SNP molecular marker rs663564950 related to goat growth traits and application

Abstract

The invention relates to the technical field of modern livestock breeding, in particular to an SNP (Single Nucleotide Polymorphism) molecular marker rs663564950 related to growth traits of goats and application of the SNP molecular marker rs663564950. The SNP molecular marker is located at the 51bp position of a nucleotide sequence shown in SEQ ID NO.01, and the polymorphism of the SNP molecular marker is C / T. When the genotype of the polymorphic site contained in the molecular marker is CT or TT, the genotype corresponds to the relative advantage of the growth traits of the goat to be detected. The molecular marker provided by the invention can be applied to the identification or prediction of the growth state of the goat, can also be applied to the field of molecular breeding, and judges the genetic potential of the goat based on the analysis of the genotype of the goat; by optimizing the dominant allelotype of the SNP molecular marker, the 6-month-old weight of the goat offspring can be improved, so that the SNP molecular marker is further used for genetic improvement of breeding sheep, and the economic benefit of the mutton sheep breeding industry is effectively improved.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of modern livestock breeding technology, and particularly relates to a SNP molecular marker rs663564950 related to goat growth traits and application. BACKGROUND

[0002] The growth traits of goats are the core target traits in goat breeding, and the traditional breeding method mainly relies on phenotype selection and pedigree information, but has limitations such as long breeding cycle and low selection efficiency. With the development of molecular biology technology, molecular marker assisted selection (MAS) and genome selection (GS) have become important means of animal genetic breeding, and single nucleotide polymorphism (SNP) as the third generation of genetic markers is widely used in the genetic mechanism analysis and breeding practice of important traits due to its advantages such as rich quantity, wide coverage of genome and mature typing technology.

[0003] In the research of SNP related to goat growth traits, a number of candidate genes and sites have been reported, providing potential targets for molecular breeding. Limited by the diversity of genes, the effect of SNP sites in different goat breeds is not stable, and the universality and application value are limited. Therefore, it is of great significance to mine more new SNP sites to improve the efficiency of molecular breeding and accelerate genetic progress.

[0004] Therefore, the present application is proposed. SUMMARY

[0005] To solve the above technical problems, the present application provides a SNP molecular marker rs663564950 related to goat growth traits and application.

[0006] Specifically, the technical scheme of the present application is as follows:

[0007] In the first aspect, the present application provides a SNP molecular marker related to goat growth traits, which is located at the 51st bp of the nucleotide sequence shown in SEQ ID NO. 01, and the polymorphism is C / T.

[0008] Preferably, the genotype of the polymorphic site contained in the SNP molecular marker is CT or TT, which corresponds to the relative advantage of the growth traits of the goat to be tested.

[0009] Preferably, the genotype of the polymorphic site contained in the SNP molecular marker is CC, which corresponds to the relative disadvantage of the growth traits of the goat to be tested.

[0010] In the second aspect, the present application provides a substance for detecting the SNP molecular marker related to goat growth traits, including a PCR primer of a genomic DNA fragment containing the SNP molecular marker or a kit containing the primer.

[0011] In a third aspect, the present application provides the SNP molecular marker or the substance for use in at least one of the following:

[0012] (1) for identifying growth traits of goats;

[0013] (2) for predicting growth traits of goats;

[0014] (3) for identifying, improving or marker-assisted breeding of goat resources.

[0015] Preferably, the growth traits include 6-month body weight.

[0016] Preferably, the goat is Chu Bao black head goat, Macheng black goat, Boer goat, Yichang white goat or Matou goat.

[0017] In a fourth aspect, the present application provides a method for detecting growth traits of goats, comprising: detecting whether the single nucleotide marked by N in the sequence shown in SEQ ID NO: 1 is C or T, and judging the growth traits of the goat based on the detection result.

[0018] Preferably, primers for amplifying the sequence of SEQ ID NO: 1 are used to genotype the material of the Chu Bao black head goat to be tested, and if the genotype is CT or TT, it is judged that the individual to be tested has a relatively dominant 6-month body weight.

[0019] In a fifth aspect, the present application provides a genetic breeding method for improving growth performance of goats, wherein the SNP molecular marker of the goat core population is determined, the SNP molecular marker is located at the 51st bp of the nucleotide sequence shown in SEQ ID NO. 01, and the polymorphism is C / T; and according to the SNP molecular marker of the goat, corresponding selection is made: the individual with the 51st base of CT type and / or TT type in the SNP marker is selected for the next generation breeding of the breeding goat, and the individual with CC type is eliminated, so as to increase the frequency of gene T at this site generation by generation, thereby improving the growth performance of the offspring goats.

[0020] Advantages:

[0021] The application provides a SNP molecular marker rs663564950 related to the growth trait of a goat and an application thereof. The SNP molecular marker is located at the 51st bp of a nucleotide sequence shown in SEQ ID NO. 01, and the polymorphism thereof is C / T. When the genotype of the polymorphism site contained in the molecular marker is CT or TT, the relative advantage of the growth trait of the goat to be detected is obtained. The molecular marker provided by the application can be applied to the identification or prediction of the growth state of a goat, and can also be applied to the field of molecular breeding. Based on the analysis of the genotype of the goat, the genetic potential of the goat is determined. By selecting the advantage allele genotype of the SNP molecular marker, the 6-month-old body weight of the offspring of the goat can be improved, and the genetic improvement of the breeding goat is further used, so that the economic benefit of the mutton sheep breeding industry is effectively improved. BRIEF DESCRIPTION OF DRAWINGS

[0022] In order to more clearly illustrate the technical solutions in the application or the prior art, the drawings needed to be used in the embodiments or the prior art description will be described below.

[0023] Figure 1 The Manhattan plot of the growth trait (6-month-old body weight) of a goat. The black arrow points to the molecular marker screened in the application, and the marker is located on the 3rd chromosome of a goat. DETAILED DESCRIPTION

[0024] The main purpose of the application is to screen a molecular marker rs663564950 related to the growth trait of a goat, and to provide the application of the molecular marker in the detection of the growth trait of a goat or the breeding of a goat.

[0025] Firstly, the application provides a goat SNP molecular marker, which is rs663564950 located on the 3rd chromosome of a goat. The nucleotide sequence of the SNP site and the upstream and downstream 50 bp is as follows (SEQ ID NO: 1):

[0026] ATGCATATGATTCAATGCTACTCTCTCAGTTTGTCCCATCCTCTCCT TCC(C / T)CGGCTGTATCCACAAGTTTGTTCCTTATGTTTGTGCCTTCTTT ATTGCCC.

[0027] The N at the 51st base of the above sequence is a C51-T51 allele mutation, which causes nucleotide polymorphism of the sequence of SEQ ID NO: 1. The molecular marker can be used as a molecular marker for detecting the growth trait of a goat, and when the 51st nucleotide of the sequence shown in SEQ ID NO: 1 is T, the goat has a higher 6-month-old body weight.

[0028] The screened molecular marker can be applied to genotype analysis of goat growth trait related genes or goat growth trait related association analysis, and provides a new molecular marker resource for molecular marker assisted selection of goat growth traits.

[0029] The application further provides a reagent or kit comprising primers for detecting the SNP molecular marker.

[0030] The SNP molecular marker or the reagent or kit can be applied to detection of goat growth traits or goat breeding.

[0031] The goat can be Chubao black head goat, Macheng black goat, Boer goat, Yichang white goat, Matou goat or the like.

[0032] The application further provides a method for detecting goat growth traits, which detects whether the single nucleotide of the N marker in the sequence of SEQ ID NO: 1 is T or C.

[0033] As a more preferred and specific embodiment, the application uses primers for amplifying the sequence of SEQ ID NO: 1 to perform genotyping on the material of the goat to be detected.

[0034] The application preferably uses the aforementioned reagent or kit for detection.

[0035] The application also provides application of the single nucleotide polymorphism of the goat SNP site or a substance (reagent or kit) for detecting the single nucleotide polymorphism of the goat SNP site in detection or assisted detection of goat growth traits or goat breeding.

[0036] The application also provides a method for screening the SNP molecular marker, comprising the following steps:

[0037] ①Extracting goat genomic DNA, performing whole genome low-depth and high-depth resequencing to obtain original sequencing data;

[0038] ②Quality control of the original sequencing data, alignment to a goat reference genome, genetic variation detection and genotype filling of all autosomes of the sample by using a Sentieon+Beagle strategy, and obtaining high-quality SNP site data;

[0039] ③SNP sites are analyzed by using FarmCPU model through rMVP software to perform GWAS analysis on the 6-month-old body weight of the goat, to obtain SNP molecular markers related to the growth traits of the goat.

[0040] In the step 1, the low depth is preferably 1-2x, and the high depth is preferably 15-20x; preferably, the number of low depth is higher than that of high depth, so that the genotype filling is performed on the sequencing results of the low depth with the sequencing results of the high depth, and the sequencing cost is reduced.

[0041] The application further provides a genetic breeding method for improving the growth traits of goats, the above-mentioned SNP molecular markers of the breeding goats in the core group of goats are determined, and corresponding selection is made according to the SNP molecular markers of the goats: the individuals with the 51st base of CT type and / or TT type are selected for the next generation breeding of the breeding goats, and the individuals with the CC type are eliminated, so as to increase the frequency of the gene T at the site from generation to generation, thereby improving the 6-month-old body weight performance of the offspring goats.

[0042] In the following examples, the application is performed by whole genome resequencing on 500 Chubao black head goats, wherein the sequencing depth of 466 goats is low depth 1x, and the sequencing depth of 34 goats is high depth 15x, aiming at genotype filling on the sequencing results of the low depth (more) with the sequencing results of the high depth (less), thereby reducing the sequencing cost. Then, the resequencing data is aligned to the goat reference genome (genome version ARS1.2), genetic variation detection and genotype filling are performed on all autosomes of the 500 samples by using the Sentieon+Beagle strategy, SNP site data is obtained to carry out GWAS research related to the 6-month-old body weight of the goat, and finally the SNP (rs663564950) related to the 6-month-old body weight of the goat is screened, the site of the SNP marker is the 31541862th nucleotide site on the 3rd chromosome of the goat reference genome Capra hircus ARS1.2 version, and the base of the site is C or T. Referring to Ensembl, the nucleotide sequence of 50 bp upstream and downstream of the SNP site is obtained, the nucleotide sequence of the fragment is shown as SEQ ID NO:1, wherein the T at the 51st base is the nucleotide after allelic mutation, and the specific nucleotide sequence is:

[0043] ATGCATATGATTCAATGCTACTCTCTCAGTTTGTCCCATCCTCTCCT TCC(C / T)CGGCTGTATCCACAAGTTTGTTCCTTATGTTTGTGCCTTCTTT ATTGCCC.

[0044] The N at position 51 of the above sequence represents a C51-T51 allele mutation, resulting in nucleotide polymorphism in the SEQ ID NO:1 sequence. GWAS analysis showed that rs663564950 was significantly associated with goat growth traits (6-month-old body weight). Individuals with genotypes CT or TT had significantly higher 6-month-old body weights than CC individuals, indicating that T is an allele beneficial for improved growth traits. This molecular marker can be used to detect traits associated with goat growth, and the presence of T at position 51 of the sequence shown in SEQ ID NO:1 is beneficial for goats to achieve higher 6-month-old body weights, which is of significant importance for goat breeding.

[0045] This invention combines low-depth resequencing with genotype imputation and utilizes GWAS analysis to screen for significant SNP molecular markers affecting goat growth traits. These markers are then used in marker-assisted selection and genomic selection to select genotypes beneficial for improving goat growth traits for breeding. This progressively increases the gene frequency of dominant alleles, accelerating the breeding improvement process and bringing significant economic benefits to goat farming. This invention also verifies the effect of these SNP molecular markers on the 6-month-old body weight of goats, demonstrating their applicability in genetic improvement of breeding goats to increase 6-month-old body weight, thereby increasing the 6-month-old body weight of offspring and enhancing the market competitiveness of goat farming enterprises.

[0046] To make the objectives, technical solutions, and advantages of this invention clearer, the technical solutions of this invention will be clearly and completely described below. Obviously, the described embodiments are only some, not all, of the embodiments of this invention. All other embodiments obtained by those skilled in the art based on the embodiments of this invention without creative effort are within the scope of protection of this invention.

[0047] The endpoints and any values ​​of the ranges disclosed in this specification are not limited to the precise ranges or values, and these ranges or values ​​should be understood to include values ​​close to these ranges or values. For numerical ranges, the endpoint values ​​of the various ranges, the endpoint values ​​of the various ranges and individual point values, and individual point values ​​can be combined with each other to obtain one or more new numerical ranges, which should be considered as specifically disclosed herein.

[0048] In the description of the specification, the description of the terms "one embodiment", "some embodiments", "specific embodiments", or "some specific embodiments" and the like means that the specific features, structures, materials or characteristics described in connection with the embodiment or example are included in at least one embodiment or example of the embodiments of the present application. In the specification, the illustrative description of the above terms does not necessarily refer to the same embodiment or example. Moreover, the specific features, structures, materials or characteristics described can be combined in any appropriate manner in any one or more embodiments or examples. In addition, the person skilled in the art can combine and combine the different embodiments or examples described in the specification and the features of the different embodiments or examples without contradiction.

[0049] The materials, reagents, etc. used in the following examples can be obtained from commercial channels unless otherwise specified. The experimental methods in the examples not specified in the specific conditions are usually carried out according to the conventional conditions, or according to the conditions recommended by the manufacturer.

[0050] Example 1

[0051] This embodiment provides a whole genome resequencing method, which is specifically as follows:

[0052] 1. Blood sample collection and white blood cell separation.

[0053] Use the veterinary blood collection needle to collect 5 mL of blood sample from the jugular vein of the goat into an EDTA anticoagulation tube, place the anticoagulation tube in an ice box containing a large number of ice bags and take it back to the laboratory, store these samples in a refrigerator at 4°C, and extract white blood cells, the specific steps are as follows:

[0054] (1) Take 2-3 mL of blood sample into a 10 mL EP tube.

[0055] (2) Add ultrapure water to the EP to make the total liquid volume 9 mL.

[0056] (3) Slowly invert the EP tube up and down for 20 times, and stand for 10 min.

[0057] (4) Place the EP tube in the centrifuge, centrifuge at 5000 rpm for 10 min.

[0058] (5) Slowly pour out the supernatant of the EP tube.

[0059] (6) Add ultrapure water again to make the total liquid volume 9 mL.

[0060] (7) Repeat steps (3), (4), and (5).

[0061] (8) After the separation of the white blood cells is completed, number them and place them in a -80°C refrigerator.

[0062] 2. Genomic DNA extraction and whole genome resequencing.

[0063] The DNA of white blood cells was extracted using the genomic DNA small amount extraction kit of Tianmo Biology (item number: d3024), and the specific method was shown in the instruction. The qualified genomic DNA was sent to Beijing Nuowozhengyuan Technology Co., Ltd. for secondary inspection and library construction, and PE150 whole genome resequencing was performed on the Huada Gene platform. The original data was obtained, and the format of the original data was FASTQ. The 34 samples were subjected to high-depth whole genome resequencing, the average sequencing depth was about 19.72X, and the total data size was 1.4T. The 466 samples were subjected to low-depth whole genome resequencing, the average sequencing depth was about 1.65X, and the total data size was 1.6T.

[0064] Example 2

[0065] This example provides a genomic alignment, genetic variation detection and genotype filling method, which is as follows:

[0066] 1. Analysis of raw sequencing data and genomic alignment.

[0067] The high-depth sequencing data and the low-depth sequencing data were subjected to quality control using the same process.

[0068] (1) The raw data was filtered using Fastp software, and the filtering standards were as follows: removing reads with a base quality value lower than 20 and a proportion of more than 30%; removing reads with n base of more than 5%. The clean reads were obtained after the above quality control.

[0069] (2) The clean reads were aligned to the goat reference genome (Capra_hircus.ARS1.2) using BWA software.

[0070] (3) The sorted BAM file after alignment was obtained using Samtools software.

[0071] (4) The repeated reads were marked using Picard.

[0072] (5) The index was constructed using Samtools software.

[0073] 2. Variation site detection and genotype filling.

[0074] (1) GATK HaploytypeCaller generated gvcf files for each sample according to the chromosome number.

[0075] (2) GATK CombineGVCFs merged the gvcf files of each sample of single chromosome.

[0076] (3) GATK Genotype GVCFs by chromosome for population SNP calling.

[0077] (4) GATK Merge Vcfs to merge autosomal population vcf files.

[0078] (5) GATK Select Variants to filter SNPs from population vcf files.

[0079] (6) GATK Variant Filtration to flag false positive SNP sites.

[0080] (7) grep command to filter flagged SNP sites.

[0081] (8) Plink software to filter SNP sites (geno 0.1 --maf 0.05 --hwe 1e-06).

[0082] (9) Beagle software to fill in missing sites.

[0083] (10) Population genome genetic variant calling and phasing using Sentieon Haplotyper and GVCFtyper modules.

[0084] (11) Genotype filling using Beagle, resulting in 26131221 high quality SNPs.

[0085] Example 3

[0086] This example provides the application of the rs663564950 molecular marker genotyping method in goat growth trait association analysis, as follows:

[0087] rs663564950 molecular marker and goat growth trait (6-month-old body weight) association analysis.

[0088] (1) The phenotypes used for genotype and growth trait association analysis were measured by professional technicians strictly according to the measurement specification, and the live weight determined at the age of 360±15 days, after fasting for 12-16h and drinking for 2h, was expressed in kilograms (kg).

[0089] (2) GWAS analysis of SNP sites and 6-month-old body weight was performed by rMVP software using FarmCPU model.

[0090] The FarmCPU model uses fixed effect model and random effect model for iteration. The fixed effect analysis model is as follows:

[0091] y = Xb + Z t u t + Si d i +e

[0092] where y is the vector of observations of the trait; b is the vector of individual fixed effects including the first three principal components of SNPs, season of birth, birth order and birth weight; u t is the t by 1 vector of pseudo-quantitative trait nucleotide genotypes as fixed effects; X and Z t are the correlation matrices of b and u t respectively; S i is the i-th SNP marker, d i is the corresponding effect; e is the random residual effect vector, which follows a normal distribution e ~ N(0, Iσ e 2) .

[0093] The results of GWAS analysis showed that rs663564950 was significantly associated with goat growth traits (6-month weight), and the effects of different genotypes of the marker on goat growth traits were shown in Table 1.

[0094] Table 1 Effects of different genotypes of rs663564950 on goat growth

[0095]

[0096] Note: When the P value of the marker is < 0.05 / 26131221 ≈ 1.91E-09 (Bonferroni correction), it is a significant marker.

[0097] From Table 1, for the 6-month weight trait of goats, the 6-month weight of individuals with genotypes CT or TT was significantly higher than that of individuals with genotype CC, indicating that T is an allele that is beneficial to the improvement of growth traits.

[0098] Finally, it should be noted that the above examples are only preferred embodiments of the present application, which are used to illustrate the technical solutions of the present application, but not to limit them; although the present application has been described in detail with reference to the foregoing examples, those skilled in the art should understand that they can still modify the technical solutions recorded in the foregoing examples, or make equivalent replacement for part of the technical features; and these modifications or replacements do not make the essence of the corresponding technical solutions deviate from the spirit and scope of the technical solutions of the embodiments of the present application; therefore, any modification, equivalent replacement, improvement, etc. made within the spirit and principles of the present application should be included in the protection scope of the present application.

Claims

1. SNP molecular markers associated with growth traits in goats, characterized in that, The SNP molecular marker is located at the 51st bp of the nucleotide sequence shown in SEQ ID NO. 01, and the polymorphism is C / T.

2. The SNP molecular marker according to claim 1, characterized in that, The genotype of the polymorphic site contained in the SNP molecular marker is CT or TT, which corresponds to the relative dominance of the growth trait of the goat being tested.

3. The SNP molecular marker according to claim 1, characterized in that, The genotype of the polymorphic site contained in the SNP molecular marker is CC, which corresponds to a relative disadvantage in the growth traits of the goat being tested.

4. A substance for detecting the SNP molecular marker according to any one of claims 1-3, characterized in that, PCR primers for amplifying genomic DNA fragments, including the SNP molecular markers, or kits containing the primers.

5. The SNP molecular marker of any one of claims 1-3 or the substance of claim 4 in at least one of the following applications: (1) Application in identifying growth traits in goats; (2) Application in predicting growth traits in goats; (3) Application in goat resource identification, improvement or molecular marker-assisted breeding.

6. The application according to claim 5, characterized in that, The growth trait includes body weight at 6 months of age.

7. The application according to claim 6, characterized in that, The goat breeds mentioned are Chubao Blackhead Goat, Macheng Black Goat, Boer Goat, Yichang White Goat, or Matou Goat.

8. A method for detecting growth traits in goats, characterized in that, include: The N-labeled single nucleotide in the sequence shown in SEQ ID NO:1 of a goat is determined to be either C or T, and the growth traits of the goat are judged based on the detection results.

9. The method for detecting growth traits of goats according to claim 8, characterized in that, The primers of the amplified sequence SEQ ID NO:1 were used to perform genotyping on the Chubao blackhead sheep materials to be tested. If the genotype was CT or TT, the relative weight advantage of the individual at 6 months of age was determined.

10. A genetic breeding method for improving the growth performance of goats, characterized in that, Identify the SNP molecular markers described in claim 1 for breeding sheep in the core goat herd, and make corresponding selections based on the goat SNP molecular markers: in the successive breeding of breeding sheep, select individuals with the CT type and / or TT type at the 51st base of the SNP marker, and eliminate CC type individuals, so as to increase the frequency of the T gene at this locus in each generation, thereby improving the growth performance of offspring goats.

Images