Grass carp n-3 polyunsaturated fatty acid synthesis surplus model and construction method thereof
By using CRISPR/Cas9 gene editing technology targeting the retsat.2 gene in grass carp, the retsat.2 protein encoding was disrupted by microinjection into grass carp fertilized eggs. This solved the problems of low efficiency and insufficient safety of traditional breeding and early genetic engineering technologies in increasing the content of n-3 polyunsaturated fatty acids in grass carp, and achieved a significant increase in the content of n-3 polyunsaturated fatty acids in the liver, brain and muscle of grass carp.
Patent Information
- Application Number
- CN202511199279.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-08-26
- Publication Date
- 2025-11-07
AI Technical Summary
Existing technologies for improving the n-3 polyunsaturated fatty acid content of grass carp and other farmed fish species suffer from low efficiency, long cycles, and insufficient safety. Traditional breeding methods are difficult to quickly improve their nutritional quality, while early genetic engineering technologies have uncontrollable gene integration sites and biosafety risks.
By using specific sgRNA to target exon 2 of the grass carp retsat.2 gene and microinjecting it into grass carp single-cell stage fertilized eggs via CRISPR/Cas9 gene editing technology, the retsat.2 protein encoding was disrupted, thus constructing a grass carp n-3 polyunsaturated fatty acid synthesis surplus model.
It significantly increases the content of n-3 polyunsaturated fatty acids in the liver, brain and muscle of grass carp, achieving precision and safety in gene editing and ensuring the controllability and stability of the gene modification process.
Smart Images

Figure CN120905228A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the technical field of genetic engineering, in particular to a grass carp n-3 polyunsaturated fatty acid synthesis surplus model and a construction method thereof. BACKGROUND
[0002] Polyunsaturated fatty acids (PUFAs) are an important class of fatty acids necessary for maintaining normal physiological functions of the human body. This class of substances plays a key role in regulating lipid metabolism, can effectively reduce the low-density lipoprotein cholesterol and triglyceride levels in the serum, and inhibit the formation of atherosclerotic plaques, thereby protecting the cardiovascular system. Polyunsaturated fatty acids can be divided into two major series, n-6 and n-3. Among them, n-3 polyunsaturated fatty acids, mainly including α-linolenic acid (ALA), eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA), are particularly important for human health. As a key component of cell membranes, n-3 PUFAs can maintain the fluidity and permeability of cell membranes and support effective conduction of cell signals. Specifically, EPA helps regulate blood lipids and reduce the risk of atherosclerosis, while DHA is a core structural material for the brain and retina, is crucial for the development of the nervous system and vision of infants, and can improve cognitive function in adults. In addition, n-3 PUFAs also have significant anti-inflammatory effects and can inhibit the production of pro-inflammatory factors in the body. In the field of aquaculture, n-3 PUFAs are also essential nutrients for fish growth and development, and have a decisive significance for improving egg quality, promoting embryonic development and improving the survival rate of juvenile fish.
[0003] Aquatic products are an important dietary source of n-3 polyunsaturated fatty acids for humans. Among them, grass carp ( Ctenopharyngodon idella ) is an important freshwater economic fish in China, with a huge production, accounting for 21.4% of the total freshwater fish farming output in China in 2023, and is one of the core sources of animal protein intake for urban and rural residents. Grass carp is widely popular due to its tender meat, balanced nutrition and affordable price, and plays a core role in ensuring the supply of aquatic products. In order to further improve the economic value and nutritional quality of farmed fish, existing technologies mainly rely on traditional breeding techniques and modern genetic engineering techniques. Traditional breeding selects individuals with excellent traits (such as fast growth and strong disease resistance) for breeding through hybridization and systematic selection. In the field of genetic engineering, early technologies mainly use random integration of transgenic methods to introduce foreign genes into fish genomes in order to obtain improved target traits, such as introducing growth hormone genes from other species into fish to promote their rapid growth.
[0004] However, the existing technical means has obvious limitations in improving the specific nutritional components (such as n-3 polyunsaturated fatty acids) of grass carp and other multi-main breeding fish. The traditional selective breeding method has a long cycle and usually needs to breed for multiple generations to obtain a slight improvement of the trait. For complex biological traits such as fatty acid metabolism, which are controlled by multiple genes, the breeding efficiency is lower, and problems such as incomplete separation of traits and loss of excellent traits are prone to occur. In addition, during the breeding process, undesirable linked genes may be inadvertently introduced, leading to the decline of other economic traits. On the other hand, although the early transgenic technology can introduce functional genes in a targeted manner, the integration position of the exogenous gene in the host genome is random and uncontrollable, which may lead to insertional inactivation (i.e. disruption of the host's original important genes), unstable gene expression level, and potential biosafety risks. These uncertainties have greatly limited the development and market promotion of edible fish using this technology.
[0005] In summary, the current technical path for improving the nutritional quality of economic fish has inherent defects. The traditional breeding method is inefficient and has a long cycle, making it difficult to meet the growing demand for high-quality aquatic products in the market. The early gene engineering technology characterized by random integration of genes cannot fully guarantee the precision and safety of its application, making it difficult to be widely used in germplasm improvement of main food economic fish. Therefore, there is an urgent need in the art for a more precise, efficient and safe technical means to stably and controllably improve the genetic traits of important economic fish such as grass carp, especially to increase the content of key nutrients beneficial to human health in the body, thereby overcoming the bottleneck of existing technology.
[0006] Therefore, the present application is proposed. SUMMARY
[0007] The present application aims to provide a grass carp n-3 polyunsaturated fatty acid synthesis surplus model and a construction method thereof. The sgRNA has the sequence of SEQ ID NO. 1, and by specifically disrupting the protein coding of the grass carp retsat.2 gene, the content of n-3 polyunsaturated fatty acids in the liver, brain and muscle can be significantly improved.
[0008] In order to achieve the above-mentioned purpose of the present application, the following technical solutions are adopted: In a first aspect, the present application provides an sgRNA, the nucleotide sequence of which is shown in SEQ ID NO. 1.
[0009] In a second aspect, the present application provides a primer sequence for constructing a template for synthesizing the sgRNA as described in the preceding embodiments, including a forward primer with the nucleotide sequence shown in SEQ ID No. 2 and a reverse primer with the nucleotide sequence shown in SEQ ID No. 3.
[0010] In a third aspect, the present application provides a method for constructing a grass carp n-3 polyunsaturated fatty acid synthesis surplus model, comprising: injecting sgRNA and Cas9 mRNA shown in the foregoing embodiments into a grass carp single-cell period fertilized egg by microinjection; wherein the sgRNA targets the grass carp retsat.2 gene exon 2; culturing the injected fertilized egg, screening and obtaining retsat.2 a grass carp with a mutated gene sequence resulting in retsat.2 a destroyed protein coding to obtain retsat.2 a grass carp with a deletion mutation as the grass carp model; Preferably, in the microinjection step, the number of single-cell period grass carp fertilized egg embryos injected is 200-500; Preferably, the sequence of the target site to which the sgRNA is directed is shown in SEQ ID No. 4.
[0011] In an optional embodiment, the method for obtaining the sgRNA comprises: using primer sequences to perform PCR with pMD19T-gRNA as the template for the PCR reaction, purifying and recovering the PCR product, and using the purified product as a gRNA in vitro transcription template; wherein the primer sequences comprise a forward primer with a nucleotide sequence shown in SEQ ID No. 2 and a reverse primer with a nucleotide sequence shown in SEQ ID No. 3; performing in vitro transcription on the gRNA in vitro transcription template with a T7 transcription enzyme to finally obtain the gRNA after purification.
[0012] In an optional embodiment, the step of culturing the injected fertilized egg, screening and obtaining retsat.2 a grass carp with a mutated gene sequence resulting in retsat.2 a destroyed protein coding to obtain retsat.2 a grass carp with a deletion mutation as the grass carp model, comprises: extracting the embryo genome obtained by culturing the fertilized egg, performing PCR amplification using a forward primer shown in SEQ ID No. 5 and a reverse primer shown in SEQ ID No. 6, and obtaining an amplification product; sequencing the amplification product, and screening out embryos with a sequencing result showing a random peak near the target site; raising the screened embryos, cutting their tail fins for genome extraction and sequencing after they grow, and screening again to obtain the retsat.2 grass carp with a deletion mutation.
[0013] In an optional embodiment, the step of sequencing the amplification product uses a reverse primer as shown in SEQ ID No. 6 as a sequencing primer.
[0014] In a fourth aspect, the present application provides a grass carp n-3 polyunsaturated fatty acid synthesis surplus model, which is prepared by any one of the preceding embodiments.
[0015] In an optional embodiment, the method comprises: performing a PCR reaction using the tail fin genome of the grass carp as a template; performing a PCR reaction using a forward primer as shown in SEQ ID No. 5 and a reverse primer as shown in SEQ ID No. 6 to obtain a PCR reaction product; sequencing the PCR reaction product using a reverse primer as shown in SEQ ID No. 6 to determine whether the retsat.2 gene has a mutation according to the sequencing result.
[0016] In a fifth aspect, the present application provides a detection product comprising a forward primer sequence as shown in SEQ ID No. 5 and a reverse primer sequence as shown in SEQ ID No. 6.
[0017] In a sixth aspect, the present application provides a use of the sgRNA as described in the preceding embodiments in constructing a grass carp retsat.2 mutant model.
[0018] The present application provides a grass carp n-3 polyunsaturated fatty acid synthesis surplus model and a method for constructing the same. The sgRNA has a nucleotide sequence as shown in SEQ ID No. 1, which can specifically recognize and bind to a specific site on the grass carp retsat.2 gene. According to the document, the target site is located on the second exon of the retsat.2 gene. This high degree of targeting accuracy is the basis for achieving site-directed gene editing, ensuring the accuracy of subsequent gene modification processes, thereby effectively reducing the risk of unintended modification at other locations in the genome.
[0019] After the sgRNA guides the gene editing tool to the predetermined target site, it can effectively trigger modification of the retsat.2 gene and successfully disrupt the coding of the Retsat.2 protein. This indicates that the sgRNA of this specific sequence not only has targeting properties in structure, but also can efficiently initiate the expected gene editing event in function, thereby achieving the disruption of the function of the target gene.
[0020] Finally, through the sgRNA-mediated precise genetic modification, the n-3 polyunsaturated fatty acid content in the liver, brain and muscle tissues of grass carp can be significantly increased. Therefore, the sgRNA of the specific sequence is a key molecular tool to obtain this excellent nutritional trait, and provides a basis for breeding grass carp rich in n-3 polyunsaturated fatty acids. BRIEF DESCRIPTION OF DRAWINGS
[0021] In order to more clearly illustrate the specific embodiments of the present application or the technical solutions in the prior art, the drawings needed in the specific embodiments or prior art description will be briefly introduced below. Obviously, the drawings in the following description are some embodiments of the present application, and those skilled in the art can also obtain other drawings according to these drawings without creative labor.
[0022] retsat.2 The sequence diagram of the gene target site provided in Example 1 of the present application, and the peak diagram of the sequencing results containing the mutation site; Figure 1 retsat.2 The column chart of the expression of the gene in different tissues of grass carp in Example 4 of the present application; Figure 2 retsat.2 The column chart of the expression of the gene in different tissues of grass carp in Example 4 of the present application; Figure 3 The comparison chart of the proportion of n-3 polyunsaturated fatty acid in total fat and n-6 polyunsaturated fatty acid in the liver of the mutant grass carp; retsat.2 The comparison chart of the proportion of n-3 polyunsaturated fatty acid in total fat and n-6 polyunsaturated fatty acid in the muscle of the mutant grass carp; Figure 4 The comparison chart of the proportion of n-3 polyunsaturated fatty acid in total fat and n-6 polyunsaturated fatty acid in the brain of the mutant grass carp. retsat.2 Figure 5 The comparison chart of the proportion of n-3 polyunsaturated fatty acid in total fat and n-6 polyunsaturated fatty acid in the brain of the mutant grass carp. DETAILED DESCRIPTION
[0023] The embodiments of the present application will be described in detail below with reference to the examples, but those skilled in the art will understand that the following examples are only used to illustrate the present application and should not be regarded as limiting the scope of the present application. The specific conditions are not specified in the examples, and the conventional conditions or the conditions recommended by the manufacturer are used. The reagents or instruments used are not specified by the manufacturer, and are all conventional products that can be obtained by purchase.
[0024] In the embodiments of the present application, an sgRNA is provided, and the nucleotide sequence of the sgRNA is shown in SEQ ID NO. 1.
[0025] The above SEQ ID No. 1 is (5'~3'): TGTAATACGACTCACTATA retsat.2 TGGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCT.
[0026] In the embodiments of the present application, a primer sequence is provided for constructing a template for synthesizing the sgRNA as described in the foregoing embodiments, including a forward primer with a nucleotide sequence as shown in SEQ ID No. 2 and a reverse primer with a nucleotide sequence as shown in SEQ ID No. 3.
[0027] The above SEQ ID No. 2 is (5'~3'): TGTAATACGACTCACTATA GTGGTAGGCAGTGGGAT TTTTAGAGCTAGAAAT.
[0028] The above SEQ ID No. 3 is (5'~3'): AGCACCGACTCGGTGCCACTTTTTC.
[0029] In the embodiments of the present application, a method for constructing a grass carp n-3 polyunsaturated fatty acid synthesis surplus model is provided, comprising: Step S1, microinjecting sgRNA and Cas9 mRNA as shown in the foregoing embodiments into a single-cell stage fertilized egg of grass carp; wherein the sgRNA targets the grass carp GTGGTAGGCAGTGGGATTGGG gene exon 2.
[0030] This step is the starting point of the entire gene editing process. The core is to deliver two key biological macromolecules, sgRNA (single guide RNA) and Cas9 mRNA (messenger RNA encoding Cas9 "gene scissors" protein), to the most initial stage of grass carp life, i.e. single-cell stage fertilized egg. The role of sgRNA is "navigation", which can accurately find the retsat.2 gene in the grass carp genome according to its sequence; and the Cas9 mRNA will be translated into Cas9 protein after entering the cell, which will cut the retsat.2 gene under the guidance of sgRNA. This step specifically indicates that the target site is located in the exon 2 of the retsat.2 gene. Exon is the part of the gene that finally encodes protein, and modification at this point can usually effectively destroy the normal function of the protein.
[0031] By physical manipulation, i.e. "microinjection", a mixture solution containing sgRNA and Cas9 mRNA is injected into the single-cell fertilized egg of grass carp under a microscope using a very thin glass needle. After treatment, a fertilized egg containing a complete set of CRISPR / Cas9 gene editing tools is obtained. This fertilized egg will start to develop, and at the same time, the sgRNA and Cas9 protein in its cells will start to work, find and modify retsat.2 genes.
[0032] By targeting the specific exon 2 of sgRNA, the accuracy of gene editing operation is ensured, and the key region of protein coding is directly affected. Injection at the single-cell stage can ensure that the gene modification event occurs in the "ancestor" cell of all cells. Therefore, most or even all cells in the developed individual will carry this gene mutation, avoiding too high proportion of chimeras (i.e. part of the cells have mutations and part of the cells do not), greatly improving the efficiency of obtaining stable genetic mutants.
[0033] Specifically, it can be completed on an inverted microscope equipped with a micro-manipulation system. First, prepare an injection solution containing a predetermined concentration of sgRNA and Cas9 mRNA, then fix the grass carp fertilized egg in a culture dish, control the injection needle by a micro-manipulation instrument, pierce the egg membrane and inject nanoliter level solution.
[0034] In some embodiments, in the microinjection step, the number of single-cell stage grass carp fertilized egg embryos injected is 200-500; for example, it can be 200, 300, 400, 500, etc.
[0035] In gene editing experiments, due to various uncertain factors such as embryo death, injection failure, and low editing efficiency, a sufficient number of embryos need to be treated to ensure that successful mutants can be finally screened. The number of 200-500 embryos given in this embodiment is an optimized range that balances the success rate of experiments and the amount of work, which has high practicality and success guarantee.
[0036] Step S2, culturing the injected fertilized egg, screening and obtaining retsat.2 a grass carp in which the retsat.2 protein coding is destroyed due to mutation of the gene sequence, to obtain retsat.2 a grass carp with a deletion mutation as the grass carp model.
[0037] This step provides the follow-up work of gene editing, i.e. cultivating the embryos treated by injection into life and selecting them by a specific method to find individuals with successful gene editing. The "success" standard here is very clear: retsat.2The gene sequence must have mutated, and the mutation must be able to cause the protein it encodes to be functionally disrupted. The ultimate goal is to obtain a retsat.2 grass carp model with a functionally deleted gene.
[0038] First is "cultivation", that is, providing suitable water temperature, water quality and nutrition and other hatching conditions for the fertilized eggs after injection, so that they can develop normally into fry and grow. Then is "screening", that is, detecting the fish at a certain stage of development at the gene level to identify whether the gene has the expected mutation. After cultivation and screening, a batch of grass carp individuals verified to have successfully mutated (functionally deleted) genes are finally obtained, and these individuals are the target grass carp model. retsat.2 retsat.2 The final grass carp model obtained is expected to meet the requirements. It not only requires the gene sequence to change, but also emphasizes that the change must be functional (disrupting protein coding), which makes the screened model clear in biological effect and provides reliable materials for subsequent research and application.
[0039] This step ensures that the final grass carp model obtained is as expected. It not only requires the gene sequence to change, but also emphasizes that the change must be functional (disrupting protein coding), which makes the screened model clear in biological effect and provides reliable materials for subsequent research and application.
[0040] In some embodiments, the sequence of the target site to which the sgRNA is directed is as shown in SEQ ID No. 4.
[0041] The precise target site of gene editing is specified in this embodiment. SEQ ID No. 4 is a specific DNA sequence, and its nucleotide sequence is specifically (5'~3'): GTGGTAGGCAGTGGGATTGGTGG.
[0042] This specific sequence is chosen as the target because it has been designed and verified to be efficiently recognized by sgRNA, and after Cas9 protein cutting, the cell itself is prone to produce insertion or deletion mutations that disrupt gene function. Specifying this sequence greatly improves the repeatability and success rate of the method and is a key technical detail for efficient gene knockout.
[0043] In optional embodiments, the method for obtaining the sgRNA in step S1 includes: Step S3, using primer sequences to perform PCR with pMD19T-gRNA as the template for the PCR reaction, purifying and recovering the PCR product, and using the purified product as a gRNA in vitro transcription template; wherein the primer sequences include a forward primer with a nucleotide sequence as shown in SEQ ID No. 2 and a reverse primer with a nucleotide sequence as shown in SEQ ID No. 3.
[0044] This step provides a process for preparing a linear DNA template for producing sgRNA. Starting from the circular DNA (plasmid) of pMD19T-gRNA, this plasmid serves as a universal backbone. By using specific primer sequences (SEQ ID No. 2 and No. 3) and PCR technology, a specific DNA fragment is "copied" and amplified from this circular backbone. Finally, the DNA fragment is purified from the PCR reaction system, and the purified DNA is the direct template required for the next step of producing sgRNA.
[0045] First, the pMD19T-gRNA plasmid, primers of SEQ ID No. 2 and No. 3, DNA polymerase and other reagents are mixed, and multiple rounds of temperature and cooling cycles are performed in a PCR instrument to replicate the target DNA fragment exponentially. Then the mixture after the PCR reaction is treated by a specific method (such as a centrifugal column) to remove excess primers, enzymes, salt ions and other impurities, and only the amplified target DNA product is retained. Thus, a high-purity, linear double-stranded DNA molecule is obtained, which is referred to as the "gRNA in vitro transcription template". One end of this template contains the promoter sequence of T7 transcription enzyme (introduced by the primer), and the subsequent part contains the complete sequence information required for the final sgRNA.
[0046] The use of specific primer sequences (SEQ ID No. 2 and No. 3) in this step ensures the accuracy of the amplified DNA template sequence, which is crucial for the subsequent synthesis of functional sgRNA. PCR technology can quickly and massively prepare the required DNA template, providing sufficient raw materials for the subsequent mass production of sgRNA. The purification step ensures the quality of the template, which is beneficial to improve the efficiency of the next step of transcription and the purity of the product.
[0047] This step can be achieved by standard molecular biology experimental techniques. For example, a PCR reaction system can be prepared according to a specific formula, and the corresponding amplification program (such as denaturation at 94°C, annealing at 60°C, extension at 72°C, and cycling 30 times) can be set on a PCR instrument. The purification and recovery of PCR products can use commercially available detection products, such as the use of adsorption columns for purifying DNA through the steps of equilibration, binding, rinsing and elution mentioned in the document.
[0048] Step S4, in vitro transcribing the gRNA in vitro transcription template with T7 transcription enzyme to obtain the purified gRNA.
[0049] This step provides the process of synthesizing the final product sgRNA in vitro using the DNA template prepared in the previous step. This process simulates the transcription process in cells, using a biological catalyst called "T7 transcription enzyme". This enzyme can recognize a specific promoter sequence on the DNA template and start synthesizing an RNA chain corresponding to the sequence of the DNA template, i.e., sgRNA. Finally, the synthesized sgRNA is purified to obtain the final product.
[0050] Specifically, the DNA template obtained in the previous step, T7 transcription enzyme, and four ribonucleotides (A, U, C, G) required for RNA synthesis are mixed in a suitable buffer and reacted at a specific temperature (e.g., 37°C). After the reaction is complete, a specific method is used to remove the residual DNA template, unreacted nucleotides, and T7 transcription enzyme, etc., leaving only the synthesized sgRNA product. Thus, the final product is a high-purity, biologically active sgRNA molecule with a sequence defined by SEQ ID NO. 1, which can be directly used in subsequent microinjection experiments.
[0051] The T7 transcription enzyme system is a very efficient in vitro transcription system that can synthesize a large amount of RNA in a short time to meet experimental needs. The in vitro synthesis and purification process can ensure that the obtained sgRNA is high in purity and complete in structure, which is crucial for ensuring the stability and effectiveness of its biological function in fertilized eggs.
[0052] This step can be completed using commercial in vitro transcription detection products. For example, the DNA template, reaction buffer, nucleotide mixture, and T7 RNA polymerase can be mixed and incubated at 37°C for 1 hour. After transcription is complete, the document also mentions using DNase I enzyme to digest the residual DNA template and using a purification column to obtain the final sgRNA product.
[0053] In some embodiments, the step S2, the fertilized eggs injected are cultured, screened and obtained retsat.2 The mutation of the gene sequence causes retsat.2 The protein coding is destroyed, and the grass carp is obtained retsat.2 The grass carp with deletion mutation is used as the grass carp model, which comprises: Step S21, the embryo genome obtained by culturing the fertilized eggs is extracted, and PCR amplification is performed using the forward primer shown in SEQ ID No. 5 and the reverse primer shown in SEQ ID No. 6, to obtain an amplification product.
[0054] This step is the first step of gene mutation screening, namely the preliminary detection at the molecular level. The core is to obtain the entire genetic material (genome) of the cultured early embryos, and then use PCR technology to massively copy only the small piece of DNA region containing retsat.2 the gene editing target. Here, two specific primers, SEQ ID No. 5 and SEQ ID No. 6, are used to ensure that only the target region is copied.
[0055] Specifically, the grass carp embryos cultured for 24 hours are treated, the cells are lysed, and the genomic DNA is purified. The extracted genomic DNA is used as a template, and the reaction system containing the primers of SEQ ID No. 5 and SEQ ID No. 6 is added, and the amplification reaction is carried out on the PCR instrument. A large number of pure DNA fragments called "amplification products" are obtained. The sequence of these DNA fragments is retsat.2 the region in the gene attacked by the CRISPR / Cas9 system.
[0056] Detecting in the early stage of embryo development can quickly determine whether the gene editing operation is initially successful, avoiding the waste of a large amount of time and resources to raise individuals that do not have mutations. The use of this pair of specially designed primers, SEQ ID No. 5 and SEQ ID No. 6, ensures that only the target region of the retsat.2 gene is amplified, making the subsequent analysis accurate and reliable.
[0057] Step S22, sequencing the amplification product, and screening out the embryos whose sequencing results show chaotic peaks near the target point.
[0058] This step is to analyze and interpret the "amplification product" obtained in the previous step. The specific base sequence of the amplified DNA fragment is read through sequencing technology, and whether there is a mutation is judged according to the characteristics of the sequencing map. The screening standard here is "chaotic peaks". The PCR amplification product obtained in the previous step is sent for DNA sequencing (such as Sanger sequencing). The analyst will check the peak chart returned by the sequencing. According to the sequencing peak chart, a batch of embryos are screened out. The sequencing chart of these selected embryos is no longer a clear, single signal peak after the gene editing target point, but a chaotic, overlapping "chaotic peak".
[0059] "Ran Peak" is a very typical feature of CRISPR / Cas9 gene knockout in F0 (first generation). Because the insertion or deletion mutations generated by gene editing in each cell can not be exactly the same, resulting in a mixed, shifted sequence library when sequencing, thus forming "Ran Peak". Therefore, it is a quick and reliable indicator to determine whether gene editing has occurred. Through this clear feature, positive embryos with successful editing can be efficiently selected from a large number of samples for further culture.
[0060] For example, assuming the normal sequence of the retsat.2 gene is...ATGGCT..., the sequencing peak chart will show clear A (green), T (red), G (black), G (black), C (blue), T (red) peaks in turn. If gene editing occurs, there can be multiple mutations such as...AT-GCT... (deletion of G) and...ATG-CT... (deletion of G), and from the position where the mutation occurs, the sequence read by the sequencer will be misaligned and mixed, resulting in subsequent peak charts becoming disorganized and unable to be clearly distinguished, which is "Ran Peak".
[0061] In some embodiments, the step of sequencing the amplification product uses a reverse primer as shown in SEQ ID No. 6 as a sequencing primer. The nucleotide sequence of SEQ ID No. 6 is (5'~3'): CTGGGAAGCACTTCTTCAGT.
[0062] Step S23, the selected embryos are fed, and after they grow, their tail fins are cut off for genome extraction and sequencing, and are again selected to obtain grass carp with retsat.2 deletion mutations.
[0063] This step is the final confirmation at the individual level. The "positive" embryos selected in the early stage are continued to be fed to grow into fish. Then, these grown individuals are subjected to a second, more accurate genetic verification to finally confirm the grass carp with stable genetic retsat.2 gene mutations.
[0064] The embryos showing "Ran Peak" are placed in a feeding system, and suitable conditions are provided for their growth and development. When the fish grow to a certain size (for example, at 1 year old), a small amount of tissue is cut from their tail fins, and the operations of the first and second steps are repeated, i.e., genome extraction, PCR amplification and sequencing. Finally, one or more grass carps carrying retsat.2 gene function deletion mutations are obtained.
[0065] The detection results of the embryonic stage may have chimerism, and by re-detecting the tissues of the adult fish, it can be confirmed whether the gene mutation is stably present in the somatic cells of the fish, which is the gold standard for judging whether a gene mutation model is successfully constructed. The grass carp obtained in this step is the founder of the entire mutant strain, which is the basis for subsequent breeding and genetic research, ensuring that the mutant traits can be stably inherited to the offspring.
[0066] In the embodiments of the present application, a grass carp n-3 polyunsaturated fatty acid synthesis surplus model is provided, which is prepared by the construction method of the grass carp n-3 polyunsaturated fatty acid synthesis surplus model according to any one of the preceding embodiments.
[0067] The grass carp provided in the embodiments is not described in terms of physical or genetic characteristics, but its "origin" is limited: it is prepared through a series of precise genetic engineering steps described in the preceding embodiments, including the use of specific sgRNA, microinjection, and screening and confirmation by specific molecular biology methods.
[0068] In the embodiments of the present application, a detection method for grass carp is provided, comprising: Step S100, performing PCR reaction with the tail fin genome of the grass carp as a template.
[0069] Step S200, performing PCR reaction with the forward primer shown as SEQ ID No. 5 and the reverse primer shown as SEQ ID No. 6 to obtain a PCR reaction product; Step S300, sequencing the PCR reaction product with the reverse primer shown as SEQ ID No. 6 to determine whether the gene has a mutation according to the sequencing result. retsat.2
[0070] The method provided in the embodiments is a molecular detection method for identifying whether the grass carp carries a mutation in the retsat.2 gene. This method provides a complete operating procedure for how to determine whether the gene of a grass carp (specifically, a fish obtained by the method in the preceding embodiments) is successfully edited through a series of precise experimental steps. Specifically, it can include: (1) Obtain a small amount of tissue from the tail fin of the grass carp to be detected, and extract complete genomic DNA therefrom as a template for subsequent PCR reaction.
[0071] (2) Perform PCR reaction using a pair of specific primers (SEQ ID No. 5 and No. 6) to copy a large amount of DNA region containing the retsat.2 gene editing site to obtain a PCR reaction product.
[0072] (3) Using one of the primers (SEQ ID No. 6) as a sequencing primer, the PCR product obtained in the previous step is subjected to DNA sequencing to read its base sequence.
[0073] Thus, a precise DNA sequence information is obtained through the above process. By analyzing this sequence, a clear conclusion can be given that the retsat.2 gene of the grass carp is mutated.
[0074] The specific data analysis method can be: (1) The gene sequence of the grass carp to be tested obtained by the method is compared with the standard sequence of the wild-type (unedited) grass carp retsat.2 gene. retsat.2
[0075] (2) If the sequence to be tested has a deletion, insertion or substitution of bases compared with the standard sequence near the target site (i.e. the position of the sequence of SEQ ID No. 4), it is determined that the retsat.2 gene is mutated.
[0076] (3) If the sequence to be tested is identical to the standard sequence, it is determined that the retsat.2 gene is not mutated.
[0077] The method combines specific primer PCR and gold standard DNA sequencing technology, and the result is accurate and reliable, which can accurately determine the change of a single base. The use of primers SEQ ID No. 5 and No. 6 ensures that the only object of detection is the target region of the retsat.2 gene, without interference from other genes. The use of the tail fin as a detection sample has no effect on the survival and health of the grass carp, and is convenient for screening and identification of living organisms.
[0078] The application provides a detection product comprising a forward primer sequence as shown in SEQ ID No. 5 and a reverse primer sequence as shown in SEQ ID No. 6.
[0079] The above detection product may, for example, include but is not limited to a detection kit, a detection device, etc. for implementing the foregoing detection method.
[0080] The application provides an application of the sgRNA as described in the foregoing embodiments in constructing a grass carp retsat.2 mutant model.
[0081] The application will be further described in detail through specific examples, but it should be understood that these examples are only for more detailed description and should not be understood as limiting the application in any form.
[0082] Example 1 In this embodiment, a gRNA is obtained.
[0083] Experimental method: 1. According to the principle of CRISPR / Cas9 knockout, design and synthesize sgRNA sequence containing gene target site sequence, wherein retsat.2 the gene target site is as shown in retsat.2 Preferably, the target sequence of the gRNA is located on the 2nd exon of the gene, and the site sequence is the nucleotide sequence as shown in SEQ ID No. 4, SEQ ID No. 4: 5'- GTGGTAGGCAGTGGGATTGGTGG -3'. retsat.2 Figure 1
[0084] 2. Synthesize PCR primers for constructing synthetic sgRNA template, and the synthesized primer sequence includes the forward primer sequence as shown in SEQ ID No. 2 and the reverse primer sequence as shown in SEQ ID No. 3; SEQ ID No. 2: 5'- TGTAATACGACTCACTATAGTGGTAGGCAGTGGGATTGGGTTTTAGAGCTAGAAAT -3'; SEQ ID No. 3: 5'- AGCACCGACTCGGTGCCACTTTTTC -3'.
[0085] 3. Use the primers synthesized in the S2 step to perform PCR with pMD19T-gRNA as the template for the PCR reaction, purify and recover the PCR product, and prepare the gRNA in vitro transcription template; PCR amplification is performed according to the following reaction system to obtain the gRNA template: Table 1, reaction system
[0086] Prepare 200 μL system, and the PCR program is as follows: 94ºC 5min; 94ºC 30s; 60ºC 30s; 72ºC 30s, 30 cycles; 72ºC 10min.
[0087] The PCR product purification and recovery step is as follows: (1) Column equilibration step: add 500 μL of equilibration liquid BL to the adsorption column CB2 (the adsorption column is placed in the collection tube), centrifuge at 12,000 rpm (~ 13,400 x g) for 1 min, discard the waste liquid in the collection tube, and place the adsorption column CB2 back into the collection tube.
[0088] (2) Estimate the volume of the PCR reaction or enzyme digestion reaction, and add 5 times the volume of the binding solution PB to it, and mix thoroughly.
[0089] (3) Add the solution obtained in the previous step to an adsorption column CB2 (the adsorption column is placed in a collection tube), and stand at room temperature for 2 min, and centrifuge at 12,000 rpm (~ 13,400 x g) for 30-60 sec, and discard the waste liquid in the collection tube, and place the adsorption column CB2 in the collection tube.
[0090] (4) Add 600 μL of the rinse solution PW (check whether anhydrous ethanol has been added before use) to the adsorption column CB2, and centrifuge at 12,000 rpm (~ 13,400 x g) for 30-60 sec, and discard the waste liquid in the collection tube, and place the adsorption column CB2 in the collection tube.
[0091] (5) Repeat the operation step (4).
[0092] (6) Place the adsorption column CB2 back into the collection tube, and centrifuge at 12,000 rpm (~ 13,400 x g) for 2 min to remove as much of the rinse solution as possible. Place the adsorption column CB2 at room temperature for a few minutes, and dry it thoroughly to prevent the residual rinse solution from affecting the next step.
[0093] (7) Place the adsorption column CB2 into a clean centrifuge tube, and add 30-50 μL of the elution buffer EB to the middle of the adsorption membrane, and stand at room temperature for 2 min. Centrifuge at 12,000 rpm (~ 13,400 x g) for 2 min to collect the DNA solution.
[0094] 4. The gRNA in vitro transcription template prepared in the S3 step is subjected to in vitro transcription using a T7 transcription enzyme, and the gRNA is obtained by purification and recovery.
[0095] The gRNA is obtained by T7 RNA transcription enzyme in vitro transcription, and the components are added and mixed as follows: Table 2, reaction system
[0096] After 1 hour of reaction at 37ºC, the synthesized gRNA is purified, and the specific steps are as follows: (1) DNase I treatment: add 2.5 μL of 10X buffer and 2 μL of DNase I, and react at 37ºC for 15 min to remove the DNA template; (2) Purify the gRNA using a SigmaSpin TM Sequencing reaction clean-up kit: Place the purification column in a 2 mL collection tube, and centrifuge at 2800 rpm for 15 s; (3) Twist off the bottom seal of the column, throw away the column cap, and place the column back into the collection tube. Centrifuge at 2800 rpm for 2 min; (4) Place the column into a new RNase-free EP tube and discard the collection tube. (5) Add the gRNA synthesis solution into the column, centrifuge at 2800 rpm for 4 min. (6) Collect the flow-through, and store at -80ºC after electrophoresis detection and concentration determination.
[0097] Example 2 In this example, synthesis of Cas9 mRNA was performed.
[0098] Experimental Methods: 1. Linearize the plasmid containing the full-length sequence of Cas9 with restriction enzyme Notl, and purify the product using GeneJET PCR Purification Kit for use as a transcription template.
[0099] The steps for purifying and recovering the PCR product are as follows: (1) Column equilibration step: Add 500 μL of equilibration buffer BL to the adsorption column CB2 (the adsorption column is placed in the collection tube), centrifuge at 12,000 rpm (~ 13,400 x g) for 1 min, discard the waste liquid in the collection tube, and place the adsorption column CB2 back into the collection tube.
[0100] (2) Estimate the volume of the PCR reaction solution or enzyme digestion reaction solution, and add 5 times the volume of binding buffer PB to it and mix well.
[0101] (3) Add the solution obtained in the previous step to an adsorption column CB2 (the adsorption column is placed in the collection tube), and let it stand at room temperature for 2 min, centrifuge at 12,000 rpm (~ 13,400 x g) for 30-60 sec, discard the waste liquid in the collection tube, and place the adsorption column CB2 into the collection tube.
[0102] (4) Add 600 μL of rinse buffer PW (check whether anhydrous ethanol has been added before use) to the adsorption column CB2, centrifuge at 12,000 rpm (~ 13,400 x g) for 30-60 sec, discard the waste liquid in the collection tube, and place the adsorption column CB2 into the collection tube.
[0103] (5) Repeat step (4).
[0104] (6) Place the adsorption column CB2 back into the collection tube, centrifuge at 12,000 rpm (~ 13,400 x g) for 2 min, and try to remove as much of the rinse buffer as possible. Let the adsorption column CB2 stand at room temperature for a few minutes, and dry it completely to prevent residual rinse buffer from affecting the next step of the experiment.
[0105] (7) Put the adsorption column CB2 into a clean centrifuge tube, and add 30-50 μl of elution buffer EB to the middle of the adsorption membrane, and then place it at room temperature for 2 min. Centrifuge at 12,000 rpm (~ 13,400 x g) for 2 min to collect the DNA solution. Use the mMessage mMachine in vitro transcription kit of Ambion Company to synthesize mRNA in vitro retsat.2 mRNA.
[0106] The reaction system is as follows: Table 3, reaction system
[0107] After the reaction system is prepared, mix well, and incubate at 37°C for 2 hours.
[0108] 2. Purification and recovery of Cas9 mRNA are carried out according to the following steps: (1) Add 1 μL of DNA enzyme in the kit to the reaction system, mix well, and incubate at 37°C for 15 min; (2) Add 20 μL of 5M ammonium acetate, mix well, and place on ice for 10 min; (3) Centrifuge at 4°C and 12,000 rpm for 15 min, and the white precipitate is the mRNA; (4) Discard the supernatant, wash the precipitate with 75% ethanol, and centrifuge at 4°C and 7,500 rpm for 5 min; (5) Discard the supernatant, dry the precipitate, and dissolve the precipitate with 10 μL of enzyme-free water; (6) Dilute 0.5 μL of RNA by 20 times, detect the concentration and purity, and then take 10 μL of the dilution liquid for agarose gel electrophoresis to detect the degradation degree.
[0109] Example 3 In this example, grass carp with edited resat.2 gene is constructed and screened.
[0110] Experimental method: 1. Mix the gRNA and Cas9 mRNA obtained in the S4 step, and then microinject them into single-cell stage grass carp zygotes, 1 nL per embryo.
[0111] 2. After the gRNA and Cas9 mRNA are synthesized, the injection sample is prepared according to the following system, and the 3 μL injection system is as follows: Table 4, injection system
[0112] Among them, the number of single-cell stage grass carp zygote embryos injected is 200-500.
[0113] 3. After injection, the embryos were cultured for 24 hours, and part of the single-cell stage embryos after microinjection were collected to extract the genome, amplify the target sequence containing the target site by PCR, and sequence; PCR amplification of the target sequence containing the target site was performed according to the following reaction system: Table 5, injection system
[0114] The PCR program was as follows: 94ºC 5min; 94ºC 30s; 60ºC 30s; 72ºC 30s, 35 cycles; 72ºC 10min.
[0115] The primer sequence used for sequencing includes the forward primer sequence of SEQ ID No. 5 and the reverse primer sequence of SEQ ID No. 6: SEQ ID No. 5: 5'-CCCCTTGCATCTCCGTAT-3'; SEQ ID No. 6: 5'-CTGGGAAGCACTTCTTCAGT-3'; In addition, the primer of SEQ ID No. 6 is also a primer for Sanger DNA sequencing.
[0116] 4. The embryos of the injection batch showing random peaks near the target site were put into the feeding system, and were fed to 1 year old, and the tail fins were cut again for screening by the above-mentioned PCR and sequencing method to detect the effective mutation type grass carp, i.e. Cas9 Grass carp mutants.
[0117] Example 4 In this example, the function verification and phenotype analysis of the retsat.2 mutant grass carp were carried out.
[0118] Experimental method: 1. The tissues of wild-type grass carp were taken for retsat.2 gene expression analysis; As shown in retsat.2 , the expression in the liver was the highest, followed by the intestine, brain and heart. Figure 2 2. The liver of the gene mutant and wild-type grass carp in step 4 of Example 3 was taken for fatty acid component analysis;
[0119] As shown in retsat.2 , compared with the wild-type grass carp, the proportion of n-3 polyunsaturated fatty acid in the liver of the mutant grass carp constructed by the present example was significantly increased, and the ratio of n-3 to n-6 fatty acid was also significantly increased. retsat.2 Figure 3
[0120] 3. Take the sample from step 4 of Example 3. retsat.2 Fatty acid composition analysis of gene mutation and wild-type grass carp brain tissue; like retsat.2 As shown, compared to wild-type grass carp, the grass carp constructed using this embodiment... Figure 4 Mutant grass carp showed a significantly increased proportion of n-3 polyunsaturated fatty acids in their brain tissue, as well as a significantly increased ratio of n-3 to n-6 fatty acids.
[0121] 4. Take the sample from step 4 of Example 3. retsat.2 Fatty acid composition analysis was performed on the muscle of genetically mutated and wild-type grass carp.
[0122] like retsat.2 As shown, compared to wild-type grass carp, the grass carp constructed using this embodiment... Figure 5 Mutant grass carp exhibit a significantly increased proportion of n-3 polyunsaturated fatty acids in their muscle, as well as a significantly increased ratio of n-3 to n-6 fatty acids.
[0123] 5. By analyzing and summarizing the data obtained in steps 1-4 of this embodiment, a description is provided. retsat.2 retsat.2 The content of n-3 polyunsaturated fatty acids in the liver, brain and muscle tissue of grass carp with deletion mutation is significantly increased. Therefore, this embodiment provides a method for constructing a grass carp model with excess n-3 polyunsaturated fatty acid synthesis.
[0124] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some or all of the technical features therein. Such modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.
Claims
1. An sgRNA, characterized in that, The nucleotide sequence of the sgRNA is shown in SEQ ID NO.
1.
2. A primer sequence for constructing a template for synthesizing the sgRNA of claim 1, characterized in that, This includes a forward primer with a nucleotide sequence as shown in SEQ ID No. 2 and a reverse primer with a nucleotide sequence as shown in SEQ ID No.
3.
3. A method for constructing a grass carp n-3 polyunsaturated fatty acid synthesis surplus model, characterized in that, include: The sgRNA and the Cas9 mRNA shown in claim 1 are microinjected into grass carp monocyte period fertilized eggs; wherein the sgRNA targets the grass carp retsat.2 gene exon 2; Culturing the injected fertilized eggs, screening and obtaining retsat.2 Grass carp with retsat.2 protein coding disrupted by gene sequence mutation to obtain retsat.2 The grass carp with deletion mutation as the grass carp model Preferably, in the microinjection step, the number of single-cell stage grass carp fertilized egg embryos injected is 200 to 500; Preferably, the sequence of the target site targeted by the sgRNA is shown in SEQ ID No.
4.
4. The method for constructing the grass carp n-3 polyunsaturated fatty acid synthesis surplus model as described in claim 3, characterized in that, The method for obtaining the sgRNA includes: Using primer sequences, PCR was performed with pMD19T-gRNA as the template for the PCR reaction. The PCR product was purified and recovered, and the purified product was used as a template for in vitro transcription of gRNA. The primer sequences included a forward primer with a nucleotide sequence as shown in SEQ ID No. 2 and a reverse primer with a nucleotide sequence as shown in SEQ ID No.
3. The gRNA template was transcribed in vitro using T7 transcriptase to obtain the purified gRNA.
5. The method for constructing the grass carp n-3 polyunsaturated fatty acid synthesis surplus model as described in claim 3, characterized in that, The step of culturing the injected zygote, screening and obtaining retsat.2 The gene sequence is mutated to cause retsat.2 The protein coding of grass carp is destroyed to obtain retsat.2 The grass carp with deletion mutation is used as the grass carp model, comprising: The genome of the embryo obtained from the fertilized egg culture was extracted and PCR amplified using the forward primer shown in SEQ ID No. 5 and the reverse primer shown in SEQ ID No. 6 to obtain the amplification product; The amplified products were sequenced to screen out embryos whose sequencing results showed random peaks near the target site. The screened embryos are bred, and after their growth, their tail fins are cut for genome extraction and sequencing, and are screened again to obtain the retsat.2 Ctenopharyngodon idellus with deletion mutation.
6. The method for constructing the grass carp n-3 polyunsaturated fatty acid synthesis surplus model as described in claim 5, characterized in that, The step of sequencing the amplified product uses reverse primers as shown in SEQ ID No. 6 as sequencing primers.
7. A grass carp n-3 polyunsaturated fatty acid synthesis surplus model, characterized in that, It was prepared by the method for constructing the grass carp n-3 polyunsaturated fatty acid synthesis surplus model as described in any one of claims 3-6.
8. The method of claim 3, wherein the grass carp is detected by the method, characterized in that, include: PCR reaction was performed using the caudal fin genome of the grass carp as a template; PCR reaction was performed using the forward primer shown in SEQ ID No. 5 and the reverse primer shown in SEQ ID No. 6 to obtain the PCR reaction product; The PCR reaction product is sequenced using a reverse primer as shown in SEQ ID No. 6 to determine from the sequencing result retsat.2 whether the gene has a mutation.
9. A test product, characterized in that This includes the forward primer sequence shown in SEQ ID No. 5 and the reverse primer sequence shown in SEQ ID No.
6.
10. Use of the sgRNA of claim 1 in constructing a grass carp retsat.2 mutant model.