Method for preparing ovarian granular cell precursor cells and extracellular vesicles

Abstract

The invention belongs to the field of biomedicine, and particularly belongs to the crossing field of biomedical engineering and regenerative medicine. The technical problem to be solved by the invention is to provide an effective means for functional repair of premature ovarian failure or premature ovarian insufficiency. The technical means for solving the technical problem is to provide a method for preparing ovarian granular cell precursor cells and extracellular vesicles. The method comprises the following steps: culturing mesenchymal stem cells in the presence of estradiol, follicle stimulating hormone and transforming growth factor beta so as to differentiate the mesenchymal stem cells into ovarian granular cell precursor cells; wherein the precursor cells of the ovarian granulosa cells express granulosa cell markers FOXL2 and AMHR2. The extracellular vesicles obtained by culturing and collecting the precursor cells of the ovarian granular cells obtained by the method can achieve a better ovarian function repairing effect, so that a new means is provided for treating ovarian insufficiency diseases such as premature ovarian failure and the like.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of biomedicine, specifically to the cross field of biomedical engineering and regenerative medicine. Specifically, it relates to a method for preparing ovarian granulosa cell precursor cells and extracellular vesicles. BACKGROUND

[0002] Cell therapy refers to the process of sending living cells into the body of a patient to regulate, replace or eliminate abnormal cells, so as to achieve tissue regeneration and repair or disease treatment. Mesenchymal stem cell (MSC) transplantation shows multiple potential characteristics of cell therapy and is used for cell transplantation therapy of various diseases, including functional repair of premature ovarian failure (POF) or premature ovarian insufficiency (POI). Although stem cell therapy has achieved encouraging results, the shortcomings of cell therapy, such as tumorigenic potential, immune rejection and low survival rate, are not to be ignored and still pose a major limitation to its clinical application.

[0003] There are clinical trials showing that mesenchymal stem cells disappear soon after being transplanted, and their functions may be exerted through a paracrine pathway. Extracellular vesicles (EVs) are considered to be the key biological active paracrine mediators of MSCs, carrying various proteins, nucleic acids and other cell active substances, and regulating the activity or function of other cells through paracrine signaling, thus exerting the role of autologous MSCs locally or distally in the body.

[0004] Extracellular vesicles are microspheres encapsulated by lipid bilayer membranes secreted by cells, containing nucleic acids, lipids, proteins and other bioactive substances, and having the characteristics of parent cells. Any cell can produce extracellular vesicles, which can act as local or distal transporters of autologous cell contents and have the characteristics of relative inertness, non-immunogenicity, biodegradability and biocompatibility. In the same disease model, extracellular vesicles derived from mesenchymal stem cells can achieve similar effects as stem cells, and compared with mesenchymal stem cells, stem cell-derived vesicles have higher safety. Therefore, stem cell-derived extracellular vesicles have the potential to replace stem cells to achieve cell-free therapy.

[0005] Premature ovarian insufficiency (POI) refers to the ovarian failure in women before the age of 40, which is mainly manifested as the decrease in the number of follicles due to the apoptosis of granulosa cells, leading to hormone level disorder and infertility. Traditional hormone replacement therapy can alleviate the symptoms, but it cannot restore the activity of follicles, and long-term use of hormones can increase the risk of tumors. Mesenchymal stem cell-derived extracellular vesicles (MSC-EVs) have shown potential in treating reproductive diseases, not only because of their functional inclination to the parent cells, but also because of their higher biological stability and lower immunogenicity than MSCs. Previous studies have shown that MSC-derived EVs can restore the function of premature ovarian failure. Extracellular vesicles derived from umbilical cord mesenchymal stem cells (UC-MSCs) have been confirmed to improve ovarian function by delivering active substances such as miRNAs and cytokines, but their efficacy is still limited by the two bottlenecks of insufficient targeting and lack of functional proteins. SUMMARY

[0006] To solve the problems existing in the prior art, an effective means for functional repair of premature ovarian failure (POF) or premature ovarian insufficiency (POI) is provided. The present application provides a method for preparing ovarian granulosa cell precursor cells and extracellular vesicles, and the obtained ovarian granulosa cell precursor cells, extracellular vesicles, compositions and their applications.

[0007] Specifically, the method for preparing ovarian granulosa cell precursor cells provided by the present application comprises the following steps: culturing mesenchymal stem cells in the presence of estradiol, follicle-stimulating hormone and transforming growth factor β, so as to differentiate them into ovarian granulosa cell precursor cells; wherein the ovarian granulosa cell precursor cells express granulosa cell markers FOXL2 (forkhead box L2) and AMHR2 (Anti-Muellerian hormone type-2 receptor).

[0008] In the above method, the weight ratio of estradiol, follicle-stimulating hormone and transforming growth factor β is (15-25):(35-55):(10-15).

[0009] In the above method, the mesenchymal stem cells are cultured in a culture medium, and estradiol, follicle-stimulating hormone and transforming growth factor β are present in the culture medium. The concentration of estradiol in the culture medium is 15-25 ng / ml; the concentration of follicle-stimulating hormone in the culture medium is 35-55 ng / ml; and the concentration of transforming growth factor β in the culture medium is 10-15 ng / ml. Preferably, the culture medium further comprises FBS. Preferably, the culture is carried out for 3-5 weeks. Further, the culture medium is a stem cell basic medium.

[0010] wherein the mesenchymal stem cells in the above method are selected from at least one of umbilical cord mesenchymal stem cells, bone marrow mesenchymal stem cells or adipose mesenchymal stem cells. Preferably, the umbilical cord mesenchymal stem cells are selected from at least one of primary mesenchymal stem cells extracted from umbilical cord or umbilical cord mesenchymal stem cell strains.

[0011] Further, the cells in the above method are spindle-shaped, round or oval-shaped; and / or the expression of the pluripotency marker OCT4 (octamer-binding transcription factor 4) of the cells is reduced compared to the mesenchymal stem cells before culture. Further, the cells also express FSHR (Follicle-stimulating hormone receptor).

[0012] Of course, the present application also provides the ovarian granulosa cell precursor cells prepared by the above method.

[0013] The present application also provides a method for preparing extracellular vesicles. The method comprises the following steps:

[0014] 1) culturing mesenchymal stem cells in the presence of estradiol, follicle-stimulating hormone and transforming growth factor β, so as to differentiate them into ovarian granulosa cell precursor cells;

[0015] 2) culturing the ovarian granulosa cell precursor cells to produce extracellular vesicles;

[0016] 3) extracting the extracellular vesicles.

[0017] wherein in step 1) of the above method, the weight ratio of estradiol, follicle-stimulating hormone and transforming growth factor β is (15-25):(35-55):(10-15).

[0018] wherein in step 1) of the above method, the mesenchymal stem cells are cultured in a culture medium, and the concentration of estradiol in the culture medium is 15-25 ng / ml; the concentration of follicle-stimulating hormone in the culture medium is 35-55 ng / ml; the concentration of transforming growth factor β in the culture medium is 10-15 ng / ml. Preferably, the culture medium further comprises FBS or a serum substitute. Preferably, the culture is carried out for 3-5 weeks. Further, the culture medium is a stem cell basal medium.

[0019] wherein the mesenchymal stem cells in the above method are selected from at least one of umbilical cord mesenchymal stem cells, bone marrow mesenchymal stem cells or adipose mesenchymal stem cells. Preferably, the umbilical cord mesenchymal stem cells are selected from at least one of primary mesenchymal stem cells extracted from umbilical cord or umbilical cord mesenchymal stem cell strains.

[0020] The present application also provides an extracellular vesicle prepared by the method for preparing an extracellular vesicle.

[0021] Further, the extracellular vesicle has a lipid bilayer membrane, an average equivalent circle diameter of 50-900 nm, and contains CD81, CD63, TSG101 (Tumor Susceptibility Gene 101) and FOXL2. Preferably, the extracellular vesicle also contains FSHR.

[0022] Meanwhile, the present application also provides a pharmaceutical composition comprising the extracellular vesicle as a main effective component; in addition, it also comprises a pharmaceutically acceptable adjuvant. The pharmaceutical composition is mainly used for treating premature ovarian failure and / or premature ovarian insufficiency.

[0023] The present application also provides an induction differentiation composition comprising estradiol, follicle-stimulating hormone and transforming growth factor beta.

[0024] Further, the induction differentiation composition comprises estradiol, follicle-stimulating hormone and transforming growth factor beta in a weight ratio of (15-25):(35-55):(10-15); preferably, the composition is a cell culture medium.

[0025] In addition, the present application also provides the ovarian granulosa cell precursor cell and the extracellular vesicle for use in the preparation of a medicament for treating premature ovarian failure and / or premature ovarian insufficiency.

[0026] Compared with the prior art, the present application has the following advantages and positive effects:

[0027] The present application induces mesenchymal stem cells in vitro with a specific combination of substances to make them differentiate into ovarian granulosa-like cell precursor cells, and extracellular vesicles are produced from the ovarian granulosa-like cell precursor cells obtained by the induction. The present application finds that the extracellular vesicles thus obtained can target the ovary and repair the ovarian function, and compared with the extracellular vesicles produced from the mesenchymal stem cells before induction, the extracellular vesicles of the present application can achieve a better effect of repairing the ovarian function, which provides a new type of cell-free therapeutic preparation for the treatment of premature ovarian failure and other ovarian dysfunction diseases, and has good safety. In addition, the present application can also provide a new treatment scheme for the treatment of premature ovarian insufficiency and other infertility, and has good application prospect.

[0028] Furthermore, this invention provides novel tissue-specific cells / specific lineage cells by inducing directed differentiation of mesenchymal stem cells using a specific combination of substances, namely, the ovarian granulosa cell precursor cells described in this invention, which express granulosa cell markers FOXL2, AMHR2, and FSHR. This invention further provides novel extracellular vesicles with excellent biological activity secreted by these ovarian granulosa cell precursor cells. Attached Figure Description

[0029] Figure 1 This diagram illustrates a process for inducing umbilical cord mesenchymal stem cells to differentiate into ovarian granulosa cell precursor cells in one embodiment of the present invention.

[0030] Figure 2 This illustration shows the morphological changes of rat umbilical cord mesenchymal stem cells (rUCMSCs) during directed differentiation into ovarian granulosa cell precursor cells, according to one embodiment of the present invention. Wherein, a, b, and c correspond to... Figure 1 The cells are shown in three stages; a shows an optical microscope image of rUCMSCs at 40x magnification; b shows an optical microscope image of cells aggregated to form stem cell niche structures at 100x magnification; c shows an optical microscope image of induced ovarian granulosa cell precursor cells at 100x magnification.

[0031] Figure 3 The results of identifying the differentiation of rUCMSCs into ovarian granulosa cell precursor cells are shown. In section a, qPCR analysis shows the gene expression levels of stem cell pluripotency markers Oct4, granulosa cell markers Foxl2 (a specific marker), Amhr2, Cyp19a1, and Fshr in rUCMSCs and ovarian granulosa cell precursor cells. Values ​​are mean ± standard error (SEM) (n=5). The control group consisted of undifferentiated UCMSCs (day 0). Differentiated cells were ovarian granulosa cell precursor cells. Gapdh was used as an internal control for quantification. *P<0.05; **P<0.01. Section b shows immunofluorescence images of granulosa cell markers and stem cell pluripotency markers in differentiated cells. Bar: 100 μm.

[0032] Figure 4 Electron microscopy morphology (a), size (b), and protein characterization (c) of umbilical cord mesenchymal stem cell extracellular vesicles (rUCMSC-EVs) and ovarian granulosa cell precursor extracellular vesicles (GLC-EVs) of the present invention are shown; human umbilical cord mesenchymal stem cell extracellular vesicles (hUCMSC-EVs) and ovarian granulosa cell precursor extracellular vesicles of the present invention are also shown.

[0033] Figure 5The tendency of the ovarian granulosa precursor cell extracellular vesicles of the application to the ovary is shown. Figures a-g show the in vivo imaging of DiR fluorescence intensity of rat major organs, wherein a, b, c, d, e, f, g are brain, heart, lung, liver, kidney, spleen, uterus + ovary, respectively. Blue represents low fluorescence intensity; green represents medium fluorescence intensity; red represents high fluorescence intensity.

[0034] Figure 6 The fertility of POI rats after treatment with the ovarian granulosa precursor cell extracellular vesicles of the application is shown. Wherein a shows the photos of rats and their offspring after treatment; b shows the statistical results of the pregnancy rate of rats after treatment; 6c shows the statistical results of the number of live fetuses of rats after treatment.

[0035] Figure 7 The hormone levels of POI rats after treatment with the ovarian granulosa precursor cell extracellular vesicles of the application are shown. Wherein a is the E2 level; b is the AMH level; 3 is the FSH level.

[0036] Figure 8 The ovarian weight and ovarian index of POI rats after treatment with the ovarian granulosa precursor cell extracellular vesicles of the application are shown. Wherein a is the ovarian weight; b is the ovarian index.

[0037] Figure 9 The ovarian section and the number of follicles of POI rats after treatment with the ovarian granulosa precursor cell extracellular vesicles of the application are shown. Wherein a shows the ovarian section stained with hematoxylin-eosin (HE); b shows the total number of follicles in the left graph, and the number of different types of follicles in the right graph.

[0038] In the figures, "*" indicates p < 0.05, "**" indicates P < 0.01, and "***" indicates p < 0.001. DETAILED DESCRIPTION

[0039] The application is further described below by the description of specific embodiments and with reference to the accompanying drawings, but this is not a limitation of the application. Those skilled in the art can make various modifications or improvements to the application according to the basic idea of the application, but as long as they do not deviate from the basic idea of the application, they are within the scope of the application.

[0040] The application proposes to first induce mesenchymal stem cells to differentiate into precursor cells similar in function to ovarian granulosa cells, and the extracellular vesicles secreted by the precursor cells repair ovarian function. The application finds that the extracellular vesicles thus produced have good ovarian function repair effect, and the effect is better than that of the extracellular vesicles produced by mesenchymal stem cells.

[0041] Thus, one aspect of the present application is to provide a method for preparing ovarian granulosa cell precursor cells, comprising the following steps: culturing mesenchymal stem cells in the presence of estradiol, follicle-stimulating hormone and transforming growth factor β, so as to differentiate them into ovarian granulosa cell precursor cells. The precursor cells express granulosa cell markers FOXL2, AMHR2 and FSHR. Optionally, the weight ratio of the estradiol, follicle-stimulating hormone and transforming growth factor β is (15-25):(35-55):(10-15).

[0042] Preferably, the mesenchymal stem cells are cultured in a culture medium, and the concentration of the estradiol in the culture medium is 15-25 ng / ml; the concentration of the follicle-stimulating hormone in the culture medium is 35-55 ng / ml; the concentration of the transforming growth factor β in the culture medium is 10-15 ng / ml; preferably, the culture medium further comprises FBS or a serum substitute; preferably, the culture is carried out for 4-6 weeks.

[0043] The ovarian granulosa cell precursor cells obtained by the method of the present application are spindle-shaped, round or oval (as shown in FIG. 1). Figure 2 The expression of the pluripotency marker OCT4 of the cells is reduced compared with the mesenchymal stem cells.

[0044] The ovarian granulosa cell precursor cells obtained by the method of the present application are a new type of cells which are generated by the directional induction of mesenchymal stem cells, and can produce extracellular vesicles with excellent biological activity, for repairing ovarian function, treating premature ovarian failure and other ovarian dysfunction diseases.

[0045] Another aspect of the present application is to provide a method for preparing extracellular vesicles, comprising the following steps:

[0046] 1) culturing mesenchymal stem cells in the presence of estradiol, follicle-stimulating hormone and transforming growth factor β, so as to differentiate them into ovarian granulosa cell precursor cells;

[0047] 2) culturing the ovarian granulosa cell precursor cells to produce extracellular vesicles;

[0048] 3) extracting the extracellular vesicles.

[0049] Ovarian granulosa precursor cells are a layer of squamous (flat) somatic cells present in primordial follicles that surround the inactivated oocyte and are the direct precursors of mature granulosa cells (GCs). Ovarian granulosa cells (OGCs) are the core components of follicle development and function maintenance, playing a key role in follicular homeostasis by regulating oocyte growth, maturation and hormone secretion. In female mammals including humans, the delicate regulation of follicle development is essential for maintaining fertility. The ovarian granulosa precursor cells of the present invention are derived from mesenchymal stem cells directed differentiation into ovarian granulosa cells in the presence of E2, FSH and TGF-β, which are in an intermediate state in the differentiation chain, have the potential to further differentiate into ovarian granulosa cells, and express ovarian granulosa cell markers FOXL2, AMHR2 and FSHR.

[0050] Preferably, in the method of the present invention, the weight ratio of estradiol, follicle-stimulating hormone and transforming growth factor β is (15-25):(35-55):(10-15).

[0051] In some embodiments, the mesenchymal stem cells are cultured in a culture medium (e.g. complete medium corresponding to the specific species source of mesenchymal stem cells used, commonly used stem cell basal medium, etc.). The concentration of estradiol in the culture medium is preferably 15-25 ng / ml. The concentration of follicle-stimulating hormone in the culture medium is preferably 35-55 ng / ml. The concentration of transforming growth factor β in the culture medium is preferably 10-15 ng / ml. In one example of the present invention, serum-free DMEM / F12 medium is preferably used.

[0052] In other embodiments, the culture medium further comprises FBS or serum substitute. The amount of FBS can be 10%.

[0053] Preferably, the mesenchymal stem cells are cultured in the presence of E2, FSH and TGF-β for 3-5 weeks.

[0054] The mesenchymal stem cells of the present invention can be derived from human or mouse, and can be selected from umbilical cord mesenchymal stem cells, bone marrow mesenchymal stem cells and adipose mesenchymal stem cells. The umbilical cord mesenchymal stem cells can be selected from primary umbilical cord mesenchymal stem cells extracted from umbilical cord and umbilical cord mesenchymal stem cell strains. Specifically, the umbilical cord mesenchymal stem cells can be derived from primary domestication P0-P5 generations.

[0055] In step 2), the ovarian granulosa precursor cells are cultured to produce extracellular vesicles. The culture in this step can be carried out for 1-4 days. Further, the culture medium used for culture can be commonly used stem cell basal medium in the art. In one example of the present invention, serum-free DMEM / F12 medium is preferably used.

[0056] After the extracellular vesicles are produced extracorporeally, the extracellular vesicles are extracted from the culture supernatant. The specific steps can include: collecting the culture supernatant of the ovarian granulosa precursor cells, performing ultracentrifugation, and performing ultrafiltration, so as to obtain the extracellular vesicles.

[0057] Preferably, the condition of the ultracentrifugation is 50000xg-100000xg centrifugation at 4°C for 70-180 minutes. Also preferably, the condition of the ultrafiltration is 100KD, 1000xg centrifugation at 4°C for 3-10 minutes.

[0058] The extracellular vesicles obtained by the method of the present application have a lipid bilayer membrane, are circular or quasi-circular, have an average equivalent circle diameter of 50-900nm, and express CD81, CD63, TSG101 and FOXL2. Preferably, the extracellular vesicles also contain FSHR. In order to prove the specificity and credibility of the vesicles, the International Society for Extracellular Vesicles (ISEV) recommends detecting at least two types of markers of the transmembrane proteins (such as CD81, CD63) and the cytoplasmic proteins (such as TSG101) of the extracellular vesicles, and combining with a negative control (such as Calnexin, to exclude cell debris contamination). The detection shows that the extracellular vesicles obtained by the present application meet these standards, and also express FOXL2; and can further contain FSHR, and the expression of OCT4 is reduced, as shown in Figure 4 These characteristics indicate that the source is the induced ovarian granulosa precursor cells.

[0059] The present application finds that in vivo injection of the mesenchymal stem cell-derived ovarian granulosa precursor cell extracellular vesicles (GLC-EVs) obtained by the present application exhibits good ovarian tropism, can restore the estrus cycle of the POI rats, regulate serum hormones (increase E2\AMH and decrease FSH), activate primordial follicles, promote the development of primordial follicles, increase the number of primary and antral follicles, and restore the fertility of the rats. Therefore, the in vivo experiment proves that the GLC-EVs of the present application have the effect of restoring ovarian function and fertility.

[0060] In still another aspect, the present application provides an extracellular vesicle prepared by the method of the present application.

[0061] The extracellular vesicle has a lipid bilayer membrane, is circular or quasi-circular, has an average equivalent circle diameter of 50-900nm, and expresses CD81, CD63, TSG101 and FOXL2. Preferably, the extracellular vesicle also contains FSHR. These characteristics indicate that the source is the induced ovarian granulosa precursor cells. It can be understood by those skilled in the art that the characteristic proteins contained in the extracellular vesicle, such as CD81, CD63, TSG101 and FOXL2, and FSHR, are mainly carried on the lipid bilayer membrane, and of course can also be carried inside the vesicle.

[0062] The present application also provides a pharmaceutical composition comprising the extracellular vesicles and pharmaceutically acceptable adjuvants.

[0063] Preferably, the single dose of the extracellular vesicles is 50 - 100 μg EVs / 0.18 - 0.22 kg. The pharmaceutical composition can comprise a single dose of the extracellular vesicles.

[0064] The present application also provides an induction differentiation composition comprising estradiol, follicle-stimulating hormone and transforming growth factor β.

[0065] Preferably, the composition comprises estradiol, follicle-stimulating hormone and transforming growth factor β in a weight ratio of (15 - 25) : (35 - 55) : (10 - 15).

[0066] Preferably, the composition is a cell culture medium.

[0067] The induction differentiation composition can induce mesenchymal stem cells to differentiate into the ovarian granulosa cell precursor cells of the present application. Further, the differentiated ovarian granulosa cell precursor cells can produce the extracellular vesicles.

[0068] The present application also provides the ovarian granulosa cell precursor cells and the extracellular vesicles for use in the preparation of a medicament for treating premature ovarian failure or premature ovarian insufficiency.

[0069] The present application is further explained or described by way of examples below, but these examples should not be construed as limiting the scope of protection of the present application.

[0070] Unless otherwise specified, the experimental methods used in the following examples are performed using conventional experimental procedures, operations, materials and conditions in the field of bioengineering.

[0071] Unless otherwise specified, the percentage concentration (%) of each reagent refers to the volume percentage concentration (%) of the reagent.

[0072] Sources of reagents, materials and instruments:

[0073] Human umbilical cord mesenchymal stem cells (HUCMSC) are purchased from Wuhan Punsun Life Science and Technology Co., Ltd., China;

[0074] Estradiol, follicle-stimulating hormone and transforming growth factor β are purchased from Sigma Company, USA, MCE Biological Company, USA and MCE Biological Company, USA, respectively;

[0075] FBS (fetal bovine serum) is purchased from CLARK Bioscience Company, USA;

[0076] Optical microscope model Echo Revolve fluorescence microscope, purchased from ECHO company, USA;

[0077] Electron microscope model FEI Tecnai G2 spirit, purchased from FEI company, USA;

[0078] Human mesenchymal stem cell serum-free medium, product number CM-SC01, purchased from Ponsen Life Technology Co., Ltd., Wuhan, China;

[0079] DMEM / F12 medium, product number 12634010, purchased from Thermo Fisher Scientific, USA;

[0080] Healthy SD female rats and healthy SD male rats were purchased from the Experimental Animal Center of Chongqing Medical University, aged 6-8 weeks.

[0081] Example 1 Preparation and characterization of umbilical cord mesenchymal stem cells

[0082] Primary extraction of rat umbilical cord mesenchymal stem cells (rUCMSC):

[0083] 1. Take the umbilical cord tissue of healthy pregnant 19d SD rats and store it in pre-cooled DPBS (purchased from Lanjeke Technology Co., Ltd., Beijing, China, pH 7.2-7.6) for short-term storage.

[0084] 2. Repeat washing with PBS to remove excess tissue and residues.

[0085] 3. Cut the umbilical cord tissue into 1-2mm 3 small pieces, wash with DPBS for 3 times, remove the supernatant after the tissue settles, and treat with red blood cell lysis solution (purchased from Solabio Technology Co., Ltd., Beijing) on ice for 15min. After adding an appropriate amount of DPBS, centrifuge at 1000xg for 5min to collect the tissue.

[0086] 4. Wash with DPBS for 3 times, collect the tissue by centrifugation at 1000xg for 5min.

[0087] 5. Add an appropriate amount of 1mg / mL collagenase IV solution (Solabio Technology Co., Ltd., Beijing, product number Cat: C8160) and incubate at 4°C overnight.

[0088] 6. Take out and transfer to room temperature at 70rpm / min for 1h, observe every 10min until the tissue pieces become flocculent.

[0089] 7. Stop digestion with an equal volume of DMEM / F12 medium containing 10% fetal bovine serum (FBS) and filter through a 100μm sieve.

[0090] 8. Centrifuge the filtrate at 1000xg for 10min to collect the cells. Wash with PBS once.

[0091] 9. Resuspend the cells with DMEM / F12 medium containing 10% FBS and 1% double antibiotics (penicillin-streptomycin), then inoculate into culture flask and incubate in 37℃, 5% CO2 incubator.

[0092] 10. MSC cell identification, detect cell surface markers (such as CD90, CD44, CD34, CD45 and CD29) by flow cytometry and cell immunofluorescence, and use the cells meeting the characteristics for subsequent experiments.

[0093] Example 2 Induced differentiation and characterization of umbilical cord mesenchymal stem cells

[0094] 1. Culture rUCMSC and HUCMSC to 70-80% confluence in stem cell medium, wherein the stem cell medium is: HUCMSCs use human mesenchymal stem cell serum-free medium, and rUCMSCs use DMEM / F12 medium containing 10% FBS and 1% double antibiotics (penicillin-streptomycin). Remove the stem cell medium and replace it with an induced differentiation medium. The rUCMSC induced differentiation medium formula is: add 10% FBS, 20 ng / mL estradiol, 50 ng / mL follicle-stimulating hormone and 15 ng / mL transforming growth factor β to DMEM / F12 medium. The HUCMSC induced differentiation medium formula is: add 20 ng / mL estradiol, 50 ng / mL follicle-stimulating hormone and 15 ng / mL transforming growth factor β to human mesenchymal stem cell serum-free medium.

[0095] 2. Incubate in a 37℃, 5% CO2 incubator, and change the medium every 2-3 days.

[0096] 3. Culture for 3-5 weeks, and characterize and detect by cell immunofluorescence, cell flow analysis and real-time fluorescence quantitative PCR.

[0097] The antibodies and dilution ratios used for cell immunofluorescence and cell flow analysis are as follows:

[0098] OCT4, species: mouse, Santa Cruz Biotechnology, USA. Immunofluorescence (IF) dilution ratio: 1:200, flow cytometry (FC) dilution ratio: 1:200.

[0099] FOXL2, species: rabbit, Wuhan, China, Aibotek Biotech Co., Ltd. IF dilution ratio: 1:200, FC dilution ratio: 1:200. AMHR2, species: mouse, Santa Cruz Biotechnology, USA. IF dilution ratio: 1:200, FC dilution ratio: 1:200. FSHR, species: rabbit, Wuhan, China, Aibotek Biotech Co., Ltd. IF dilution ratio: 1:200, FC dilution ratio: 1:200.

[0100] Secondary antibody: Alexa Fluor 594 Affinipure Donkey Anti-Rabbit IgG (H+L); Alexa Fluor 594 Rabbit Anti-Rat IgG (H+L), Shanghai Yisen Biological Technology Co., Ltd. IF dilution ratio: 1:200, FC dilution ratio: 1:200.

[0101] DAPI, Shanghai Biyun Tian Biological Technology Co., Ltd., Catalog No. C1005.

[0102] The primer sequences used for RT-qPCR are as follows:

[0103] OCT4, upstream primer: CAAAGCAGAAACCCTCGTGC (SEQ ID No. 1); downstream primer: AACCACACTCGGACCACATC (SEQ ID No. 2).

[0104] FOXL2, upstream primer: AGTTTATGTCCTCCTGTGCTCAC (SEQ ID No. 3); downstream primer: GAAAGAGACGAGCCCAGTAGAAA (SEQ ID No. 4).

[0105] AMHR2, upstream primer: CACTGACTTCTGCAATGCCAATTA (SEQ ID No. 5); downstream primer: CTGTAGCAGGGCCAAGATGAT (SEQ ID No. 6).

[0106] CYP19A1, upstream primer: GCAAAGCACCCTAATGTTGAAGA (SEQ ID No. 7); downstream primer: CGAGTCTGTGCATCCTTCCAATA (SEQ ID No. 8).

[0107] FSHR, upstream primer: TTTGCCAGTGAGCTGTCAGT (SEQ ID No. 9); downstream primer: CAGGCAGATGCTCACCTTCA (SEQ ID No. 10).

[0108] Gapdh, upstream primer: GAAGGTCGGTGTGAACGGAT (SEQ ID No. 11); downstream primer: CCCATTTGATGTTAGCGGGAT (SEQ ID No. 12).

[0109] The primers mentioned above were synthesized by Beijing Genki Biological Technology Co., Ltd.

[0110] The qPCR reaction program was as follows: 95 °C for 2 min, 95 °C for 5 s, 60 °C for 10 s, for a total of 40 cycles.

[0111] The results are shown in Figure 3 From the figure, it can be seen that the expression of the stem cell pluripotency marker Oct4 of the induced cells was significantly reduced; the gene expression levels of the granulosa cell markers Foxl2, Amhr2, Cyp19a1 and Fshr were increased. This shows that the umbilical cord mesenchymal stem cells are induced to differentiate into ovarian granulosa cells, thereby obtaining ovarian granulosa cell precursor cells.

[0112] Example 3 Production and characterization of extracellular vesicles from ovarian granulosa cell precursor cells

[0113] 1. The ovarian granulosa cell precursor cells obtained in Example 2 were discarded into the induction differentiation medium, and washed with PBS for 3 times. Serum-free DMEM / F12 medium was added, and the supernatant was collected after 1-4 days.

[0114] 2. Centrifugation at 500 x g, 15 min, 4 °C to remove cells.

[0115] 3. Centrifugation of the supernatant at 2000 x g, 15 min, 4 °C to remove cell debris.

[0116] 4. Filtration through a 1.2 μm filter to further ensure the absence of cells.

[0117] 5. Filtrate, 100 KD ultrafiltration tube, 1000 x g, 3-10 min, 4 °C, centrifugation to remove small molecules.

[0118] 6. Concentrate the sample, 50000 x g-100000 x g, 70-180 min, 4 °C, ultra-speed centrifugation to collect vesicles.

[0119] 7. Characterization of EVs by NTA (nanoparticle tracking analysis), TEM (transmission electron microscopy) and WB (western blot). The results are shown in Figure 4 .

[0120] NTA (nanoparticle tracking analysis) detection is to track the Brownian motion of nanoparticles by laser scattering and microscopy, analyze their diffusion coefficient, and calculate the particle size and concentration using a signal processing system. In this experiment, the vesicles were diluted to 107 -10 9 The sample was injected into the sample cell, and the system was set up for detection. The software analyzed the trajectories of the particles, and the particle size distribution and concentration were outputted.

[0121] The antibodies used for WB are as follows:

[0122] SG101, species: rabbit, Biolegend, USA, WB dilution ratio 1: 1000.

[0123] CD63, species: rabbit, Biolegend, USA, WB dilution ratio 1: 1000.

[0124] CD81, species: rabbit, Biolegend, USA, WB dilution ratio 1: 1000.

[0125] Calnexin, species: rabbit, Biolegend, USA, WB dilution ratio 1: 1000.

[0126] FOXL2, species: rabbit, Wuhan Aibiotek Biological Technology Co., Ltd., WB dilution ratio 1: 1000.

[0127] FSHR, species: rabbit, Wuhan Aibiotek Biological Technology Co., Ltd., WB dilution ratio 1: 1000.

[0128] OCT4, species: mouse, Santa Cruz Biotechnology, USA, WB dilution ratio 1: 1000.

[0129] rUCMSC and HUCMSC cells were treated in the same way to produce and collect vesicles, and EVs were characterized in the same way.

[0130] Figure 4 a and b show the morphology and size of rUCMSC-EVs and GLC-EVs of rat origin, indicating that they are comparable in morphology and size. Figure 4 d and e show the morphology and size of HUCMSC-EVs and HGLC-EVs, indicating that they are also comparable in morphology and size. Figure 4 c shows the markers expressed by rUCMSC-EVs and GLC-EVs, both of which express CD81, CD63 and TSG101, and neither of which expresses Calnexin, meeting the standards of the International Society for Extracellular Vesicles (ISEV). In addition, GLC-EVs also express FOXL2 and FSHR, and the expression of OCT4 is reduced, indicating that they are derived from induced ovarian granulosa cell precursor cells.

[0131] Example 4 Ovarian tropism of GLC-EVs

[0132] 1. Rat-derived GLC-EVs obtained in Example 3 (1 x 10 10 - 1 x 10 11 The obtained GLC-EVs were labeled with DiR (purchased from MCE Bio Company, USA, item number HY-D1048) by incubating for 30 min in the dark, where DiR was prepared according to the instructions to a working solution of 1 to 5 μΜ.

[0133] 2. Washed once with PBS.

[0134] 3. 50 μg of labeled GLC-EVs were mixed with 100 μL of PBS, and then injected intraperitoneally into non-pregnant POI model (POI female rats were modeled as described in Example 5) female SD rats. After 48 h, the brain, heart, lung, liver, spleen, kidney, uterus and ovary were imaged using the MS FX Pro live imaging system (purchased from Carestream Molecular Imaging Company, USA).

[0135] The results are shown in Figure 5 , with the results before and after injection of GLC-EVs shown above and below, respectively. Blue indicates low fluorescence intensity in the figure; green indicates medium fluorescence intensity in the figure; and red indicates high fluorescence intensity in the figure. As can be seen from the figure, GLC-EVs have obvious ovary tropism and can target the ovary.

[0136] Example 5 Treatment of POI with GLC-EVs

[0137] POI female rats were modeled by intraperitoneal injection of 120 mg / kg cyclophosphamide (purchased from Merck Sigma, Germany, item number PHR1404) on day 1, followed by 8 mg / kg cyclophosphamide for 13 consecutive days, for a total of 14 days, to induce a POI animal model. After successful modeling, the POI rats were randomly divided into a model control group (PBS group), an rUCMSC-EVs injection group (treatment group), and a GLC-EVs injection group (treatment group). Healthy female SD rats of the same age served as a normal group. Each group had 20 rats, and the experiment was repeated 3 times.

[0138] 1. POI rats were treated with rat-derived GLC-EVs obtained in Example 3, treatment groups: 50 pg EVs / 0.18-0.22 kg intraperitoneal injection (50 pg EVs mixed in 100 pL PBS), once a week, for 2 consecutive weeks; PBS group: 100 pL PBS / 0.18-0.22 kg intraperitoneal injection, once a week, for 2 consecutive weeks; normal group: 100 pL PBS / 0.18-0.22 kg intraperitoneal injection, once a week, for 2 consecutive weeks. On the 14th day after the start of the first treatment, 8 female rats were randomly selected from each group and mated with healthy male SD rats according to the ratio of 2:1. The rats were mated from 4:00 pm to 6:00 pm on the same day. The rats were checked for the presence of sperm plugs from 8:00 am to 9:00 am the next morning. A sperm plug indicated successful mating. The gestation period was 19-22 days, and the number of pups was recorded after birth.

[0139] Figure 6 The fertility of the rats after treatment is shown. As can be seen from the figure, GLC-EVs can restore the fertility of POI rats. Compared with the PBS group, the pregnancy rate and the number of live-born fetuses in the GLC-EVs treatment group increased significantly; compared with the rUCMSC-EVs group, the pregnancy rate and the number of live-born fetuses also increased significantly.

[0140] 2. On the 14th day after the start of the first treatment, the rats were anesthetized with 2% isoflurane (purchased from Shenzhen Ruivode Life Science and Technology Co., Ltd., Catalog No. R510-22-10), and whole blood was collected by cardiac puncture. The whole blood was allowed to stand for 2 hours, and then centrifuged at 1000 x g for 5 minutes to obtain serum. The levels of E2, FSH and AMH in the serum samples of the rats after treatment were detected by the following ELISA kits, respectively. QuicKey Pro-Rat Estradiol Enzyme-Linked Immunosorbent Assay Kit, Catalog No. E-OSEL-R0001; Rat Follicle-Stimulating Hormone (FSH) Enzyme-Linked Immunosorbent Assay Kit, Catalog No. E-EL-R0391; Rat Anti-Mullerian Hormone (AMH) Enzyme-Linked Immunosorbent Assay Kit, Catalog No. E-EL-R3022; all purchased from Wuhan Elabscience Biotechnology Co., Ltd.

[0141] Figure 7 The hormone levels of the rats after treatment are shown. As can be seen from the figure, GLC-EVs can regulate the hormone levels of POI rats, increase the serum E2 and AMH levels, and reduce the serum FSH level.

[0142] 3. After euthanizing the experimental SD rats in accordance with the ethical guidelines, the abdominal cavity was exposed, the ovaries and uterus were located, the uterine horn was lifted with forceps, and the surrounding fat was separated. The ovary and fallopian tube were cut at the junction, pre-cooled PBS was used to rinse the bloodstains, filter paper was used to absorb the surface liquid, and the ovaries were photographed and weighed.

[0143] Figure 8The ovarian weight and ovarian index of rats after treatment are shown. As can be seen from the figure, GLC-EVs and rUCMSC-EVs significantly increase both ovarian weight and ovarian index, and the effect of GLC-EVs group is better than that of rUCMSC-EVs group.

[0144] 4. The collected ovaries were fixed with 4% paraformaldehyde at room temperature for 24-48 h, paraffin-embedded, and cut into 4 pm slices. On the largest cross-section of the ovary, 5 sections were made at an interval of 40 pm, and one of them was used for follicle counting. Figure 9 b). Five sections were selected from each ovary for hematoxylin-eosin (HE) staining. Figure 9 a). The morphological characteristics of the ovarian sections were observed, and the primordial, primary, secondary, and antral follicles were counted. Statistical analysis was performed using ordinary one-way ANOVA, followed by Dunnett's test. All data from at least 3 independent measurements are expressed as mean ± SEM. Statistical analysis was performed using GraphPad Prism 8.0. P<0.05, 0.01, 0.001, 0.0001 were statistically significant.

[0145] Figure 9 The follicle development of rats after treatment is shown. As can be seen from the figure, GLC-EVs reduce the number of primordial follicles and significantly increase the number of primary follicles and antral follicles, which indicates that GLC-EVs may improve follicle development and promote ovarian function recovery by promoting the activation of primordial follicles to primary follicles, and the effect of GLC-EVs is better than that of rUCMSC-EVs.

Claims

1. A method for preparing ovarian granulosa cell precursor cells, characterized in that... Includes the following steps: Mesenchymal stem cells were cultured in the presence of estradiol, follicle-stimulating hormone, and transforming growth factor β to differentiate them into ovarian granulosa cell precursor cells; wherein the ovarian granulosa cell precursor cells expressed granulosa cell markers FOXL2 and AMHR2.

2. The method for preparing ovarian granulosa cell precursor cells according to claim 1, characterized in that: The weight ratio of estradiol, follicle-stimulating hormone and transforming growth factor β used is (15-25):(35-55):(10-15).

3. The method for preparing ovarian granulosa cell precursor cells according to claim 1, characterized in that: Mesenchymal stem cells are cultured in a culture medium containing estradiol, follicle-stimulating hormone (FSH), and transforming growth factor β (TGF-β), wherein the concentration of estradiol in the culture medium is 15-25 ng / ml; the concentration of FSH in the culture medium is 35-55 ng / ml; and the concentration of TGF-β in the culture medium is 10-15 ng / ml. Preferably, the culture medium further contains FBS. Preferably, the culture is performed for 3-5 weeks.

4. The method for preparing ovarian granulosa cell precursor cells according to claim 1, characterized in that: The mesenchymal stem cells are selected from at least one of umbilical cord mesenchymal stem cells, bone marrow mesenchymal stem cells, or adipose mesenchymal stem cells; preferably, the umbilical cord mesenchymal stem cells are selected from at least one of primary mesenchymal stem cells extracted from the umbilical cord or umbilical cord mesenchymal stem cell lines.

5. The method for preparing ovarian granulosa cell precursor cells according to claim 1, characterized in that: The cells are spindle-shaped, round, or oval; and / or the expression of the pluripotency marker OCT4 in the cells is lower than that of the pre-culture mesenchymal stem cells. Furthermore, the cells may also express FSHR.

6. Ovarian granulosa cell precursor cells prepared by the method for preparing ovarian granulosa cell precursor cells according to any one of claims 1-5.

7. A method for preparing extracellular vesicles, characterized in that... Includes the following steps 1) Use the method for preparing ovarian granulosa cell precursor cells according to any one of claims 1-5 to culture mesenchymal stem cells and differentiate them into ovarian granulosa cell precursor cells; 2) Culture the ovarian granulosa cell precursor cells to generate extracellular vesicles; 3) Extract the extracellular vesicles.

8. Extracellular vesicles prepared by the method of claim 7.

9. The extracellular vesicle according to claim 8, characterized in that... Meets at least one of the following criteria: 1) Contains CD81, CD63, TSG101, and FOXL2; 2) The extracellular vesicle has a lipid bilayer membrane and an average equivalent circle diameter of 50-900 nm; Furthermore, the extracellular vesicles also contain FSHR.

10. The use of the ovarian granulosa cell precursor cells of claim 6, or the extracellular vesicles of claim 9 or 10, in the preparation of a medicament for treating premature ovarian failure and / or premature ovarian insufficiency.

11. A pharmaceutical composition comprising the extracellular vesicles of claim 10 or 11 and a pharmaceutically acceptable excipient.

12. A differentiation-inducing composition comprising estradiol, follicle-stimulating hormone, and transforming growth factor β.

13. The composition according to claim 12, wherein the composition comprises estradiol, follicle-stimulating hormone and transforming growth factor β in a weight ratio of (15-25):(35-55):(10-15); preferably, the composition is a cell culture medium; preferably, the concentration of estradiol in the culture medium is 15-25 ng / ml, the concentration of follicle-stimulating hormone is 35-55 ng / ml, and the concentration of transforming growth factor β is 10-15 ng / ml; preferably, the culture medium further comprises FBS.

Images