Chitinase mutants and their use in promoting plant growth
By constructing a highly efficient chitinase mutant using error-prone PCR, the problems of low catalytic efficiency and poor stability of natural chitinase were solved, enabling effective control of pests and pathogens and promoting plant growth, thus improving the effectiveness of agricultural applications.
Patent Information
- Application Number
- CN202511448319.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-10-11
- Publication Date
- 2026-01-16
- Estimated Expiration
- 2045-10-11
AI Technical Summary
Natural chitinases have low catalytic efficiency and poor stability in agricultural applications, making them difficult to use widely, and their broad-spectrum effectiveness against different pests is insufficient.
Chitinase mutants were constructed using error-prone PCR technology to improve their enzyme activity and environmental stability. Gene expression was performed using Pichia pastoris to prepare highly efficient chitinase mutant enzyme preparations for application in pest control and plant growth promotion.
The chitinase mutant exhibits 2.7 times the enzyme activity of the wild type at 50℃ and pH 7, significantly enhancing its control over pests and pathogens, promoting plant growth, and improving yield and quality.
Smart Images

Figure SMS_10
Abstract
Description
TECHNICAL FIELD
[0001] The present application belongs to the field of microorganisms and genetic engineering, and particularly relates to a chitinase mutant and application thereof in promoting plant growth. BACKGROUND
[0002] Chitin is a natural high molecular weight polysaccharide formed by N-acetylglucosamine through beta-1, 4-glycosidic bond, and is the main structural component of insect exoskeleton and egg shell, the shell of some crustaceans, and the cell wall of many fungi. Chitinase is a kind of glycoside hydrolase that can specifically act on chitin glycosidic bond and hydrolyze chitin into oligosaccharides. Chitinase can play a biological control role through mechanisms such as hydrolyzing pathogenic fungal cell walls, destroying pest body walls, and synergizing insecticidal effects. The target of chitinase (chitin) only exists in invertebrates, fungi and other organisms, and is completely absent in higher plants and animals. This unique target specificity makes chitinase have no toxic effect on higher plants and animals. The biological control technology developed based on chitinase not only can precisely act on target organisms, but also has the core advantages of strong environmental compatibility, high safety in use, and difficulty for target organisms to develop resistance, and has become a key technology direction for replacing high-residue and high-risk chemical pesticides in current agricultural production.
[0003] However, natural chitinase has obvious limitations in practical application. On the one hand, the catalytic efficiency of natural chitinase is low, and a high dose is needed to achieve ideal insecticidal and antibacterial effects, resulting in high application cost. On the other hand, the stability of natural chitinase is poor, and it is easy to be inactivated in field environment (such as high temperature, acid-base change), and it is difficult to maintain long-term control effect. In addition, some natural chitinases have insufficient broad-spectrum against different pests, and can only act on specific groups of pests, limiting their application range. Therefore, it is a key requirement to develop a chitinase mutant with high catalytic activity and strong environmental stability to promote the wide application of chitinase in the field of agriculture.
[0004] In view of this, the present application is proposed. SUMMARY
[0005] In view of the above problems, the purpose of the present application is to provide a chitinase mutant and application thereof in promoting plant growth. The mutant has higher enzyme activity and stronger environmental stability, and shows better effects when used for insecticidal and antibacterial purposes, and can effectively promote plant growth.
[0006] The above purpose of the present application is achieved by the following technical solutions:
[0007] In a first aspect, the present application provides a chitinase mutant, wherein the amino acid sequence of the chitinase mutant is shown as SEQ ID NO. 3.
[0008] In a second aspect, the present application provides a gene encoding the chitinase mutant.
[0009] In a third aspect, the present application provides a recombinant expression vector comprising the gene encoding the chitinase mutant.
[0010] Further, the vector of the recombinant expression vector is plasmid pPICZ alpha A.
[0011] In a fourth aspect, the present application provides a recombinant strain comprising the recombinant expression vector.
[0012] Further, the host strain of the recombinant strain is Pichia pastoris.
[0013] In a fifth aspect, the present application provides an enzyme preparation comprising the chitinase mutant.
[0014] In a sixth aspect, the present application provides the use of the chitinase mutant or the enzyme preparation in the prevention of agricultural pests.
[0015] In a seventh aspect, the present application provides the use of the chitinase mutant or the enzyme preparation in the prevention of plant diseases.
[0016] In an eighth aspect, the present application provides the use of the chitinase mutant or the enzyme preparation in the promotion of plant growth.
[0017] Compared with the prior art, the present application has the following beneficial effects:
[0018] 1. The present application uses error-prone PCR technology to direct the evolution of wild-type chitinase in vitro, and obtains a chitinase mutant with significantly improved enzyme activity and environmental stability. The enzyme activity of the mutant at 50℃ and pH 7 is 1051.36 U / mL, which is about 2.7 times that of the wild-type chitinase (385.45 U / mL).
[0019] 2. The chitinase mutant provided by the present application has good killing effect on pests such as Lepidoptera pests, Thysanoptera pests and Coleoptera pests, and shows good antibacterial activity on pathogens such as Phytophthora capsici, Pythium aphanidermatum, Botrytis cinerea, Alternaria solani and Curvularia inaequalis. It can be used in the growth and development of vegetable plants such as Chinese cabbage, rape, tomato, and food plants such as rice and corn, and can significantly improve the yield and quality of plants.
[0020] 3. The chitinase mutant of the present application realizes the active extracellular expression of the gene encoding the chitinase mutant in the engineering bacteria Pichia pastoris, has high expression stability, and can efficiently separate and purify the target chitinase mutant from the fermentation product after fermentation culture of the obtained chitinase mutant recombinant strain. DETAILED DESCRIPTION
[0021] The present application is further described in the following by specific embodiments. Unless otherwise specified, the technical means, materials, etc. involved in the following embodiments can be known to those skilled in the art, and appropriate ones can be selected from the known means and materials capable of solving the corresponding technical problems. In addition, the embodiments should be understood as illustrative rather than limiting the scope of the present application, and the essence and scope of the present application are only limited by the claims.
[0022] It should be understood that the scope of the present application is not limited to the defined processes, properties or components, as these embodiments and other descriptions are only illustrative of specific aspects of the present application. In fact, various changes to these embodiments that are obvious to those skilled in the art or related fields without departing from the essence and scope of the present application are all encompassed within the scope of the appended claims.
[0023] It should be noted that, unless otherwise defined, the scientific and technical terms used in the context of the present application should have the meanings commonly understood by those of ordinary skill in the art.
[0024] The chitinase mutants employed in the present application are marked as follows:
[0025] The "amino acid replaced at the original amino acid position" is used to represent the mutated amino acid in the chitinase mutant. For example, W57F means that the amino acid at position 57 is replaced by F from the wild-type chitinase, and the position number corresponds to the amino acid sequence number of the wild-type chitinase in SEQ ID NO. 1.
[0026] The chitinase mutant provided in the embodiments of the present application has an amino acid sequence as shown in SEQ ID NO. 3.
[0027] The present application is based on a wild-type chitinase with an amino acid sequence as shown in SEQ ID NO. 1, and a mutant library thereof is constructed by error-prone PCR, and then the chitinase mutant gene is connected with a carrier, and the host bacteria are used for gene expression, and then a chitinase mutant with significantly improved enzyme activity is screened. Sequencing shows that the mutation points of the chitinase mutant include: W57F, A104C, T108C, G174Q, F274C, F289Y, Y305C, G321A, E339C, Q347C, V372L, G408S, S420A, S431R, D525S, specifically, the tryptophan, alanine, threonine, glycine, phenylalanine, phenylalanine, tyrosine, glycine, glutamic acid, glutamine, valine, glycine, serine, serine, aspartic acid at the 57th, 104th, 108th, 174th, 274th, 289th, 305th, 321st, 339th, 347th, 372nd, 408th, 420th, 431st, and 525th sites are respectively mutated into phenylalanine, cysteine, cysteine, glutamine, cysteine, tyrosine, cysteine, alanine, cysteine, cysteine, leucine, serine, alanine, arginine, serine. The enzyme activity of the mutant is about 2.7 times that of the wild-type chitinase.
[0028] The present application further provides a coding gene of the chitinase mutant as described above, and the nucleotide sequence is shown in SEQ ID NO. 4.
[0029] The present application further provides a recombinant expression vector comprising the coding gene as described above. The recombinant expression vector includes a prokaryotic expression vector, a eukaryotic expression vector and other expression vectors, wherein the carrier of the prokaryotic expression vector includes pET series, pGEX series, pMAL series, pCold series, pTrcHis B and other vectors, and the carrier of the eukaryotic expression vector and other expression vectors includes pFastBac series, pPICZ alpha A, pPIC9K and the like.
[0030] The present application further provides a recombinant strain comprising the recombinant expression vector as described above. The host cell of the recombinant strain is selected according to the type of the recombinant expression vector, for example, when the recombinant expression vector is a prokaryotic expression vector, the host cell is selected from prokaryotic cells, and common prokaryotic cells include Escherichia coli, Bacillus subtilis and the like; when the recombinant expression vector is a eukaryotic expression vector or other expression vector, the host cell can be selected from eukaryotic cells or plant cells, including Pichia pastoris, Saccharomyces cerevisiae, plant cells transformed by Agrobacterium, plant cells transformed by protoplasts and the like.
[0031] In another specific embodiment of the present application, the recombinant expression vector is a eukaryotic expression vector, and the vector is plasmid pPICZα A. Correspondingly, the host cell of the recombinant strain is Pichia pastoris, specifically Pichia pastoris GS115.
[0032] The present application further provides an enzyme preparation comprising the chitinase mutant as described above. The enzyme preparation includes liquid and solid dosage forms, and in addition to the chitinase mutant, it can further comprise some auxiliary ingredients such as buffers, stabilizers, preservatives, etc. to ensure the quality and safety of the enzyme preparation during storage and use.
[0033] The present application further provides the use of the chitinase mutant or enzyme preparation as described above in the control of agricultural pests. The pests include lepidopteran pests such as Plutella xylostella, Helicoverpa armigera, Spodoptera exigua, Cnaphalocrocis medinalis, Pieris rapae, thrips pests such as Frankliniella occidentalis, and coleopteran pests such as Leptinotarsa decemlineata and Epilachna vigintioctopunctata. The chitinase mutant of the present application can destroy the physiological structure of the above pests through the action of cuticle degradation, molting interference, and eggshell dissolution, thereby achieving the control effect. This means that the chitinase mutant of the present application can be used as a component of insecticides to improve their insecticidal effect.
[0034] The present application further provides the use of the chitinase mutant or enzyme preparation as described above in the control of plant diseases. The plant diseases refer to diseases caused by pathogenic oomycetes or pathogenic fungi, such as Pythium aphanidermatum, Pythium ultimum, Botrytis cinerea, Alternaria solani (causing early blight of potato), and Curvularia inaequalis. The chitinase mutant of the present application can efficiently hydrolyze the key component chitin in the cell wall of the above pathogenic fungi, leading to the rupture of the hyphal tip, the collapse of the cell wall structure, and the failure of spore to germinate or rupture, thereby effectively inhibiting the growth, invasion, and reproduction of the pathogenic fungi.
[0035] The present application further provides the use of the chitinase mutant or enzyme preparation as described above in the promotion of plant growth. The plants are vegetable plants such as Chinese cabbage, rape, and tomato, or food plants such as rice and corn. The chitinase mutant of the present application can realize the promotion of plant growth through the synergistic action mechanisms of optimizing the rhizosphere microbial environment, activating the development of plant root system, and regulating plant physiological metabolism.
[0036] Further, the chitinase mutant of the present embodiment can be applied to the preparation of water-soluble fertilizer, to improve soil and increase plant stress resistance by enhancing the functionality of the fertilizer, thereby improving the quality and yield of the plant. The specific application method is as follows: the chitinase mutant of the present embodiment is used to enzymatically hydrolyze a chitin-containing material to obtain an enzymatic hydrolysate containing oligosaccharides and the like, and the enzymatic hydrolysate is added to the fertilizer raw material to mix uniformly, thereby obtaining the desired water-soluble fertilizer. More specifically, the chitin-containing material can be shrimp shells, crab shells, and the like, which are crushed, and then 2-2.5 times the mass of water is added, followed by the addition of 3-5% of the mass of the powdered chitinase mutant, and enzymatic hydrolysis is carried out at 37-42°C for 3-5 hours, after which the enzymatic hydrolysate is obtained by filtration. The fertilizer raw material is a conventional water-soluble fertilizer raw material, and the components and concentrations thereof can be selected by those skilled in the art according to the actual situation, and the present embodiment is not particularly limited. For example, the components of the fertilizer raw material include urea, potassium sulfate, zinc sulfate, and water-soluble organic carbon, and the concentrations thereof are 10-15 g / L, 10-15 g / L, 10-15 g / L, and 200-280 g / L, respectively, and the solvent is water. The amount of the enzymatic hydrolysate added is 0.5-2% of the mass of the fertilizer raw material.
[0037] To make the technical solutions of the present application clearer, the chitinase mutant is described in detail below through a plurality of specific embodiments.
[0038] The components of the culture medium used in the present embodiment are as follows:
[0039] YPD solid culture medium: yeast extract 10 g, tryptone 20 g, glucose 20 g, agar powder 20 g, and deionized water to 1 L;
[0040] BMGY culture medium: yeast extract 10 g, tryptone 20 g, glycerol 10 mL, 1 M potassium phosphate buffer (pH 6.0) 100 mL, 10×YNB (containing ammonium sulfate) 100 mL, 500×biotin (0.02%) 2 mL, and deionized water to 1 L;
[0041] BMMY culture medium: yeast extract 10 g, tryptone 20 g, methanol 5 mL, 1 M potassium phosphate buffer (pH 6.0) 100 mL, 10×YNB (containing ammonium sulfate) 100 mL, 500×biotin (0.02%) 2 mL, and deionized water to 1 L;
[0042] PDA culture medium: potato infusion powder 6 g, glucose 20 g, agar powder 15 g, and deionized water to 1 L.
[0043] It should be noted that the above culture media all need to be autoclaved at 120°C for 20 min.
[0044] The enzyme activity of the chitinase and the mutant thereof in the embodiments of the present application is determined by using the DNS method. The specific determination method is as follows: colloid chitin and enzyme solution are preheated at 45℃ respectively, 500 μL of the preheated enzyme solution is taken, 500 mL of the colloid chitin solution is added, and after reaction at 45℃ for 30 min, 2 mL of DNS reagent is added to terminate the reaction, color development is performed by water bath treatment at 100℃ for 10 min, after cooling, centrifugation is performed to take the supernatant, and the absorbance value is determined at 540 nm. The definition of the enzyme activity unit is as follows: the amount of enzyme used for generating 1 μmol of acetylglucosamine per minute is defined as one activity unit.
[0045] Example 1 Preparation of chitinase mutant
[0046] 1.1 Obtain wild-type chitinase gene
[0047] The wild-type chitinase gene BcChiA-wt with the amino acid sequence shown in SEQ ID NO. 1 and the nucleotide sequence shown in SEQ ID NO. 2 is amplified by PCR.
[0048] The reaction system for amplification is as follows: 2 μL of DNA template, 2 μL of forward primer, 2 μL of reverse primer, 1.5 μL of Pfu DNA Polymerase, 10 μL of 10× PCR Buffer, 1 μL of 5 mM dNTP Mixture, and ddH2O is added to make up to 50 μL.
[0049] The forward primer and the reverse primer are as follows:
[0050] The forward primer BcChiA-wt-F is as follows: GGAATTCCATATGGCTCGTCAATAAATCTAA,
[0051] The reverse primer BcChiA-wt-R is as follows: CCGCTCGAGTTACAGCCACAGCCACCAAC.
[0052] The PCR conditions are as follows: denaturation at 98℃ for 2 min; denaturation at 98℃ for 15 s, annealing at 60℃ for 15 s, extension at 72℃ for 1.5 min, 30 cycles, and 72℃ for 5 min.
[0053] The wild-type chitinase gene BcChiA-wt amplified above and plasmid pPICZα A were double-digested with Xba I and BamH I, respectively, and the reaction system was 5 μL of the amplified product or plasmid pPICZα A, 1 μL of Xba I, 1 μL of BamH I, 5 μL of 10×CutSmart Buffer, and ddH2O was added to 50 μL. After the enzyme digestion at 37 °C for 1.5 h, agarose gel electrophoresis was performed, and the product was recovered by a DNA gel recovery kit to obtain the BcChiA-wt gene fragment and the linearized pPICZα A plasmid fragment.
[0054] The above gene fragment and plasmid fragment were ligated to obtain the recombinant expression vector pPICZα A-BcChiA-wt.
[0055] 1.2 Construction of chitinase mutant library
[0056] The wild-type chitinase gene was used as a DNA template for error-prone PCR amplification to obtain a randomly mutated chitinase gene.
[0057] The reaction system of PCR was 1 μL of DNA template, 2 μL of forward primer BcChiA-wt-F, 2 μL of reverse primer BcChiA-wt-R, 5 μL of 10×Taq PCR Buffer, 7 μL of MgCl2 (25 mM), 1 μL of MnCl2 (10 mM), 4 μL of dNTP mixture, 0.5 μL of Taq DNA polymerase, and ddH2O was added to 50 μL.
[0058] The reaction program was 95 °C for 5 min, 30 cycles of 94 °C for 30 s, 55 °C for 30 s, 72 °C for 2 min, and finally 72 °C for 10 min.
[0059] After the error-prone PCR amplification product was subjected to 1% agarose gel electrophoresis, the product was recovered by a DNA gel recovery kit to obtain a randomly mutated chitinase gene.
[0060] 1.3 Expression and screening of chitinase mutants
[0061] Referring to the foregoing method, the randomly mutated chitinase gene was double-digested with plasmid pPICZα A, and then ligated to obtain a recombinant expression vector containing a mutant gene. The recombinant strain was obtained by transforming the recombinant expression vector into host cells Pichia pastoris GS115 by an electroporation method, and a chitinase mutant with high enzyme activity was screened. The specific transformation and screening method is as follows:
[0062] (1) Linearize the recombinant expression vector containing the mutant gene, mix 5 μL of the linearized product with 80 μL of Pichia pastoris GS115 competent cells, and then perform electroporation under the conditions of 1.5 kV, 25 μF and 200 Ω. Immediately after the electroporation, add 1 mL of pre-cooled sorbitol (1 mol / L) to obtain a bacterial solution;
[0063] (2) Take 200 μL of the bacterial solution and spread it on YPD solid medium containing 100 μg / mL Zeocin, and then incubate it at 30°C for 2-4 days until single colonies appear;
[0064] (3) Pick a single colony and inoculate it in BMGY medium (containing 1% glycerol), and then incubate it at 30°C and 250 rpm until the OD600 is 2-6. Centrifuge to collect the bacterial cells, resuspend them in BMMY medium (containing 0.5% methanol) to an OD600 of 1.0, and then continue to incubate them at 30°C and 250 rpm. Add 100% methanol to the medium every 24 h to a final concentration of 0.5%, and then incubate for 72-96 h. Centrifuge to obtain the supernatant (chitinase mutant crude enzyme solution), and then determine the enzyme activity at 50°C and pH 7.
[0065] (4) Linearize the aforementioned recombinant expression vector pPICZα A-BcChiA-wt according to the above method, prepare the wild-type chitinase crude enzyme solution, and then determine the enzyme activity. Compare the enzyme activity of the chitinase mutant crude enzyme solution with the determined enzyme activity, and then preliminarily screen the chitinase mutant crude enzyme solution with improved enzyme activity. Repeat the above steps for re-screening, and finally screen the chitinase mutant crude enzyme solution with significantly improved enzyme activity.
[0066] 1.4 Purification of the chitinase mutant
[0067] Use 26% ammonium sulfate to precipitate the chitinase mutant crude enzyme solution obtained after the final screening, centrifuge to collect the precipitate, resuspend it in a pH 6.5, 20 mM KH2PO4-Na2HPO4 buffer, centrifuge to remove the solid after resuspension, and then obtain a resuspension solution. Dialyze the resuspension solution in the above buffer at 4°C for 24 h, centrifuge to collect the supernatant, filter it through a 0.22 μm organic membrane, and then load it onto a Ni-NTA chromatography column. First, use 2 column volumes of A liquid (25 mM Tris-HCl buffer, 500 mM NaCl, pH 7.4) and gradient elution of A liquid containing 15, 30 and 45 mM imidazole to elute the impurities, and then use 2 column volumes of B liquid (25 mM Tris-HCl buffer, 500 mM NaCl, 300 mM imidazole) for elution. The collected eluate is the purified chitinase mutant enzyme solution. Freeze-dry the enzyme solution to obtain a powdery chitinase mutant.
[0068] The obtained chitinase mutant was sequenced, the amino acid sequence of which is shown as SEQ ID NO. 3, and the nucleotide sequence of which is shown as SEQ ID NO. 4.
[0069] The chitinase mutant was determined for enzyme activity at 50℃ and pH 7, and the enzyme activity was determined to be 1051.36 U / mL, which was about 2.7 times that of the wild-type chitinase (385.45 U / mL).
[0070] Example 2 Investigation of the Enzymatic Properties of the Chitinase Mutant
[0071] 2.1 Optimum temperature of the chitinase mutant
[0072] The chitinase mutant was determined for enzyme activity at 30-80℃ and pH 7. The temperature with the highest enzyme activity was the optimum temperature of the chitinase mutant, and the enzyme activity was defined as 100%, and the relative enzyme activity under the remaining temperature conditions was calculated.
[0073] The determination results are shown in Table 1, the optimum temperature of the chitinase mutant of the application was 55℃, and the relative enzyme activity remained above 90% under the conditions of 45-65℃.
[0074] Table 1 Relative enzyme activity of the chitinase mutant under different temperatures
[0075] .
[0076] 2.2 Optimum pH of the chitinase mutant
[0077] The chitinase mutant was determined for enzyme activity at pH 2-10 and a temperature of 50℃. The pH with the highest enzyme activity was the optimum pH of the chitinase mutant, and the enzyme activity was defined as 100%, and the relative enzyme activity under the remaining pH conditions was calculated.
[0078] The determination results are shown in Table 2, the optimum pH of the chitinase mutant of the application was 6, and the relative enzyme activity remained above 90% under the conditions of pH 4-8, and the relative enzyme activity remained above 85% under the conditions of pH 3-9.
[0079] Table 2 Relative enzyme activity of the chitinase mutant under different pH
[0080] .
[0081] 2.3 Thermal stability of the chitinase mutant
[0082] The thermostability of the chitinase mutant was determined under pH 6 conditions, i.e., after incubation in a water bath at 45-80℃ for 2 h, the residual enzyme activity of the chitinase mutant was measured and calculated. The initial enzyme activity after 0 h of incubation was defined as 100%. The results are shown in Table 3. The chitinase mutant of the present invention can maintain a residual enzyme activity of over 90% after treatment at 30-65℃ for 2 h.
[0083] Table 3. Results of thermostability determination of chitinase mutants
[0084] .
[0085] 2.4 pH stability of chitinase mutants
[0086] The pH stability of the chitinase mutant was determined at 55°C, i.e., the chitinase mutant was incubated at pH 2-10 for 12 h, and the residual enzyme activity of the chitinase mutant was measured and calculated. The initial enzyme activity after 0 h of incubation was defined as 100%. The results are shown in Table 4. After treatment at pH 5-8 for 12 h, the residual enzyme activity of the chitinase mutant of the present invention remained above 90%.
[0087] Table 4. Results of pH stability determination of chitinase mutants
[0088] .
[0089] Example 3: Application of chitinase mutants in agricultural pest control
[0090] (1) The insecticidal activity of the chitinase mutant against diamondback moth, cotton bollworm, beet armyworm, rice leaf roller, cabbage caterpillar, potato beetle, and twenty-eight-spotted ladybug was determined by the following method:
[0091] Fresh leaves of host plants of the target pests (e.g., cabbage leaves for diamondback moth, cotton leaves for bollworm, and potato leaves for potato beetle) were cut into 2 cm * 2 cm pieces. These were then immersed for 10 seconds in chitinase mutant enzyme solutions at concentrations of 100 μg / mL, 200 μg / mL, and 300 μg / mL, and in wild-type chitinase enzyme solution at a concentration of 300 μg / mL. After immersion and draining, the larvae were placed in petri dishes lined with moistened filter paper. Ten standardized larvae were inoculated into each petri dish. The dishes were cultured at a temperature of 25 ± 1 ℃, a relative humidity of 70 ± 5%, and a light intensity of 16 L: 8 D. The number of dead larvae was checked and recorded every 24 hours, and the mortality rate (number of dead larvae / total number, %) was calculated. A larvae that could not move when lightly touched with the tip of a brush was considered dead. The mortality rates of diamondback moth, cotton bollworm, beet armyworm, rice leaf roller, cabbage caterpillar, potato beetle, and 28-spotted ladybug after 72 h of cultivation are shown in Table 5.
[0092] Table 5: Mortality rate of target pests after 72 h of incubation under different treatments (%)
[0093] .
[0094] (2) The chitinase mutant was tested for insecticidal activity against the western flower thrips, and the testing method was as follows:
[0095] A layer of parafilm film was laid on the bottom of a culture dish, and chitinase mutant enzyme solutions with concentrations of 100 μg / mL, 200 μg / mL, and 300 μg / mL and a wild-type chitinase enzyme solution with a concentration of 300 μg / mL were each uniformly dropped onto the surface of the film (500 μL per dish, ensuring that the surface of the film was completely wet), and then air-dried at room temperature for 30 min to form a uniform drug film. Ten western flower thrips adults were introduced, and the culture dish was sealed with a breathable film (with a small hole for ventilation). The culture dish was placed in an environment with a temperature of 25±1 °C, a relative humidity of 70±5%, and a light intensity of 16L:8D. The number of dead insects was checked and recorded every 24 h, and the mortality rate was calculated (number of dead insects / total number, %). Insects that could not move when touched with a brush were considered dead. After 72 h of incubation, the mortality rates of the western flower thrips under the treatments of chitinase mutant enzyme solutions with concentrations of 100 μg / mL, 200 μg / mL, and 300 μg / mL were 54.2%, 72.4%, and 89.4%, respectively; and the mortality rate of the western flower thrips under the treatment of the wild-type chitinase enzyme solution with a concentration of 300 μg / mL was 16.7%.
[0096] Example 4: Application of chitinase mutants in plant disease control
[0097] The chitinase mutant was tested for fungistatic activity against five pathogenic fungi, i.e., Phytophthora capsici, Pythium aphanidermatum, Botrytis cinerea, Alternaria solani, and Curvularia inaequalis, and the testing method was as follows:
[0098] Chitinase mutant enzyme solutions with concentrations of 100 μg / mL, 200 μg / mL, and 300 μg / mL and a wild-type chitinase enzyme solution with a concentration of 300 μg / mL were mixed with PDA solid medium cooled to about 50°C at a ratio of 1:9 (v / v) to prepare drug-containing plates. Plates to which an equal amount of sterile water was added were used as blank controls. A 5-mm-diameter fungal cake was taken from the edge of a pre-cultured pathogenic fungal colony and invertedly inoculated in the center of the drug-containing plate, which was then incubated at 25 °C in the dark. After 7 d of incubation, the colony diameters of each treatment group were measured, and the mycelial growth inhibition rate was calculated according to the following formula. The calculation results are shown in Table 6.
[0099] .
[0100] Table 6: Mycelium growth inhibition rate of pathogenic fungi under different treatments (%)
[0101] .
[0102] Example 5: Application of chitinase mutants in promoting plant growth
[0103] (1) Promotion effect of chitinase mutants on the growth of Chinese cabbage
[0104] Select full and disease-free Chinese cabbage seeds, rinse with sterile water, and completely immerse in chitinase mutant enzyme solution with concentrations of 100 μg / mL, 200 μg / mL, and 300 μg / mL, and wild-type chitinase enzyme solution with a concentration of 300 μg / mL. Use sterile water as a blank control. After soaking for 12 h at 25°C, germinate the seeds, and then sow them in substrate soil when the radicles grow to 0.5 cm. After 30 days of cultivation, measure the fresh weight and root length of the Chinese cabbage. The results are shown in Table 7.
[0105] Table 7: Fresh weight and root length of Chinese cabbage under different treatments
[0106] .
[0107] (2) Promotion effect of chitinase mutants on the growth of rice
[0108] Select full and disease-free rice seeds, rinse with sterile water, and completely immerse in chitinase mutant enzyme solution with concentrations of 100 μg / mL, 200 μg / mL, and 300 μg / mL, and wild-type chitinase enzyme solution with a concentration of 300 μg / mL. Use sterile water as a blank control. After soaking for 12 h at 25°C, germinate the seeds, and then sow them in substrate soil when the radicles grow to 0.5 cm. After 30 days of cultivation, measure the fresh weight and root length of the Chinese cabbage. The results are shown in Table 7.
[0109] Table 8: Effective panicle number, panicle grain number, and thousand-grain weight of rice under different treatments
[0110] .
[0111] Test Example 6
[0112] Use the chitinase mutant to prepare a water-soluble fertilizer, and the preparation method is as follows:
[0113] Water-soluble fertilizer sample 1:
[0114] Prepare the fertilizer raw materials, which include urea, potassium sulfate, zinc sulfate, and water-soluble organic carbon, with concentrations of 10 g / L, 10 g / L, 15 g / L, and 200 g / L, respectively. The solvent is water.
[0115] The shrimp shell was crushed and added with 2 times of water by mass, and 3% of the powdered chitinase mutant of Example 1 by mass, and then enzymolysis was carried out at 37℃ for 3h, and then filtration was carried out to obtain an enzymolysis liquid;
[0116] The enzymolysis liquid was added to the fertilizer raw material at 0.5% by mass, and then mixed uniformly to obtain a water-soluble fertilizer.
[0117] Water-soluble fertilizer sample 2:
[0118] A fertilizer raw material was prepared, and the components included urea, potassium sulfate, zinc sulfate and water-soluble organic carbon, and the concentrations were 12g / L, 12g / L, 13g / L and 240g / L respectively, and the solvent was water;
[0119] The crab shell was crushed and added with 2.3 times of water by mass, and 4% of the powdered chitinase mutant of Example 1 by mass, and then enzymolysis was carried out at 40℃ for 5h, and then filtration was carried out to obtain an enzymolysis liquid;
[0120] The enzymolysis liquid was added to the fertilizer raw material at 0.15% by mass, and then mixed uniformly to obtain a water-soluble fertilizer.
[0121] Water-soluble fertilizer sample 3:
[0122] A fertilizer raw material was prepared, and the components included urea, potassium sulfate, zinc sulfate and water-soluble organic carbon, and the concentrations were 15g / L, 15g / L, 10g / L and 280g / L respectively, and the solvent was water;
[0123] The shrimp shell and the crab shell were mixed at a mass ratio of 1:1, and then crushed and added with 2.5 times of water by mass of the total mixture, and then added with 5% of the powdered chitinase mutant of Example 1 by mass of the total, and then enzymolysis was carried out at 42℃ for 4h, and then filtration was carried out to obtain an enzymolysis liquid;
[0124] The enzymolysis liquid was added to the fertilizer raw material at 0.2% by mass, and then mixed uniformly to obtain a water-soluble fertilizer.
[0125] Control fertilizer sample: the fertilizer raw material without adding the enzymolysis liquid, and the components were the same as those of the fertilizer raw material of the water-soluble fertilizer sample 1.
[0126] (1) Application of water-soluble organic fertilizer in promoting the growth of tomatoes
[0127] The above water-soluble fertilizer and the control fertilizer sample were diluted 800 times, and then sprayed on the tomatoes at the seedling stage, the flowering stage and the fruiting stage, and the spraying amount was 30L per mu at the seedling stage, 30L per mu at the flowering stage and 40L per mu at the fruiting stage. After the tomatoes matured, the incidence of gray mold and the yield were determined, and the results are shown in Table 9.
[0128] Table 9 Effect of different fertilizers on the incidence of gray mold and the yield of tomatoes
[0129]
[0130] (2) Application of water-soluble organic fertilizer in promoting the growth of wheat
[0131] The above water-soluble fertilizer and control fertilizer samples were diluted 800 times, and the wheat was sprayed at the jointing stage, with a dosage of 30 L per mu. After the wheat matured, the ear number, grain number per ear and yield were measured, and the results are shown in Table 10.
[0132] Table 10 Effect of different fertilizer treatments on the ear number, grain number per ear and yield of wheat
[0133] .
[0134] Finally, it should be noted that although the present application has been described in detail with reference to the foregoing embodiments, those skilled in the art can still modify the technical solutions recorded in the foregoing embodiments or make equivalent replacements to some of the technical features, and any modification, equivalent replacement, improvement, etc. made within the spirit and principles of the present application shall be included in the protection scope of the present application.
Claims
1. A chitinase mutant characterized in that, The amino acid sequence of the chitinase mutant is shown as SEQ ID NO.
3.
2. A gene encoding the chitinase mutant according to claim 1.
3. A recombinant expression vector, characterized in that, The gene encoding the chitinase mutant according to claim 2.
4. The recombinant expression vector of claim 3, wherein, The vector of the recombinant expression vector is plasmid pPICZα A.
5. A recombinant strain, characterized in that, The recombinant expression vector according to claim 3 or 4.
6. The recombinant bacterial strain of claim 5, wherein The host strain of the recombinant strain is Pichia pastoris.
7. Enzyme preparation, characterized in that, The chitinase mutant according to claim 1.
8. The chitinase mutant according to claim 1 or the enzyme preparation according to claim 7 is applied in the prevention of Plutella xylostella, Helicoverpa armigera, Spodoptera exigua, Cnaphalocrocis medinalis, Pieris rapae, Leptinotarsa decemlineata, Epilachna vigintioctopunctata and Frankliniella occidentalis.
9. The chitinase mutant according to claim 1 or the enzyme preparation according to claim 7 is applied in the prevention of Pythium aphanidermatum, Pythium ultimum, Botrytis cinerea, Alternaria solani, and Curvularia inaequalis.
10. The chitinase mutant according to claim 1 or the enzyme preparation according to claim 7 is applied in the promotion of Brassica chinensis, Oryza sativa, Solanum lycopersicum, and Triticum aestivum growth.
Citation Information
Patent Citations
Application of recombinant chitinase to insecticidal or bacterium-inhibition effect
CN109258693A
Biocontrol microorganisms
US20120263690A1