Gene-coded opioid receptor fluorescent probe as well as preparation method and application thereof

Abstract

The invention discloses a gene-coded opioid receptor fluorescent probe as well as a preparation method and application thereof, the opioid receptor fluorescent probe comprises fusion of a human Mu-chip receptor and a green fluorescent protein, and the amino acid sequence of the opioid receptor fluorescent probe is shown as SEQ ID NO.1. The opioid receptor fluorescent probe constructed by the invention has good membrane positioning capability, good fluorescence signal stability and specificity and large detection range; the compound shows specific response to opioid drugs and endogenous opioid peptides (such as beta-enkephalin and enkephalin) in HEK293T cells, the fluorescence intensity and the ligand concentration are dose-dependent, the compound can be blocked by an antagonist, and the compound has excellent selectivity and pharmacological characteristics. The probe constructed by the invention can be used for novel analgesic drug development, pain mechanism research and addiction behavior monitoring.

Description

TECHNICAL FIELD

[0001] The application belongs to the field of gene drugs, and particularly relates to a gene-encoded opioid receptor fluorescent probe and a preparation method and application thereof. BACKGROUND

[0002] Mu-opioid receptor (MOR) belongs to the G protein-coupled receptor (GPCR) family and plays an important role in physiological processes such as pain, reward and respiration. Opioid drugs are considered to be the most effective analgesic drugs and are mainly used in clinical practice to relieve severe pain, mainly by binding to MOR and activating to exert analgesic effect. Although opioid drugs have strong analgesic effect, they also have obvious abuse potential, leading to serious adverse reactions such as addiction, respiratory depression and gastrointestinal dysfunction. With the increasing burden of opioid drug abuse, the development of new opioid drugs has great research interest. Specific detection and drug screening in living cells can more accurately reflect the role of opioid drugs in real biological systems, which is conducive to the study of biological activity and drug discovery. However, the progress of specific detection and screening of opioid drugs has been limited by poor specificity, low dynamic range and low throughput.

[0003] The existing detection methods are mainly based on two stages in the MOR signaling cascade: the binding process of opioid substances to MOR, and the downstream signaling events triggered by MOR activation. In terms of binding property detection, radioligand binding experiments can determine the affinity of opioid substances to MOR, but this method has low throughput and cannot provide key information on the efficacy of ligand-activated receptors. With the in-depth analysis of the MOR signaling mechanism, detection methods based on MOR-mediated downstream signaling events have gradually developed, including cAMP accumulation detection, calcium flow fluorescence technology, G protein and beta-arrestin-2 recruitment, and related kits have been commercialized in scientific research and pharmaceutical fields. However, due to the high complexity of the MOR activation mechanism, these methods are often interfered by other non-specific signals, leading to deviations in the detection results. At the same time, these technologies generally have strong dependence on high-precision instruments, radiation safety hazards, complex operation procedures, and difficulties in MOR protein purification, which significantly restrict their application in specific detection and drug screening in situ in living cells. Therefore, it is of great significance to develop more advanced and accurate detection tools and methods to break through the existing technical bottlenecks and accelerate the development of new drugs.

[0004] Gene-encoded fluorescent probes based on GPCRs and fluorescent proteins have been developed for studying the mechanisms and regulation processes of neurotransmitters and receptors in vivo and in vitro, which will have great potential in future in situ ultrafast imaging in living cells and screening of their ligands as safe, efficient and easy-to-use tools. However, there are still problems such as poor specificity, small fluorescence dynamic range and low stability for gene-encoded opioid receptor fluorescent probes, for example, the only Mu-opioid receptor gene-encoded fluorescent probe μLight reported in Nature Neuroscience in 2024 (Nat. Neurosci. 2024, 27(9), 1844-1857.) has a maximum fluorescence response of 54.9%, which is weak and has low sensitivity when used for opioid compound detection. SUMMARY

[0005] The present application aims to provide a gene-encoded opioid receptor fluorescent probe, which has greatly improved fluorescence intensity, with a maximum fluorescence intensity of 297.05%, which is 5.4 times that of the existing μLight fluorescent probe, and has good molecular selectivity and pharmacological properties, which is beneficial for opioid compound detection and drug screening applications.

[0006] The present application also provides a preparation method and application of the gene-encoded opioid receptor fluorescent probe.

[0007] Technical scheme: To solve the above technical problems, the present application provides a gene-encoded opioid receptor fluorescent probe, which comprises a fusion of a human Mu-opioid receptor and a green fluorescent protein, and the amino acid sequence is shown as SEQ ID NO. 1.

[0008] The amino acid sequence of the opioid receptor fluorescent probe is shown as SEQ ID NO. 2.

[0009] The gene-encoded opioid receptor fluorescent probe of the present application comprises the following steps:

[0010] The MOR and cpGFP sequences are used as templates to design primers, and PCR is used to produce DNA fragments of cpGFP and MOR with pDisplay homologous arms. The DNA fragments are digested and purified, and primers are designed to amplify or double-enzyme cut to produce linearized pDispaly vectors containing different break sites. The linearized pDispaly vectors are connected to the MOR and cpGFP fragments under the action of homologous recombinase to produce recombinant plasmids. The recombinant plasmids are transformed into competent cells, and single colonies are picked by antibiotic selection. After sequencing verification, the correct recombinant plasmids are extracted to obtain recombinant plasmids containing gene-encoded opioid receptor fluorescent probes.

[0011] Further, the recombinant plasmid is introduced into HEK293T cells by PEI (polyethylenimine) mediated transfection method, and the expression of the gene encoded opioid receptor fluorescent probe in the cells is observed by fluorescence microscopy.

[0012] The primers for generating the DNA fragments of cpGFP and MOR with pDisplay homologous arms by PCR are as follows:

[0013] pDis-MOR-F tacaaaaaagttggcacctctagaatggacag

[0014] MOR256-R atcaaagctctcacaatcagtccatagcacacggtaatgatgagc

[0015] MOR256-GFP-F attgtgagagctttgatttaccccgcgccggccgggccgcgcga

[0016] GFP-linker-R cttctcgcggttctgtcgcccgcgccagc

[0017] Linker-MOR-F cagaaccgcgagaagaggatcaccaggatggtgctgg

[0018] SalI-pDis-R ggggagggagaggggcgctagcttattcagggcaacggagcagtttctgc

[0019] The primers for designing, reverse PCR amplification or double enzyme digestion to generate linearized vectors containing different cleavage sites are as follows:

[0020] pDisplay-NheI-F gctagcgcccctctcc

[0021] pDisplay-XbaI-R tctagaggtgccaacttttttgtaca

[0022] The application of the gene encoded opioid receptor fluorescent probe in the expression and membrane localization of living cells.

[0023] The application of the gene encoded opioid receptor fluorescent probe in the detection and screening of opioid compounds.

[0024] The opioid compounds include (a) endogenous opioid peptides, including endorphins, endorphin peptides and enkephalins, etc.; (b) semi-synthetic or fully synthetic opioid drugs, such as DAMGO, loperamide, methadone and fentanyl and analogs thereof, etc.

[0025] The genetically encoded opioid receptor fluorescent probe can be used for visualizing and directly detecting the activation or inactivation of MOR in living cells affected by endogenous opioid peptides, MOR agonists and antagonists.

[0026] The kit for detecting and screening opioid compounds comprises the genetically encoded opioid receptor fluorescent probe.

[0027] The core design of the genetically encoded opioid receptor fluorescent probe in the application is based on the "conformation coupling" strategy. For the first time, the conversion of chemical signals to optical signals is realized by fusing human Mu-opioid receptor (MOR) with the circularly permuted fluorescent protein cpEGFP. The specific design points include: (1) Target receptor selection: MOR is selected as the skeleton because it has high specificity for opioid compounds, avoiding cross-reactions with other compounds. (2) Fluorescent module insertion: The environment-sensitive fluorescent protein (such as cpEGFP) is embedded in the third intracellular loop (ICL3) of the receptor, which is the region with the most significant conformational change upon ligand binding. (3) Further optimization of the linker and cpEGFP: The linker serves as a bridge between the functional domains (MOR and cpEGFP) in the fusion protein, which can regulate the efficiency of conformational change and signal transmission. The length and rigidity of the linker directly affect whether the conformational change induced by binding can be efficiently transmitted. At the same time, cpEGFP as the light-emitting unit determines the fluorescence response and signal-to-noise ratio, both of which cooperatively affect the fluorescence sensitivity, specificity and dynamic range of the probe. By optimizing the linker and key action sites, the direct correlation between fluorescence response and opioid compound concentration is ensured.

[0028] Compared with the traditional detection means, the gene-encoded opioid receptor fluorescent probe designed in the application has obvious advantages. In terms of time and space resolution, the traditional method such as microdialysis is minute and is an average of a tissue region, and electrochemical detection is second and is a local region; while the gene-encoded opioid receptor fluorescent probe can reach sub-second level, can realize single-cell level detection, and can track the instantaneous change of the opioid receptor activated by the opioid compound in real time. In terms of specificity, the traditional microdialysis relies on chromatographic separation, the specificity is moderate, and the electrochemical detection needs high potential and is easy to be disturbed, and the specificity is low; the gene-encoded opioid receptor fluorescent probe is highly specific and is not disturbed by other neurotransmitters and compounds, such as norepinephrine and 5-hydroxytryptamine. Compared with the same fluorescent probe, the fluorescence intensity of the gene-encoded fluorescent probe provided in the application is greatly improved, and the maximum fluorescence intensity of the opioid compound loperamide can reach 297.05%, which is 5.4 times of the existing muLight fluorescent probe (the maximum fluorescence response to beta-endorphin is 54.9%), and the gene-encoded fluorescent probe has good molecular selectivity and pharmacological properties, and can be used for opioid compound detection and drug screening applications.

[0029] Advantages: Compared with the prior art, the application has the following advantages:

[0030] The fluorescent probe provided in the application is constructed based on genetic engineering technology, and the Mu-opioid receptor (MOR) having the binding capacity for opioid drugs and endogenous opioid peptides is fused with the circularly permuted green fluorescent protein (cpGFP); the constructed opioid receptor fluorescent probe has good membrane positioning capacity, fluorescence signal stability, good specificity and large detection range; in the HEK293T cell, the opioid receptor fluorescent probe shows specific response to opioid drugs and endogenous opioid peptides (such as beta-endorphin and enkephalin), the fluorescence intensity is dose-dependent with the ligand concentration, can be blocked by an antagonist, and has excellent selectivity and pharmacological properties. The probe constructed in the application can be used for new analgesic drug development, pain mechanism research and addiction behavior monitoring. BRIEF DESCRIPTION OF DRAWINGS

[0031] Figure 1 is an agarose gel electrophoresis diagram;

[0032] Figure 2 is a map of the gene-encoded opioid receptor fluorescent probe;

[0033] Figure 3 is a partial sequencing diagram of the gene-encoded opioid receptor fluorescent probe;

[0034] Figure 4 is a membrane positioning and fluorescence response diagram of the gene-encoded opioid receptor fluorescent probe;

[0035] Figure 5 is the light stability of the gene-encoded opioid receptor fluorescent probe;

[0036] Figure 6 Fluorescence emission spectrum of the fluorescent probe for opioid receptor;

[0037] Figure 7 Fluorescence dose-effect relationship diagram of the fluorescent probe for opioid receptor to Leu-Enkephalin;

[0038] Figure 8 Fluorescence dose-effect relationship diagram of the fluorescent probe for opioid receptor to DAMGO;

[0039] Figure 9 Fluorescence dose-effect relationship diagram of the fluorescent probe for opioid receptor to Methadone;

[0040] Figure 10 Fluorescence dose-effect relationship diagram of the fluorescent probe for opioid receptor to Loperamide;

[0041] Figure 11 Blocking fluorescence response of the fluorescent probe for opioid receptor by opioid receptor antagonists naloxone and naltrexone;

[0042] Figure 12 No fluorescence response of the mutant of the fluorescent probe for opioid receptor to opioid receptor agonists;

[0043] Figure 13 Detecting and screening different types of opioid receptor agonists by the fluorescent probe for opioid receptor;

[0044] Figure 14 No fluorescence response of the fluorescent probe for opioid receptor to common endogenous neurotransmitters;

[0045] Figure 15 Schematic diagram of constructing high-throughput screening platform based on gene-encoded fluorescent probe for opioid receptor;

[0046] Figure 16 Schematic diagram of verifying fluorescence response ability of different fluorescent probes for opioid receptor expressed in HEK293T cells. DETAILED DESCRIPTION

[0047] The present application will be described in detail below by way of examples. The following examples are intended to better illustrate the present application and are not intended to limit the scope of the present application. Various changes and modifications can be made to the present application without departing from the spirit and scope of the present application.

[0048] Unless otherwise specified, the starting materials used in the examples of the present application are known products, which can be obtained by purchasing commercially available products.

[0049] I. Experimental materials and reagents

[0050] All primers used for PCR were synthesized, purified and identified correctly by Shenguo Bioengineering (Shanghai) Co., Ltd. The expression plasmids constructed in the examples were all sequenced, and the sequencing was completed by Beijing Chengkai Biological Co., Ltd. The high-fidelity polymerase used in each example was purchased from Nanjing Novozyme Biotech Co., Ltd. The homologous recombination enzyme was purchased from Shanghai Biyun Tian Biological Technology Co., Ltd. Unless otherwise stated, inorganic salts and other chemical reagents were domestic analytical pure reagents. HEPES salt was purchased from Shanghai Maikelin Biochemical Technology Co., Ltd., and ampicillin (Amp) was purchased from Shanghai Biyun Tian Biological Technology Co., Ltd. The DNA purification kit and general plasmid extraction kit used in the examples were purchased from Kangwei Century Company. The cloning strain Top10 was purchased from Nanjing Chengkai Biological Technology Co., Ltd. The main instruments used in the examples: American Molecular Devices enzyme marker, LSM 700-zeiss confocal microscope (Germany Carl Zeiss Company), PCR amplifier (Shanghai Sangshuai Biological Technology Co., Ltd.), nucleic acid electrophoresis instrument (Shanghai Tian Neng Technology Co., Ltd.), micro ultraviolet spectrophotometer Nanodrop 2000 (Thermo Fisher Scientific) and carbon dioxide cell incubator (Singapore Yisigao Technology Co., Ltd.).

[0051] II. Conventional molecular biology methods and cell experimental methods used in the examples

[0052] Plasmid construction is the most commonly used experimental technique in molecular biology research. The principle is to rely on the action of restriction endonuclease, DNA ligase and other modification enzymes, respectively, to cut and modify the target gene and vector DNA, then connect them together, and then introduce them into host cells to realize the correct expression of the target gene in the host cells. The pEGFP-N1 vector and pDisplay vector were purchased from Invitrogen Company.

[0053] 1. Polymerase chain reaction (PCR) amplification of target gene fragments

[0054] Table 1 PCR reaction system

[0055]

[0056] 2. PCR reaction system conditions:

[0057] Table 2 PCR reaction program

[0058]

[0059] The PCR reaction was carried out according to the above conditions, and the PCR amplified target product was stored at -20°C for standby.

[0060] 3. Agarose gel electrophoresis to recover PCR products

[0061] Agarose gel electrophoresis is a method for separating different sizes of DNA or RNA using agarose as a medium:

[0062] (1) Add 50 μL of amplified PCR product to 10 μL of DNA loading Buffer and perform 1% agarose gel electrophoresis at a constant voltage of 120 V for 30 min;

[0063] (2) Cut the target band from the agarose gel under ultraviolet irradiation, ensuring that the target gene band is completely treated; place the cut gel strip in an EP tube and weigh it;

[0064] (3) Add an appropriate amount of PN solution to the gel strip according to its weight and dissolve it in a 50°C water bath;

[0065] (4) After the gel strip is completely dissolved, add the gel strip solution to the equilibrated adsorption column and stand at room temperature for 2 min; centrifuge at 12000 rpm for 2 min and discard the waste liquid in the collection tube;

[0066] (5) Place the adsorption column back into the collection tube, add 500 μL of rinse solution, stand at room temperature for 2 min, centrifuge at 12000 rpm for 2 min, and discard the waste liquid in the centrifuge tube;

[0067] (6) The ethanol in the rinse solution can affect the efficiency of the product, so repeat step (5) and let the adsorption column stand uncovered for 10 min to ensure that the ethanol is completely volatilized;

[0068] (7) Add 50 μL of elution solution to the adsorption column and stand at room temperature for 5 min; centrifuge at 12000 rpm for 5 min and collect the target gene solution;

[0069] (8) Detect the concentration of the recovered target gene solution and store it at -20°C.

[0070] 4. Enzymatic digestion reaction

[0071] Perform an enzymatic digestion reaction on the recovered PCR gel product and the pDisplay vector, and the enzymatic digestion reaction system is as follows:

[0072] Table 3 Enzymatic digestion reaction system

[0073]

[0074] Perform the enzymatic digestion reaction according to the above reaction system, and incubate at 37°C for 2 h. After the reaction is completed, perform 1% agarose gel electrophoresis to recover the enzymatic digestion products, which are stored at -20°C for future use.

[0075] 5. T4 DNA ligation reaction

[0076] The pDisplay vector and the enzyme-digested product of PCR were subjected to a ligation reaction, and the ligation reaction system was as follows:

[0077] Table 4 Ligation reaction system

[0078]

[0079]

[0080] According to the above system, the reaction was carried out at 16°C for 2h, and the ligation product was stored at -20°C for standby.

[0081] 6. Transformation of competent cells of the ligation product

[0082] (1) Dissolve 50 μL of competent cells TOP10 on ice;

[0083] (2) Add 10 μL of the obtained ligation product (i.e. the target gene plasmid) to the competent cells, mix gently, and stand on ice for 30 min;

[0084] (3) Heat shock at 42°C for 90 s, and stand on ice for 2 min;

[0085] (4) Add 700 μL of LB medium without antibiotics, and place on a shaker to recover at 37°C for 60 min;

[0086] (5) Centrifuge at 5000 rpm for 1 min to collect the bacteria, resuspend the bacterial pellet after removing the supernatant, and spread the bacterial solution on LB solid medium containing kanamycin;

[0087] (6) Incubate the spread plate at 37°C for 16 h;

[0088] (7) Pick a single colony on the plate into LB medium containing kanamycin, and shake the bacteria at 37°C for 16 h to amplify them;

[0089] (8) After amplification, part of the turbid bacterial solution was used for freezing, and part was sent to Shengong Bioengineering Company for sequencing. The sequencing results were compared with the Pubmed database and the predicted target plasmid.

[0090] 7. Plasmid extraction

[0091] The plasmid extraction used the Endotoxin-Free Plasmid Extraction Kit from Kangwei Century Biotechnology Co., Ltd., and the operation steps were as follows:

[0092] (1) Collect the bacterial solution of overnight culture in a centrifuge tube, centrifuge at 12000 rpm for 1 min, and try to remove the supernatant;

[0093] (2) Add 500 μL Buffer P1 (RNase A has been added) to the centrifuge tube, and use a pipette to blow the bacterial cells at the bottom of the tube to mix well;

[0094] (3) After the suspended cells are precipitated, add 500 μL Buffer P2 to the centrifuge tube, and gently invert to mix 10 times to mix well to ensure that the lysis is complete;

[0095] (4) After standing at room temperature for five minutes, the bacterial solution becomes clear and transparent; then add 500 μL Buffer E3, and immediately invert to mix to avoid local precipitation;

[0096] (5) Place the centrifuge tube at room temperature for 5 min, centrifuge at 12000 rpm for 5 min, and aspirate the supernatant to add the supernatant to the filter column (Endo-remover FM), and centrifuge at 12000 rpm for 1 min to filter;

[0097] (6) Re-transfer the filtered filtrate to a clean centrifuge tube, and add 450 μL of isopropyl alcohol to the filtrate, and invert to mix the filtrate and isopropyl alcohol thoroughly;

[0098] (7) The adsorption column (Spin Columns DL) can efficiently adsorb plasmids, and before use, the column needs to be balanced: add 200 μL Buffer PS to the adsorption column, centrifuge at 12000 rpm for 1 min, and discard the Buffer PS in the collection tube, and wait for use;

[0099] (8) Transfer the mixture of the filtrate and isopropyl alcohol to the balanced collection tube, centrifuge at 12000 rpm for 1 min, and discard the waste liquid in the collection tube, and re-place the adsorption column in the collection tube, and repeat the operation twice to make the mixture be adsorbed by the adsorption column;

[0100] (9) Add 750 μL Buffer PW (anhydrous ethanol has been added) to the adsorption column, centrifuge at 12000 rpm for 1 min, and discard the Buffer PW in the collection tube, and then re-place the adsorption column in the collection tube, and centrifuge again for 1 min to completely remove the residual anhydrous ethanol in the adsorption column to avoid affecting the subsequent experiment;

[0101] (10) Transfer the adsorption column to a new centrifuge tube, and add 40 μL Endo-Free Buffer EB to the center of the adsorption membrane of the adsorption column to elute the plasmid, and after standing at room temperature for 5 minutes, centrifuge at 12000 rpm for 2 min;

[0102] (11) Re-drip the eluent Endo-Free Buffer EB in the centrifuge tube to the adsorption column, and repeat the centrifugation operation to increase the efficiency of plasmid extraction.

[0103] 8. Cell transfection and expression of genetically encoded fluorescent probes for opioid receptors

[0104] Cell transfection was performed using linear Poly-ethylenimine Linear (PEI) MW 40000 instant transfection reagent, the basic steps are as follows:

[0105] (1) Plate HEK293T cells in logarithmic growth phase 18-24h before transfection;

[0106] (2) When the cells are confluent to 60% of the single cell layer, the optimal transfection density can be performed;

[0107] (3) High concentration of serum will affect the performance of PEI MX transfection reagent, 1h before transfection, replace the cell culture medium with fresh DMEM medium without fetal bovine serum;

[0108] (4) Take 300μL DMEM medium diluent into a polypropylene EP tube, and add 2μg plasmid DNA;

[0109] (5) Gently blow with a pipette to mix and dilute the plasmid DNA in DMEM medium;

[0110] (6) The general recommended PEI transfection reagent: plasmid DNA concentration is 1.5-4.0:1, and 6μL PEI transfection reagent is added in this experiment;

[0111] (7) Vortex the polypropylene EP tube for 5s to mix the PEI transfection reagent and plasmid DNA diluent thoroughly;

[0112] (8) Place the EP tube at room temperature for 10min on the clean bench to form PEI-DNA mixture, and the incubation time of PEI transfection reagent and plasmid DNA should not be too long, control within 20min;

[0113] (9) After standing, gently blow the mixture 5 times with a pipette to mix;

[0114] (10) When adding cells, shake the cell culture dish while adding the PEI-DNA mixture to the transfection cells in fresh serum-free medium;

[0115] (11) After adding the PEI-DNA mixture, gently shake the culture dish to ensure uniform distribution of the mixture and avoid local high concentration;

[0116] (12) After the transfected cell culture dish is placed in the incubator for 24 h, the normal culture medium containing serum is replaced; generally, the expression of the recombinant protein can be detected 36-48 h after the cell transfection, and the maximum yield can be observed 72-96 h after the transfection.

[0117] 9. Fluorescence detection in living cells

[0118] Confocal fluorescence imaging of living cells is an experimental method for studying the distribution of fluorescent probes expressed in cells. The fluorescence emitted by green fluorescent protein can be captured under a confocal fluorescence microscope, and the cell localization and fluorescence response brightness change of the fluorescent probe can be analyzed.

[0119] Confocal imaging was performed on a Zeiss LSM700 fluorescence microscope equipped with a 20x air objective and a 63x oil immersion objective, a compact four-line excitation light source: 405 nm (100 mW), 488 nm (100 mW), 555 nm (100 mW), and 640 nm (75 mW) lasers, and a Carl Zeiss Microscopy perfect focus system. Excitation and emission filter combinations were used for various fluorophores, and green fluorescence was collected using a 525 / 50 nm emission filter. Carl Zeiss Microscopy hardware was used to control the acquisition of all images, and Carl Zeiss Zen software was used for image processing.

[0120] Example 1

[0121] Construction and detection of gene-encoded fluorescent probe plasmid for opioid receptor

[0122] In this example, the pDisplay plasmid was purchased from Invitrogen Company, and the following sites were selected for insertion of cpGFP based on the crystal structure of MOR, and the corresponding plasmid was obtained.

[0123] The primers used for constructing the plasmid are shown in Table 5:

[0124] Table 5 Primers used for PCR

[0125]

[0126] According to the method of 2-7 in the above-mentioned experimental method two, the DNA fragments of cpGFP and MOR with pDisplay homologous arms were PCR amplified using the primers in Table 5, wherein the MOR sequence (Sequence ID: NM_001145279.4) was used as a template, pDis-MOR-F and MOR256-R and Linker-MOR-F and SalI-pDis-R were used for PCR amplification to produce two DNA fragments with MOR homologous arms, respectively; the cpGFP sequence (Sequence ID: PQ753947.1) was used as a template, and MOR256-GFP-F and GFP-linker-R were used to produce the DNA target gene of cpGFP, which was purified by DpnI enzyme digestion; the pDisplay plasmid was used as a template, and pDisplay-NheI-F and pDisplay-XbaI-R primers were used for reverse PCR amplification to produce a linearized vector containing XbaI and NheI enzyme sites, and the linearized pDispaly vector was connected with the two DNA fragments with MOR homologous arms and the cpGFP fragment under the action of homologous recombinase to produce a recombinant plasmid, which was transformed into Top10 E. coli competent cells, and single colony colonies were selected for identification, and positive colonies were cultured and the plasmid was sent to Beijing Qikang Biotechnology Co., Ltd. for sequencing. Figures 1-3 The nucleic acid sequence encoded thereby is shown in SEQ ID NO. 2, and the amino acid sequence is shown in SEQ ID NO. 1.

[0127] Example 2

[0128] Live cell expression and membrane localization of fluorescent probes

[0129] Excellent membrane localization ability and optical performance can significantly improve the applicability of fluorescent probes for ultrafast and continuous imaging. The fluorescent probe (recombinant plasmid) prepared in Example 1 provided in this embodiment was transfected according to step 8 in the above-mentioned experimental method two, and was used for laser confocal imaging after being transiently expressed in HEK293T cells for 48 hours. The live cell expression and membrane localization of the fluorescent probe were tested in HEK293T cells, as shown in Figure 4 , the expression of the fluorescent probe at the cell level, the expression of the fluorescent probe in HEK29T cells, and the targeting of the cell surface. After applying an opioid receptor agonist, a significant fluorescence enhancement reaction was observed, and the fluorescence enhancement was located at the cell edge. As can be seen from the fluorescence ratio map, there is a significant green fluorescence enhancement at the cell edge, and in contrast, there is almost no fluorescence change in the cytoplasm, indicating that the cell membrane transport is normal, and the fluorescent probe is located on the cell membrane. Further, as shown in Figure 5As shown, the opioid receptor fluorescent probe exhibits excellent light stability. Even after 2 hours of administration, the bright green fluorescence of the opioid receptor fluorescent probe was observed to remain intact and persistent, without obvious quenching phenomenon. The experimental results show that the genetically encoded opioid receptor fluorescent probe can be expressed in living cells, and has good single cell membrane localization ability and optical stability, which is conducive to opioid detection and kit application.

[0130] Example 3

[0131] Spectral performance of the fluorescent probe

[0132] According to step 8 in the above Experimental Method Two, transfection was performed, and the genetically encoded fluorescent probe was expressed in HEK293T cells for 48 hours for spectral detection. The spectral changes of the opioid receptor fluorescent probe prepared in Example 1 (recombinant plasmid) before and after reacting with endogenous opioid peptide-Leu-Enkephalin (CAS No.: 58822-25-6, Macklin Company Catalog No. L860495) were detected. The fluorescence spectrum was obtained using a multifunctional Molecular D microplate reader, the ID5 microplate reader was set to fluorescence-spectrum (Florescence-Spectrum) reading mode, the emission was set to 560 nm, the bandwidth was 20 nm, the excitation spectrum was measured in the range of 350 to 520 nm, the step was 5 nm, and the bandwidth was 20 nm; the excitation was set to 455 nm, the bandwidth was 20 nm, the emission spectrum measurement range was set to 500 to 750 nm, the step was 5 nm, and the bandwidth was 20 nm; as shown in the figure Figure 6 As shown, the fluorescent probe exhibits a clear fluorescence peak at a wavelength of 515 nm. When exposed to Leu-Enkephalin, the fluorescence intensity of the opioid receptor fluorescent probe at 515 nm significantly increases, indicating that the probe specifically interacts with Leu-Enkephalin, resulting in enhanced fluorescence signal and affinity specificity.

[0133] Example 4

[0134] Specific response of the fluorescent probe to opioid compounds

[0135] According to step 8 in the above Experimental Method Two, transfection was performed, and the genetically encoded fluorescent opioid receptor probe was expressed in HEK293T cells. The genetically encoded opioid receptor fluorescent probe prepared in Example 1 of the present application (recombinant plasmid) has a fluorescent response to different types of MOR agonists, including endogenous peptides (leucine enkephalin), central nervous system agonists (methadone and DAMGO), and peripheral agonists (loperamide), with compound concentrations from 10 -9 -10 -3M. The fluorescence intensity was calculated according to the formula ΔF / F = (F-F0) / F0, where F represents the fluorescence intensity after ligand binding, and F0 represents the background fluorescence intensity. The green fluorescence expression of the opioid receptor fluorescent probe gradually increased when exposed to different concentrations of leucine enkephalin, and showed a concentration-dependent response. The maximum ΔF / F0 was up to 126.64%, and the half maximal effective concentration (EC 50 ) was about 280.7 nM Figure 7 ). After applying DAMGO, methadone and loperamide, the fluorescence intensity also showed a similar dose-dependent increase. The experimental results showed that the maximum ΔF / F0 of DAMGO was ~ 159.18% and the EC 50 value was about 2.79 μM Figures 8-10 , the maximum ΔF / F0 of methadone was ~ 256.92% and the EC 50 was about 1.48 μM Figures 8-10 , and the maximum ΔF / F0 of looperamide was ~ 297.05% and the EC 50 was about 478.2 nM Figures 8-10 . It is proved that the fluorescent probe exhibits excellent fluorescence response and very high sensitivity, and the EC 50 range is from micromolar to submicromolar. Nature Neuroscience (Nat. Neurosci. 2024, 27(9), 1844-1857.) reported the only Mu-opioid receptor gene-encoded fluorescent probe μLight with a maximum fluorescence response of 54.9%, which has a weak fluorescence response and low sensitivity when used for opioid compound detection. The fluorescence intensity of the gene-encoded fluorescent probe provided by the present application is greatly improved, and the maximum fluorescence intensity can reach 297.05%, which is 5.4 times that of the existing μLight fluorescent probe, has good molecular selectivity and pharmacological properties, and can be used for opioid compound detection and drug screening applications.

[0136] Example 5

[0137] Fluorescent probe ultrafast fluorescence imaging

[0138] Genetically encoded opioid receptor fluorescent probes are important tools for live-cell ultrafast imaging. These fluorescent probe signals exhibit high temporal resolution. Furthermore, since opioid receptor fluorescence is genetically encoded, the probes can be directly expressed in live cells, targeting specific organelles and cell types. Following step 8 of Experimental Method 2 above, transfection was performed to express the opioid receptor fluorescent probe (recombinant plasmid) prepared in Example 1 in HEK293T cells. The opioid receptor agonists DAMGO, methadone, leucine enkephalin, and loperamide were applied to the cells expressing the fluorescent probes, and real-time fluorescence enhancement was observed under real-time detection mode of fluorescence microscopy. Naloxone and naltrexone are the most commonly used opioid receptor antagonists and can effectively antagonize the effects of opioid agonists on MOR. The opioid-induced fluorescence increase is not only reversible but can also be effectively inhibited in the presence of MOR antagonists such as naloxone and naltrexone. After applying the MOR antagonists, a rapid and significant decrease in green fluorescence in the activated fluorescent probe was clearly observed, eventually returning to baseline levels or even lower. Figure 11 Fluorescent probes can accurately visualize and directly detect the activation or inactivation of MOR in living cells affected by endogenous opioid peptides, MOR agonists, and antagonists, demonstrating that the probes maintain the function of natural opioid receptors and can rapidly recognize ligands and respond.

[0139] Example 6

[0140] Sensing mechanism of gene-encoded opioid receptor fluorescent probe

[0141] This invention delves into the sensing mechanism of fluorescent probes. As a control, this invention generates a novel opioid receptor fluorescent probe mutant by converting key amino acid residues in the MOR binding pocket to alanine (Ala, A), within the MOR ligand binding pocket D149. 3.32 and Q126 2.60 Perform an alanine mutation, resulting in D149. 3.32 A and Q126 2.60 A. Two fluorescent probe mutants, specifically D149 3.32 The amino acid and nucleotide sequences of A are SEQ ID NO.3 and SEQ ID NO.4; Q126 2.60 The amino acid and nucleotide sequences of A are shown in SEQ ID NO. 5 and SEQ ID NO. 6. Transfection was performed according to step 8 of Experimental Method II above, and fluorescence performance was detected as in Example 5. The mutant showed similar brightness and membrane transport to the fluorescent probe. However, even at a concentration of 100 μM, the mutant D149 of the fluorescent probe... 3.32 Mutant A also failed to respond to DAMGO, loperamide, methadone, and leucine enkephalin. Mutant Q126 2.60A fluorescent probe produced a fluorescence response that was similar to mutant D149 3.32 A similar result( Figure 12 ) was observed for mutant D149. In addition, the present application also found that the fluorescent probe showed a concentration-dependent response to opioid agonists, and the opioid drug-induced fluorescence increase could be blocked by MOR antagonists naloxone and naltrexone. The above results all indicate that the opioid receptor fluorescent probe prepared in Example 1 is reliable, the fluorescence response produced is specific, the fluorescence enhancement is due to the interaction between MOR and ligand, and it can be used for detection and screening application of opioid compounds

[0142] Example 7

[0143] Opioid compound detection and screening of the fluorescent probe The present application evaluates the molecular specificity of the fluorescent probe, and detects and screens its selectivity to different reagents. According to the above experimental method 8, cell transfection is carried out, and plated into a 96-well plate; 100 μL of cells are added to each well of the microplate, and after the cells are added to the microplate, the cells are uniformly distributed to facilitate high-content imaging analysis; before imaging, the culture medium is replaced with Tyrode solution (unit: mM): 150 NaCl, 4 KCl, 2 MgCl2, 2 CaCl2, 10 HEPES and 10 glucose (pH 7.4). The HEK293T cells in the 96-well plate are imaged using the Opera Phenix (PerkinElmer) high-content screening system, which is equipped with a × 20, 0.4 aperture (NA) objective, a × 40, 0.6-NA objective, a × 40, 1.15-NA water immersion objective, a 488 nm laser and a 561 nm laser. A 525 / 50 nm emission filter is used to collect green fluorescence. The opioid receptor fluorescent probe prepared in Example 1 (recombinant plasmid) is expressed in HEK293T cells. 100 μM of opioid drugs, including endogenous peptides, MOR agonists, and other neurotransmitters unrelated to opioid receptors, are added to the culture plate expressing the probe. The fluorescent probe provided by the present application can detect opioid agonists such as β-endorphin, fentanyl and its derivatives, and endomorphin-1, which means that it has multifunctionality for various opioid drugs( Figure 13 ). The fluorescent probe has little fluorescence change for other neuroregulators or neurotransmitters( Figure 14 ), indicating that the fluorescent probe has great potential in mechanism research and non-interfering in vivo research, is suitable for virus packaging and transgenic application, and makes it a competitive candidate for optogenetics and kinetic studies in complex tissues. The fluorescent probe shows high selectivity for endogenous peptides of MOR and central nervous system and peripheral agonists, and can be used as a valuable platform for high-throughput screening of opioid agonists and antagonists in living cells and accelerating drug discovery( Figure 15 ).

[0144] From the above examples, the opiate receptor fluorescent probe provided by the present application has the advantages of small protein molecule, easy maturation, large dynamic range of fluorescence, low detection limit of opiate substances, good specificity, ability to detect in cells, rapid, real-time detection and screening of opiate drugs.

[0145] Example 8

[0146] Based on the probe sequence in Example 1 of the present application, the encoded nucleic acid sequence is shown in SEQ ID NO. 2, and the amino acid sequence is shown in SEQ ID NO. 1. A total of 239 gene-encoded opiate receptor fluorescent probes were constructed in the present application, and the probe in Example 1 has the optimal performance, the amino-terminal linker is composed of 25 amino acids (N-Linker-1), and the carboxyl-terminal linker is composed of 15 amino acids (C-Linker-1), which cooperates with cpGFP to determine the fluorescence sensitivity, specificity and dynamic range of the probe. The linker and cpGFP in the probe were subjected to mutation substitution, and part of the specific substitution is shown in Table 6 and Table 7. According to the step 8 in the above-mentioned experimental method two, each opiate receptor fluorescent probe was expressed in HEK293T cells, and the method of the present application was used for detection, and the results of A-T in Table 8 were obtained. Figure 16 Figures A-S are part of the mutant-substituted fluorescent probes expressed, which prove that the effects of each mutant probe are actually not as good as the probe of the present application. The present application verifies the performance of membrane localization expression, fluorescence response ability and opiate compound characteristics, and finally selects the probe of the present application (T) in Table 8. Figure 16

[0147] Table 6 linker in gene-encoded opiate receptor fluorescent probe

[0148]

[0149]

[0150] Table 7 Mutation of cpGFP in gene-encoded opiate receptor fluorescent probe

[0151] ​

Claims

1. A genetically encoded fluorescent probe for opioid receptors, characterized in that, The opiate receptor fluorescent probe comprises a fusion of human Mu-fragment receptor and green fluorescent protein, and the amino acid sequence is shown as SEQ ID NO.

1.

2. The genetically encoded fluorescent probe of the opioid receptor according to claim 1, characterized in that, The nucleic acid sequence of the opiate receptor fluorescent probe is preferably shown as SEQ ID NO.

2.

3. A method for preparing the fluorescent probe for opioid receptor encoded by the gene according to claim 1, characterized in that, The method comprises the following steps: The primer is designed, and the DNA fragments of cpGFP and MOR with pDisplay homologous arms are generated by PCR, and the DNA fragments are digested and purified, and the primer is designed, and the linearized pDispaly carrier containing different cleavage sites is generated by reverse PCR amplification or double enzyme digestion, and the linearized pDispaly carrier is connected with the MOR and cpGFP fragments under the action of homologous recombinase to generate a recombinant plasmid, and the recombinant plasmid is transformed into a competent cell, and a single colony is picked up by antibiotic screening, and after correct verification by sequencing, the recombinant plasmid is extracted to obtain a recombinant plasmid containing a gene-encoded opiate receptor fluorescent probe.

4. The production method according to claim 3, characterized by, The primer for generating the DNA fragments of cpGFP and MOR with pDisplay homologous arms by PCR is as follows: pDis-MOR-F tacaaaaaagttggcacctctagaatggacag MOR256-R atcaaagctctcacaatcagtccatagcacacggtaatgatgagc MOR256-GFP-F attgtgagagctttgatttaccccgcgccggccgggccgcgcga GFP-linker-R cttctcgcggttctgtcgcccgcgccagc Linker-MOR-F cagaaccgcgagaagaggatcaccaggatggtgctgg SalI-pDis-R ggggagggagaggggcgctagcttattcagggcaacggagcagtttctgc.

5. The preparation method according to claim 3, characterized in that, The primer for generating the linearized carrier containing different cleavage sites by reverse PCR amplification or double enzyme digestion is as follows: pDisplay-NheI-F gctagcgcccctctcc pDisplay-XbaI-R tctagaggtgccaacttttttgtaca.

6. Use of the gene-encoded opiate receptor fluorescent probe of claim 1 or 2 in expression and membrane localization of living cells.

7. Use of the gene-encoded opiate receptor fluorescent probe of claim 1 or 2 in detection and screening of opiate compounds.

8. Use according to claim 7, characterized in that, The opiate compounds include (a) endogenous opioid peptides: endorphin, endomorphin or enkephalin; (b) semi-synthetic or synthetic opiate drugs: DAMGO, loperamide, methadone or fentanyl and analogs thereof.

9. Use of the genetically encoded fluorescent probe of opioid receptors according to claim 1 or 2 for visualizing and directly detecting the activation or deactivation of MOR in living cells affected by endogenous opioid peptides, MOR agonists and antagonists.

10. A kit for detecting and screening an opioid compound, characterized by, It comprises the genetically encoded fluorescent probe of opioid receptors according to claim 1 or 2.

Images