed using the method described in Example 1; ARG-2 was obtained by knocking out farR from ARG-1, and the knockout was performed using the method described in Example 1; ARG-3 was obtained by knocking out ldh from ARG-2 and integrating ptufargJ at that site, and the integration was performed using the method described in Example 2; ARG-4 was obtained by knocking out the pargC promoter from ARG-3 and integrating the ptuf promoter at that site, and the integration was performed using the method described in Example 2; ARG-4 was obtained by knocking out adhE and integrating at that site. PtufpyrAB E949* The strain ARG-5 was obtained, and the integration was performed using the method described in Example 2; ARG-5 was integrated at this site after OCD was knocked out. Ptufgdh The strain ARG-6 was obtained, and the integration was performed using the method described in Example 2; ARG-6 was obtained by knocking out ackA and introducing exogenous material at that site. PtufpntAB The strain ARG-7 was obtained, and the introduction of the exogenous gene followed the operation method described in Example 3; ARG-7 was obtained by knocking out amn and integrating it at that site. PtuflysE The strain ARG-8 was obtained, and the integration was performed using the method described in Example 2; ARG-8 was modified by knocking out pta and introducing exogenous material at that site. Ptuf-fxpk The strain ARG-9 was obtained, and the introduction of the exogenous gene was carried out using the operation method described in Example 3.

[0086] Example 5

[0087] Screening for phosphatidylcholine enzyme fxpk from Bifidobacterium adolescentis using promoters of varying strengths. This example aims to illustrate the construction of a NOG (non-oxidative glycolysis) system by introducing the exogenous gene fxpk, enriching the acetyl-CoA pool, and comparing P... sod With P tuf Two promoters were used to express the strength of this enzyme. The specific procedures are as follows:

[0088] 1. Following the exogenous gene editing strategy described in Examples 3 and 4, P was introduced... sod - fxpk and P tuf - fxpk They were integrated into strain ARG-8, resulting in strains ARG-9-1 and ARG-9, respectively.

[0089] 2. The strains ARG-8, ARG-9-1 and ARG-9 were verified by shake-flask fermentation.

[0090] 3. Strains ARG-8, ARG-9-1, and ARG-9 were selected and inoculated into seed shake-flask culture tubes from 20% glycerol incubators at -80℃. The culture medium used was BHI medium, and the culture conditions were 32℃ for 12 hours, serving as the starting strains for shake-flask fermentation. The inoculum size was 5 mL, and the medium was adjusted to 30 mL. The culture conditions were 32℃, 220 rpm, and pH 7.0. After inoculation into the shake-flasks, the culture was carried out for 24 hours, during which the pH was maintained at approximately 7.0 using 25% ammonia. The shake-flask fermentation medium was as follows: yeast extract 4 g / L, peptone 2 g / L, MgSO4·7H2O 2 g / L, (NH4)2SO4 5 g / L, KH2PO4 3 g / L, V B1 1.5mg / L, V B3 1.5mg / L, V B5 1.5mg / L, V B12 1.5 mg / L, Biotin 0.5 mg / L, FeSO4 5 mg / L, MnSO4 10 mg / L, Glucose 20 g / L, Phenol Red 20 mL / L, Defoamer 1 drop.

[0091] 4. The results of shake-flask fermentation are shown in Table 4.

[0092] Table 4

[0093] strain L-arginine production (g / L) ARG-8 27.8 ARG-9-1 31.3 ARG-9 32.9

[0094] Fermentation results showed that, on the one hand, the introduction of the phosphatidylcholine enzyme fxpk from Bifidobacterium adolescentis significantly increased the yield of L-arginine, by 12% compared to strain ARG-8. On the other hand, the promoter P tuf With P sod In comparison, using the promoter P tuf The strain produced more L-arginine than when using promoter P sod The strain was 5.1% higher. Therefore, preferably, P will be used. tuf The promoter-derived ARG-9 was used as an L-arginine engineered bacterium.

[0095] Example 6

[0096] Using ARG-9 as the production strain, a fermenter validation experiment was conducted, as detailed below:

[0097] (1) Slant seed culture: The strain ARG-9 was inoculated from a 20% glycerol preservation tube at -80℃ into a BHI solid slant for activation culture. The culture conditions were 32℃ for 12h, and two generations were activated. The bacteria on the second generation solid slant were used as the starting bacteria for the seed tank.

[0098] (2) Seed culture in fermenter: Second-generation solid slant cells were washed off with sterile physiological saline and inoculated into a 5 L fermenter. The culture medium was brought to a final volume of 2 L. The culture conditions were 32℃, pH 7.0, dissolved oxygen 30-50%, and cultured until OD reached 2000. 600 nm Reaching 15;

[0099] (3) Fermentation culture in fermenter: The inoculum amount is 20% of the seed tank, the culture medium is 3 L, the culture conditions are 32℃, dissolved oxygen 30-50%, and ammonium sulfate with a concentration of 3g / L is added simultaneously during the fermentation process.

[0100] The slant culture medium used was BHI medium.

[0101] The seed culture medium used was: MgSO4·7H2O 1g / L, yeast extract 4g / L, peptone 2g / L, K2HPO4·3H2O 4g / L, glutamic acid 1.3g / L, FeSO4·7H2O 8mg / L, MnSO4 6mg / L, VB1, VB3, and VB5 2mg / L each, and ammonium sulfate 8g / L.

[0102] The fermentation medium used was: MgSO4·7H2O 2g / L, yeast extract 4g / L, peptone 3g / L, K2HPO4·3H2O 6g / L, glutamic acid 1.3g / L, FeSO4·7H2O 30mg / L, MnSO4 10mg / L, VB1, VB3, and VB5 2mg / L each, and ammonium sulfate 8g / L.

[0103] The final fermentation results of strain ARG-9 are as follows: L- Arginine yield was 115.6 g / L, sugar-acid conversion rate was 43%, and fermentation cycle was 48 h.

[0104] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention. Improvements and modifications such as strain modification based on the method of the present invention or based on the method are all considered to be within the scope of protection of the present invention.

Claims

1. An L-arginine-producing strain, characterized in that: The gene was obtained by gene editing using metabolic engineering techniques with Corynebacterium glutamicum AJC as the starting strain: the repressor protein gene was knocked out from the genome. argR repressor protein gene farR and lactate dehydrogenase gene ldh Overexpression of the argJ gene and B. subtilis 168 pyrAB E949* Gene, glutamate dehydrogenase gene gdh Originating from Escherichia coli Escherichia coli MG1655 pyridine nucleotide transferase gene pntAB and transport protein genes lysE and use tuf The promoter replaces the original promoter of the operator argCJBDF, wherein the... argR The nucleotide sequence is shown in SEQ ID NO.1 of the sequence listing. farR The nucleotide sequence is shown in SEQ ID NO.2 of the sequence listing. argJ The nucleotide sequence of the gene is shown in SEQ ID NO.4 of the sequence listing. pyrAB E949* The nucleotide sequence of the gene is shown in SEQ ID NO.6 of the sequence listing. gdh The nucleotide sequence is shown in SEQ ID NO.7 of the sequence listing. pntAB The nucleotide sequence is shown in SEQ ID NO.8 of the sequence listing. lysE The nucleotide sequence is shown in SEQ ID NO.9 of the sequence listing; tuf The nucleotide sequence of the promoter is shown in SEQ ID NO.5 of the sequence listing.

2. The L-arginine-producing strain according to claim 1, characterized in that: The ldh The nucleotide sequence is shown in the sequence listing SEQ ID NO.

3.

3. The method for constructing the L-arginine-producing strain according to claim 1 or 2, characterized in that: The specific steps are as follows: (1) Corynebacterium glutamicum AJC Using the starting strain, the repressor protein gene argR was knocked out to construct strain ARG-1; (2) Continue to modify strain ARG-1, knock out the repressor protein gene farR, and obtain strain ARG-2; (3) Continue to modify strain ARG-2, knock out the lactate dehydrogenase gene ldh, and at the same time, use at this site tuf Overexpression of the argJ gene in the promoter yielded strain ARG-3; (4) Continue to modify strain ARG-3 and use tuf The promoter was replaced with the original promoter of the operon argCJBDF to achieve overexpression and obtain strain ARG-4; (5) Continue to modify strain ARG-4, using tuf Promoter overexpression originates from B. subtilis 168 pyrAB E949* Genes were extracted to obtain strain ARG-5; (6) Continue to modify strain ARG-5, using tuf Promoter overexpression of glutamate dehydrogenase gene gdh strain ARG-6 was obtained; (7) Continue to modify strain ARG-6, using tuf Promoter overexpression originates from E. coli Escherichia coli MG1655 pyridine nucleotide transferase gene pntAB strain ARG-7 was obtained; (8) Continue to modify strain ARG-7 and use tuf Promoter overexpression of transporter genes lysE The target strain ARG-8 was obtained.

4. An L-arginine-producing strain, characterized in that: Using the strain described in claim 1 or 2 as the starting strain, sod Promoter overexpression of phosphatidylcholinesterase gene fxpk The obtained, wherein, fxpk The nucleotide sequence is shown in SEQ ID NO. 11 of the sequence listing; sod The nucleotide sequence of the promoter is shown in the sequence listing SEQ ID NO.

10.

5. The method for constructing the L-arginine-producing strain according to claim 4, characterized in that: The specific steps are as follows: Using the strain described in claim 1 or 2 as the starting strain, using... sod Promoter overexpression of phosphatidylcholinesterase gene fxpk The target strain ARG-9-1 was obtained.

6. An L-arginine-producing strain, characterized in that: Using the strain described in claim 1 or 2 as the starting strain, the phosphatidylcholine enzyme gene is overexpressed using the tuf promoter. fxpk The obtained, wherein, fxpk The nucleotide sequence is shown in SEQ ID NO.11 of the sequence listing; the nucleotide sequence of the tuf promoter is shown in SEQ ID NO.5 of the sequence listing.

7. The method for constructing the L-arginine-producing strain according to claim 6, characterized in that: The specific steps are as follows: Using the strain described in claim 1 or 2 as the starting strain, using... tuf Promoter overexpression of phosphatidylcholinesterase gene fxpk The target strain ARG-9 was obtained.

8. The use of the L-arginine-producing strain according to claim 1, 2, 4 or 6 in the fermentation production of L-arginine.

9. The application according to claim 8, characterized in that: The production process uses fermentation tanks, and the specific steps are as follows: (1) Take the strain of Corynebacterium glutamicum and inoculate it into BHI solid slant from a 20% glycerol preservation tube at -80℃ for culture. The culture conditions are 32℃ and 12h. After two generations of activation, the bacteria on the second generation solid slant are used as the starting bacteria for the seed tank. (2) Seed culture in the fermenter: Second-generation solid slant cells were washed off with sterile physiological saline and inoculated into a 5 L fermenter. The culture medium was brought to a final volume of 2 L. The culture conditions were 32℃, pH 7.0, dissolved oxygen 30-50%, and cultured until OD reached 2000. 600 nm Reaching 15; (3) Fermentation culture in a fermenter, with an inoculum of 20% of the seed tank volume, a culture medium volume of 3 L, and culture conditions of 32℃, dissolved oxygen of 30-50%, with ammonium sulfate added simultaneously during fermentation; or The production process uses shake-flask fermentation, and the specific steps are as follows: ① Take the strain of Corynebacterium glutamicum, inoculate it into a seed shaker tube from a 20% glycerol preservation tube at -80℃ and culture it under the conditions of 32℃ for 12h, and use it as the starting strain for shake flask fermentation; ② Shake flask fermentation culture, with an inoculum of 5 mL and a culture medium volume of 30 mL. The culture conditions are 32℃, 220 rpm, and pH 7.0.

Images