Purification and maturation culture medium for myocardial cells derived from induced pluripotent stem cells
By using specific maturation culture medium components and purification steps, the problem of insufficient maturity in traditional cardiomyocyte culture was solved, achieving effective maturation and purification of cardiomyocytes, thereby improving the efficiency of drug development and the reliability of experimental results.
Patent Information
- Application Number
- CN202511057044.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-07-30
- Publication Date
- 2025-11-07
AI Technical Summary
Traditional in vitro culture techniques for cardiomyocytes make it difficult for stem cell-induced differentiated cardiomyocytes to mature, resulting in drug screening models that are not suitable for cardiac drug development. Furthermore, immature cardiomyocytes and mature cardiomyocytes differ significantly in gene expression, electrophysiology, and morphology, which limits the application value of the research.
Using specific maturation culture medium components, such as galactose, fatty acids, and L-carnitine, the expression of genes such as MYL2, KCNJ2, and CASQ2 is synergistically promoted, thereby activating the maturation of cardiomyocytes through multiple pathways. Before maturation, a purification culture medium is used to remove undifferentiated cells, thereby improving cell purity and homogeneity.
This approach enables effective maturation of cardiomyocytes, mimics the energy metabolism pattern of adult myocardium, improves the reliability of drug development and the stability of experimental results, ensures the functional stability and standardization of the cardiomyocyte population, and promotes the accuracy of drug screening models.
Smart Images

Figure CN120905133A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the technical field of myocardial cell culture medium, and relates to a purification and maturation culture medium for myocardial cells derived from induced pluripotent stem cells. BACKGROUND
[0002] With the improvement of medical technology, heart surgery and drug treatment have made remarkable progress. However, cardiovascular disease is still the biggest killer of human health all over the world. And because the in vitro cultured myocardial cells are difficult to develop into mature cells, the drug screening model established by immature myocardial cells is not suitable for the development of heart drugs, so the effective drug development is extremely slow. Therefore, it is an important link for the development of cardiovascular disease drugs to culture mature myocardial cells and tissues in vitro to obtain an effective drug screening model.
[0003] The traditional myocardial cell in vitro culture technology is difficult to make the myocardial cells induced by human stem cells develop into mature cells, and the obtained myocardial cells are similar to the myocardial cells in the fetal period of human in gene expression, electrophysiology and morphology. Compared with adult myocardial cells, the in vitro cultured myocardial cells are smaller in size, lower in electrical excitability, damaged in excitation-contraction coupling, and incomplete in expression of adrenergic receptors. If a series of pharmacological models in myocardial tissue engineering are constructed by using immature myocardial cells, the results cannot reflect the true situation of mature myocardial cells to drugs. Therefore, the realization of in vitro myocardial cell maturation is an important link.
[0004] Most of the researches on myocardial cells are based on embryonic or neonatal myocardial cells. The embryonic or neonatal myocardial cells have strong vitality and are more suitable for long-term in vitro culture. However, the ion channels and protein expression may change in different periods of cell development, so the research results of embryonic or neonatal myocardial cells cannot be completely applied to mature myocardial cells. Therefore, although the culture of myocardial cells has a history of more than 50 years, there are still great differences between immature myocardial cells and mature myocardial cells in function and structure. Therefore, there is a certain limitation in establishing a culture model by using embryonic or neonatal immature myocardial cells to study the physiological characteristics of myocardial cells. SUMMARY
[0005] The purpose of the present application is to overcome the shortcomings and deficiencies of the prior art, and to provide a purification and maturation culture medium for myocardial cells derived from induced pluripotent stem cells, which solves the problems that the myocardial cells obtained by the traditional culture method are in the stage of immature myocardial cells and cannot be compared with mature myocardial cells in the state.
[0006] The present application researches and finds that mature cardiomyocytes express high levels of genes, such as proteins related to myocardial cell contractility, such as MYH7, MYL2, calcium processing related genes, such as CASQ2, ATP2A2 (sarcoplasmic reticulum ATPase), etc., ion channel related genes KCNJ2 (potassium ion channel protein), SCN5A (sodium ion channel protein), etc. Based on this, the present application selects specific mature culture medium components, i.e. galactose, fatty acid and L-carnitine as the main mature active components, uses fatty acid and L-carnitine in combination to synergistically promote the expression of MYL2 gene and KCNJ2 gene, uses fatty acid and galactose in combination to synergistically promote the expression of CASQ2 gene, and uses L-carnitine to significantly promote the expression of ACAT1 gene, thereby multi-pathway synergistically activating cardiomyocyte maturation and promoting effective maturation of cardiomyocytes.
[0007] The object of the present application can be achieved by the following scheme:
[0008] In a first aspect, the present application provides a maturation culture medium for induced pluripotent stem cell-derived cardiomyocytes, which comprises a basic culture medium and a maturation active ingredient; the basic culture medium comprises RPMI 1640 without glucose, and the maturation active ingredient comprises L-carnitine, fatty acid and galactose.
[0009] As an embodiment of the present application, the fatty acid comprises one or more of linoleic acid and palmitic acid. In some embodiments, the fatty acid is a mixture of 2.5 mM linoleic acid and 1.5 mM palmitic acid dissolved in 10% BSA.
[0010] As an embodiment of the present application, in the maturation culture medium, the concentration of L-carnitine is 1-3 mM, the concentration of fatty acid is 0.2-0.8 mM, and the concentration of galactose is 5-15 mM.
[0011] As an embodiment of the present application, the maturation active ingredient further comprises creatine, taurine, ITS, NEAA, Glutmax.
[0012] Further, in the maturation culture medium, the concentration of creatine is 1-4 mM, and the concentration of taurine is 1-4 mM.
[0013] In a second aspect, the present application provides a method for inducing maturation of pluripotent stem cell-derived cardiomyocytes using the maturation culture medium, comprising the following steps:
[0014] S1, adding pluripotent stem cell-derived cardiomyocytes to a purification culture medium for purification;
[0015] S2, adding the purified cardiomyocytes to the maturation culture medium for maturation.
[0016] As one embodiment of the present application, in step S1, the method for preparing the cardiomyocyte derived from the pluripotent stem cell comprises: adding a differentiation medium to the pluripotent stem cell, and sequentially adding a Wnt signal activator and Wnt C59 for differentiation culture to obtain the cardiomyocyte.
[0017] Further, in the differentiation medium, the concentration of the Wnt signal activator is 4-10 uM, and the concentration of the Wnt C59 is 4-10 uM.
[0018] Preferably, the Wnt signal activator comprises CHIR.
[0019] Further, the differentiation medium comprises a basic medium and additional components, the basic medium comprises RPMI1640, and the additional components comprise at least one of B27 minus insulin and B27 supplement.
[0020] Further, the concentration of the additional components is 1-3%.
[0021] As one embodiment of the present application, in step S1, the purification medium comprises RPMI 1640 without glucose, Lactose DL-sodium lactate, and GlutMax, wherein the concentration of the Lactose DL-sodium lactate is 2-6 mM. The purification medium can promote the conversion of metabolic pathways and is conducive to the subsequent maturation process.
[0022] The present application relates to a method for preparing cardiomyocytes induced by pluripotent stem cells (iPSCs), promoting the death of non-cardiomyocytes in vitro by culture in a culture medium, obtaining juvenile cardiomyocytes, and promoting the maturation of cardiomyocytes by culture in a culture medium.
[0023] In a third aspect, the present application provides an artificial mature cardiomyocyte prepared by the method.
[0024] Compared with the prior art, the present application has the following beneficial effects:
[0025] 1. The present application uses galactose, fatty acids and L-carnitine as the main active ingredients, fatty acids and L-carnitine can synergistically promote the expression of MYL2 gene and KCNJ2 gene, fatty acids and galactose can synergistically promote the expression of CASQ2 gene, and L-carnitine can significantly promote the expression of ACAT1 gene, thereby multi-pathway synergistically activating cardiomyocyte maturation and promoting the effective maturation of cardiomyocytes.
[0026] 2、The mature culture medium of the present application can promote the metabolic mode of juvenile myocardial cells to change from glycolysis to fatty acid oxidation metabolism, enhance mitochondrial function, simulate the energy metabolism pattern of adult myocardium, make the function of iPSC-CM more stable, closer to the in-vivo mature state and physiological characteristics, and have better characteristics and application potential, which can meet the needs of industrialized production (such as drug development).
[0027] 3、The present application adopts a purification medium to purify the cells before mature culture, which can remove the iPSCs or other types of cells (such as fibroblasts, endothelial cells) that have not successfully differentiated, improve the uniformity and purity of the cells, ensure the acquisition of a high-purity myocardial cell population and the stability of the experiment, reduce the deviation of the experimental results, and improve the reliability of the data. In addition, the purification process can ensure the functional stability of myocardial cells in different batches, so that the mature culture process has standardization and repeatability. BRIEF DESCRIPTION OF DRAWINGS
[0028] Other features, objects, and advantages of the present application will become more apparent from the following detailed description of non-limiting embodiments, made with reference to the following drawings:
[0029] Figure 1 Example 1 is the myocardial differentiation, purification and maturation process;
[0030] Figure 2 Example 2 is the comparison before and after purification;
[0031] Figure 3 Example 4 is the test of the effective components of the mature culture medium;
[0032] Figure 4 Example 3, 5 and 6 are the myocardial cell maturation detection; wherein, A. the change of cell morphology before and after the treatment of the mature culture medium; B. the detection of mitochondrial distribution before and after the treatment of the mature culture medium; C. the flow cytometry detection of CTNT after differentiation; D. the difference in the number of nuclei before and after the treatment of the mature culture medium;
[0033] Figure 5 Example 7 is the OCR detection result. DETAILED DESCRIPTION
[0034] The present application will be described in detail below with reference to the accompanying drawings and specific embodiments. The following examples are implemented on the premise of the technical solutions of the present application, and provide detailed implementation modes and specific operation processes, which will help those skilled in the art to further understand the present application. It should be pointed out that the protection scope of the present application is not limited to the following examples, and several adjustments and improvements made on the premise of the concept of the present application all belong to the protection scope of the present application.
[0035] The raw materials involved in each embodiment of the present application are all commercially available products.
[0036] Example 1 Obtain cardiomyocytes from pluripotent stem cells
[0037] Reference Figure 1 According to the flowchart shown, the newly plated iPSCs are cultured to about the 4th day, at which time the cell confluence is about 85%, the culture dish is basically covered with cells and there is no obvious gap between the cells, at which time the differentiation medium containing RPMI 1640 basic medium and 2% B27 minus insulin (Gibco A18956-01, i.e. Figure 1 B27 without insulin) is added, at which time it is recorded as the 0th day of differentiation, and 6uM Wnt signal activator CHIR (sigma SML1046) is added to the culture medium on the 0th-1st day. On the 2nd day, the culture medium is replaced with 5uM Wnt C59 (purchased from MCE, item number HY-15659) for continuous differentiation, and on the 4th day, the culture medium is replaced with the above-mentioned differentiation medium containing RPMI 1640 basic medium and 2% B27 minus insulin, and the differentiation is continued, and the liquid is replaced every two days. On the 6th day, it is replaced with a differentiation medium containing RPMI 1640 basic medium and 2% B27 supplement (Gibco 17504-044, i.e. Figure 1 B27 in it), and generally on the 9th day of induction, spontaneously beating cells can be observed.
[0038] Example 2 Purification of cardiomyocytes
[0039] The purification of cardiomyocytes removes most of the non-cardiomyocytes to ensure the accuracy of the experimental results later, which includes the following steps:
[0040] 1) On the 14th day, the culture medium in the original well is aspirated, and 2mL of cardiomyocyte purification medium (the specific components are shown in Table 1) is added to each well of a 6-well plate.
[0041] 2) The culture medium is replaced every 2-3 days, and attention should be paid to timely replacement of the purification medium. During the use of the purification medium, a large number of non-cardiomyocytes will undergo apoptosis, which is a normal phenomenon.
[0042] 3) After about a week, the non-cardiomyocytes are completely removed, the purification medium is removed, and the differentiation medium containing RPMI 1640 basic medium and B27 supplement in Example 1 is replaced, and after 2 days of recovery, the subsequent maturation can be carried out. After the treatment of the purification medium, the apoptosis of non-cardiomyocytes is obviously observed, and the spontaneously beating cardiomyocytes are retained, and the purification effect is shown in Figure 2 Figure 2 is enlarged 20 times).
[0043] Table 1 Cardiomyocyte purification medium
[0044]
[0045] Example 3: Cardiac cell maturation
[0046] This embodiment tests different combinations to select a culture medium that effectively promotes cardiomyocyte maturation, using it as one of the methods for in vitro cardiomyocyte maturation. The effects of L-carnitine, fatty acids, and galactose on the maturation effect are evaluated according to the following steps:
[0047] A. Coat 6-well plates with Matrigel and incubate at 37°C for at least 1 hour.
[0048] B. Prepare reagents, including cardiomyocyte seeding medium (including 2% B27 supplement and 5% KSR (Gibco, 10828028) RPMI 1640), PBS, and Tryptophan. TM Select enzyme (Gibco, 12563011) was rewarmed at room temperature.
[0049] C. Discard the culture medium from the original wells, wash once with PBS, and add 1 mL TrypLE to each well of the six-well plate. TM Digest with Select enzyme and incubate at 37°C for 10-15 minutes. Observe under a microscope when the cell edges begin to curl and detach. At this point, use cardiomyocyte seeding medium to terminate the digestion. Otherwise, extend the digestion time until the cells detach after being gently tapped.
[0050] D. Transfer the cell suspension to a 15 mL centrifuge tube and centrifuge at 300 g for 3 min.
[0051] E. After centrifugation, discard the supernatant, resuspend the cells in 1 mL of cardiomyocyte seeding culture medium, and count them.
[0052] F. Aspirate the Matrigel from the cell culture plate and add cells at a density of 40,000–50,000 cells / cm². 2 Inoculate the culture medium into new wells at a density of 2 mL, and add 2 mL of culture medium to each well.
[0053] Incubate at 37°C for 24 hours in a 5% CO2 incubator.
[0054] H. Once the cells have stabilized, replace the cardiomyocyte maturation medium (specific components are shown in Table 2), and replace with fresh medium every 3–4 days. Collect RNA after 1–2 weeks of treatment with the cardiomyocyte maturation medium, and perform relative expression level detection on some genes related to mature cells.
[0055] Table 2. Culture medium for cardiomyocyte maturation
[0056]
[0057]
[0058] Wherein, the fatty acid FA is 2.5 mM of linoleic acid and 1.5 mM of palmitic acid mixed in 10% BSA.
[0059] The change of cell morphology before and after the treatment of mature culture solution is shown in Figure 4 A.
[0060] Fluorescent quantitative detection of Example 4
[0061] Remove the culture solution, wash once with PBS, add 1 mL Trizol to each well of the six-well plate to lyse the cells, and collect the cell lysate into RNase free 1.5 mL EP tubes. Add 200 μL chloroform to each tube, and shake vigorously for 15 s on a vortex shaker. After standing at room temperature for 5 min, observe the obvious upper and lower layers, with the upper layer being white and the lower layer being red. Centrifuge at 12000 g at 4°C for 15 min. Carefully pipette the upper liquid into new RNase free 1.5 mL EP tubes, add 1 μL glycogen, and mix well by vortexing. Add an equal volume of isopropanol (450 μL), mix well by inverting, and stand at room temperature for 5 min. Centrifuge at 12000 g at 4°C for 10 min. Remove the supernatant, add 1 mL of pre-cooled 75% ethanol, and centrifuge at 12000 g at 4°C for 2 min. Carefully remove the ethanol, and dry in the open air for 5 min. Add 20 μL RNase-Free-Water, and mix well. Place on ice until the RNA is dissolved. Measure the RNA concentration using a Maestro NanoPro concentration measuring instrument. Reverse transcription is performed according to the instructions of the Abm 5XALL-In-One RT MasterMix kit. Prepare the reaction system on ice, as shown in Table 3, and the reaction parameters are shown in Table 4:
[0062] Table 3 Reaction system
[0063] Reagent Amount Reaction solution (5x All-In One master Mix) 4 μL RNA sample 100 ng RNase-Free-Water Increased to 20 μL
[0064] Table 4 Reaction parameters
[0065] Temperature (°C) Time (min) 25 10 42 50 85 5
[0066] The obtained cDNA can be stored at -20°C. Prepare the fluorescent quantitative PCR reaction system using 2xSYBR Green qPCR Master Mix reagent (YEASEN 11201ES08). The reaction system (20 μL) contains the components shown in Table 5:
[0067] Table 5 Reaction system
[0068]
[0069]
[0070] The gene primers are shown in Table 6:
[0071] Table 6 Gene primers
[0072] Primer Sequence ACAT1-F GGCCTGCTGTAATCAGTGTG (SEQ ID NO. 1) ACAT1-R GTGTTCTCACAAATGGAAACTTCT (SEQ ID NO. 2) CASQ2-F GAGCCCACGATTCCAGAGC (SEQ ID NO. 3) CASQ2-R TGCCGTGTGCAGAATAGAGG (SEQ ID NO. 4) KCNJ2-F CCTGGCTTTCGTCCTGTCAT (SEQ ID NO. 5) KCNJ2-R TGAAGCTGTTGACCTCGGAC (SEQ ID NO. 6) MYL2-F ACATCATCACCCACGGAGAAGAGA (SEQ ID NO. 7) MYL2-R ATTGGAACATGGCCTCTGGATGGA (SEQ ID NO. 8)
[0073] The reaction procedure is shown in Table 7:
[0074] Table 7 Reaction procedure
[0075]
[0076] To verify the synergistic effect of L-carnitine, fatty acids and galactose on promoting the maturation of cardiomyocytes, CMA group (without L-carnitine), CM B group (without fatty acids), CMC group (without galactose), CM D group (without L-carnitine and fatty acids), CM E group (without L-carnitine and galactose), CM F group (without L-carnitine, galactose and fatty acids), CM G group (experimental group), and CM EM group (PCR reaction system) were set. According to the Ct value given by the software, the difference in the mRNA expression fold of the samples was calculated using the △△Ct algorithm. By detecting the relative expression of genes related to lipid metabolism pathway, ion channel, calcium flow, sugar metabolism and sarcomere structure, cardiomyocytes were obtained through the purification-maturation system, and the expression of genes related to mature cardiomyocytes in lipid metabolism, calcium flow and sarcomere was significantly increased (P<0.05), indicating that the maturation system had the ability to promote the maturation of cardiomyocytes. Figure 3 Figure 3
[0077] 1) At the structural level of mature cardiomyocytes, MYL2 is an important component of cardiomyocyte contraction protein. Taking MYL2 as an indicator of mature cardiomyocytes, the CMC (-Galatose) group showed the most prominent MYL2 gene expression, indicating that galactose had the strongest promoting effect on MYL2 gene expression, which indicated that the combination of fatty acids (FA) and L-carnitine (L-Carnitine) may help the maturation of cardiomyocyte contraction function.
[0078] 2) In terms of ion channel changes, it involves ion exchange of mature cells, CASQ2 as a marker gene of sarcoplasmic reticulum calcium storage, and fatty acids have a greater impact on it. Compared with the use of FA alone (CME group), it can significantly improve the expression of CASQ2 and effectively promote calcium regulation. KCNJ2, an inward potassium ion channel protein, can maintain a negative resting potential and prevent excessive repolarization during action potential. It is highly expressed in mature cardiomyocytes. The combination of FA and L-carnitine can better promote the expression of KCNJ2.
[0079] 3) Mature cardiomyocytes mainly produce energy through fatty acid beta-oxidation, and ACAT1 is involved in the synthesis of cholesterol esters, which is a key enzyme in lipid metabolism, especially in fatty acid metabolism and lipid droplet formation. Therefore, this index is used to represent the ability of lipid metabolism. The expression level is the lowest when FA and L-carnitine are lacking, which directly affects metabolism. When FA is lacking (CM B group), the metabolism is abnormally high when containing L-carnitine, which may be caused by metabolic disorders due to the lack of FA, rather than stable cell maturation. The absence of a single component can lead to unbalanced maturation.
[0080] In summary, the maturation of cardiomyocytes requires the coordinated activation of multiple pathways, and the absence of a single component can lead to unbalanced maturation. The combination of fatty acid FA, L-carnitine, and galactose Galatose can promote the effective maturation of cardiomyocytes in multiple dimensions and can be used as a directional maturation strategy.
[0081] Example 5 Immunofluorescence Staining Flow Cytometry Detection
[0082] The purity of the cardiomyocytes recovered for 2 days after purification was detected. hiPSCs-CMs cells (i.e., cardiomyocytes after purification without treatment with maturation medium) were digested with TrypLETM Select enzyme, and cell suspension was collected. After centrifugation, the cells were washed with PBS. Then, the cells were fixed with 4% PFA at room temperature for 30 min, and then blocked with antibodies at room temperature for 10 min. The primary antibody Cardiac Troponin T Monoclonal Antibody (13-11) (thermofisher MA5-12960) was diluted according to the instructions, and then added to the cells and incubated at room temperature for 0.5 h. After PBS washing, the non-specifically bound primary antibody was washed away, and the cells were analyzed by flow cytometry. About 95% of the purified cells were labeled with the cardiomyocyte-specific marker CTNT, as shown in Figure 4 C, the purification effect is very obvious.
[0083] HOCHEST was used to stain the cardiomyocytes before and after maturation, and incubated at room temperature for 0.5 h. The cells were analyzed by flow cytometry, and the difference in the number of nuclei before and after treatment with maturation medium was Figure 4As shown in FIG. D, the number of multinucleated cells increased significantly after treatment with the maturation medium.
[0084] Example 6 Mitochondrial distribution analysis
[0085] Due to the change in metabolic mode, the mitochondria of mature cardiomyocytes are more functional and more dispersed in the cytoplasm. In order to detect the maturation effect of the cells, the mitochondria of the cardiomyocytes before and after maturation were stained. The whole process needs to be operated in the dark. After thawing the storage solution at room temperature, dilute it to the required concentration (such as Green 20-200 nM) with 37°C preheated PBS or medium. Remove the medium and add 37°C preheated MitoTracker working solution, incubate for 15-45 minutes (recommended 30 minutes). After washing with PBS, replace the fresh medium and directly use it for fluorescence microscope detection and photography. Image software is used for analysis. After treatment with the maturation medium, the mitochondria are more dispersed in the cytoplasm and the coloration is more obvious. Figure 4 B), the density of mitochondria is also relatively higher.
[0086] Example 7 Seahorse metabolic analysis
[0087] At the metabolic level, mature cardiomyocytes and immature cardiomyocytes also show great differences. Seahorse is used to detect energy metabolism. Mitochondria decomposes fatty acids and pyruvate through the Kreb cycle, and then generates a large amount of ATP as the energy source of the cell through the electron transport cycle. This process consumes oxygen as the electron acceptor at the end of the electron transport cycle, so the oxygen consumption rate indicates the rate of aerobic metabolism. Through OCR detection, different concentrations of FCCP were used for treatment, all showing a consistent trend. D30-maturation indicates treatment with the maturation medium, D30-EM indicates treatment with the expansion medium, and D15 indicates the immature cardiomyocytes differentiated, such as Figure 5As shown, the mature medium group has the strongest respiratory capacity, significantly higher than the D15 and D30-EM groups, indicating that the mature medium-treated cardiomyocytes have higher oxidative phosphorylation capacity, can produce more ATP to support the energy needs of the cells. The non-mitochondrial oxygen consumption of the mature medium-treated group is the highest, indicating that its non-mitochondrial metabolic activity is more active. This may be related to the enhancement of other oxygen-consuming processes in the cell (such as antioxidant defense system). The basal respiration of the mature medium-treated group is the highest, indicating that its basal metabolic level is higher. This means that the mature medium group of cardiomyocytes consumes more oxygen and produces more ATP to support the basic life activities of the cells in the resting state. The ATP turnover rate of the mature medium-treated group of cardiomyocytes is the highest, indicating that its ATP generation and utilization efficiency is higher. This reflects that the mature medium group of cardiomyocytes has a more efficient energy metabolism system that can quickly respond to the energy needs of the cells. The inner membrane leakage of the mature medium-treated group of cardiomyocytes is the highest, which may be related to its higher mitochondrial activity. Mitochondrial inner membrane leakage is an indicator of mitochondrial function, and higher leakage may indicate higher mitochondrial membrane potential and stronger mitochondrial activity. In summary, the mature medium-treated cardiomyocytes are significantly higher than the juvenile cardiomyocytes and the expansion medium-maintained group in multiple indicators (respiratory capacity, non-mitochondrial oxygen consumption, basal respiration, ATP turnover rate, and inner membrane leakage), indicating that their metabolic state is more mature and their mitochondrial function is more perfect. This may be due to the fact that the mature medium-treated group of cardiomyocytes uses a medium composition that is more suitable for the maturation of cardiomyocytes, promoting the development of the metabolic function of the cells.
[0088] The expansion medium-maintained group is slightly higher than the D15 group in some indicators, but overall performance is not as good as the mature medium-treated group, indicating that its maturity is between the juvenile and mature states. This may be that with the extension of the culture time, it can also promote the maturation of cardiomyocytes, but the effect is not good.
[0089] In summary: After using the unique purification-maturation treatment, non-cardiomyocytes can be removed significantly, and the purity of differentiation can be improved. After the mature medium treatment, the maturation of cardiomyocytes can be effectively promoted.
[0090] The specific embodiments of the present application are described above. It should be understood that the present application is not limited to the above specific embodiments, and those skilled in the art can make various modifications or modifications within the scope of the claims, which does not affect the essential content of the present application.
Claims
1. A maturation medium for inducing cardiomyocytes derived from induced pluripotent stem cells, characterized by, The maturation medium comprises a basic medium and a maturation active ingredient; the basic medium comprises RPMI 1640 without glucose, and the maturation active ingredient comprises L-carnitine, fatty acid and galactose.
2. The maturation medium of claim 1, wherein, The fatty acid comprises one or more of linoleic acid and palmitic acid.
3. The maturation medium of claim 1, wherein, In the maturation medium, the concentration of L-carnitine is 1-3 mM, the concentration of fatty acid is 0.2-0.8 mM, and the concentration of galactose is 5-15 mM.
4. The maturation medium of claim 1, wherein, The maturation active ingredient further comprises creatine, taurine, ITS, NEAA and Glutmax.
5. The maturation medium of claim 4, wherein, In the maturation medium, the concentration of creatine is 1-4 mM, and the concentration of taurine is 1-4 mM.
6. A method for inducing maturation of pluripotent stem cell-derived cardiomyocytes using the maturation medium according to any one of claims 1 to 5, characterized by, The method comprises the following steps: S1, adding pluripotent stem cell-derived cardiomyocytes to a purification medium for purification; S2, adding the purified cardiomyocytes to the maturation medium for maturation.
7. The method of claim 6, wherein, In step S1, the preparation method of the pluripotent stem cell-derived cardiomyocytes comprises: adding a differentiation medium to pluripotent stem cells, and sequentially adding a Wnt signal activator and Wnt C59 for differentiation culture to obtain cardiomyocytes.
8. The method of claim 7, wherein, The differentiation medium comprises a basic medium and an additional ingredient, the basic medium comprises RPMI 1640, and the additional ingredient comprises at least one of B27 minus insulin and B27 supplement.
9. The method of claim 6, wherein, In step S1, the purification medium comprises RPMI 1640 without glucose, Lactose DL-sodium lactate and GlutMax; wherein the concentration of Lactose DL-sodium lactate is 2-6 mM.
10. An artificial mature cardiomyocyte prepared by the method of any one of claims 6-9.
Citation Information
Patent Citations
Maturation medium compositions and methods for human heart organoid maturation
CA3258762A1
Culture medium compositions for maturating cardiomyocytes derived from pluripotent mammalian stem cells
CN105473708A
Serum-free culture system for promoting maturation of stem cell derived myocardial cells
CN108456654A
Method for directional induced differentiation of iPS cells to mature nerve cells
CN110656089A
Method for improving yield and purity of pluripotent stem cell directionally induced cardiac muscle cells
CN113337458A