Method for synchronously synthesizing D-psicose from escherichia coli by using D-glucose / glycerol composite carbon source system
By constructing recombinant Escherichia coli Ec02 and Ec03, utilizing a D-glucose/glycerol complex carbon source system, overexpressing a specific gene and knocking out the pfkA gene, the problems of high production cost and low efficiency of D-allulose in existing technologies were solved, achieving efficient synthesis of D-allulose with a yield increased to 5.40 g/L.
Patent Information
- Application Number
- CN202511449079.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-10-11
- Publication Date
- 2025-11-07
- Estimated Expiration
- 2045-10-11
AI Technical Summary
Existing technologies for synthesizing D-allulose using Escherichia coli suffer from high production costs and low efficiency. In particular, D-allulose cannot be synthesized when there is insufficient accumulation of fructose-6-phosphate, and knocking out the phosphofructokinase gene affects the growth capacity of the strain and the product conversion rate.
Recombinant Escherichia coli Ec02 and Ec03 were used to construct a glycerol-based synthetic pathway by overexpressing a specific gene and knocking out the pfkA gene, combined with D-glucose and glycerol as a complex carbon source. D-allulose was synthesized simultaneously using the D-glucose/glycerol complex carbon source system.
The yield of D-allulose and the growth capacity of the strain were improved, the problems of growth inhibition and glucose effect were solved, and the efficient synthesis of D-allulose was achieved with a yield of 5.40 g/L.
Smart Images

Figure CN120905332A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application belongs to the field of synthetic biology, and particularly relates to a method for synthesizing D-allulose by using D-glucose / glycerol compound carbon source system in E. coli. BACKGROUND
[0002] D-allulose does not participate in human physiological metabolism due to its natural physical and chemical properties, and has multiple physiological functions such as reducing blood sugar and reducing blood lipids, and has been widely concerned in recent years. Due to the great attention of D-allulose in the food industry in recent years, how to reduce the cost and more efficiently produce D-allulose from the time efficiency has become the main concern of related enterprises, so it is of practical significance to develop a D-allulose production strategy with lower cost and higher efficiency.
[0003] Due to the advantages in production cost and production efficiency, in recent years, the catalytic pathway for de novo synthesis of D-allulose from glucose has gradually become a research hotspot. Compared with the traditional glucose isomerase (GI) and D-allulose 3-epimerase (DAEase) coupling method for synthesizing D-allulose, the in vivo phosphorylation synthesis method using glycolysis pathway has higher irreversibility and thermodynamic effect, which also makes it increasingly become a focus in the field of D-allulose synthesis. However, when the accumulation of fructose-6-phosphate is insufficient, D-allulose cannot be synthesized and the carbon metabolic flow generated by glycolysis preferentially flows into the TCA cycle to meet the basic growth needs of E. coli. Therefore, many scholars have knocked out the two pfkA gene and pfkB gene encoding phosphofructokinase (PFK) in E. coli to regulate the carbon metabolic flow, but the knockout of this enzyme inevitably affects the growth ability of the strain, ultimately leading to a decrease in the conversion rate of the product. SUMMARY
[0004] The technical problem to be solved by the present application is to provide a method for efficiently synthesizing D-allulose by using compound carbon source (D-glucose / glycerol) in view of the deficiencies of the prior art, which can improve the yield of D-allulose.
[0005] To solve the above technical problems, the technical solution of the present application is:
[0006] The method for synthesizing D-allulose by using D-glucose / glycerol compound carbon source system in E. coli according to the present application is characterized in that D-glucose / glycerol is used as a substrate, and is prepared by fermentation of recombinant E. coli; the recombinant E. coli is recombinant E. coli Ec02 and / or recombinant E. coli Ec03.
[0007] The recombinant E. coli Ec02 overexpresses pgi gene, glk gene, alse gene, a6pp gene, and overexpresses Mlc gene and glpk G913S gene, and knocks out pfkA gene;
[0008] The recombinant E. coli Ec03 overexpresses pgi gene, glk gene, alse gene, a6pp gene, and overexpresses Mlc gene and glpk G913S gene, and knocks out pfkA gene, and overexpresses aldO gene, rhaD gene and yqaB gene.
[0009] The recombinant E. coli Ec02 is constructed by the following method: taking E. coli BL21 (DE3) as a chassis host bacterium, overexpressing pgi gene, glk gene, alse gene, a6pp gene, and knocking out pfkA gene to obtain recombinant E. coli Ec01; on the basis of the recombinant E. coli Ec01, overexpressing Mlc gene and glpk G913S gene to obtain the recombinant E. coli Ec02.
[0010] The recombinant E. coli Ec03 is constructed by the following method: taking E. coli BL21 (DE3) as a chassis host bacterium, overexpressing pgi gene, glk gene, alse gene, a6pp gene, and knocking out pfkA gene to obtain recombinant E. coli Ec01; on the basis of the recombinant E. coli Ec01, overexpressing Mlc gene and glpk G913S gene to obtain the recombinant E. coli Ec02; on the basis of the recombinant E. coli Ec02, overexpressing aldO gene, rhaD gene and yqaB gene to obtain the recombinant E. coli Ec03.
[0011] The a6pp gene is derived from Bacteroides fragilis NCTC 9343; and the aldO gene is derived from Streptomyces coelicolor M145.
[0012] The fermentation uses IPTG as an inducer.
[0013] The fermentation conditions are as follows: the IPTG concentration is 0.1-0.5 mM; the concentration ratio of D-glucose to glycerol is (9~1): (1~9); and the fermentation time is 12-72 h.
[0014] The construction process of the recombinant E. coli Ec02 is specifically as follows:
[0015] The pgi gene and the glk gene are connected on the vector pCDFDuet-1 to obtain a recombinant plasmid pCDFDuet-pgi-glk; the a6pp gene and the alse gene are connected on the vector pETDuet-1 to obtain a recombinant plasmid pETDuet-a6pp-alse; the recombinant plasmids pCDFDuet-pgi-glk and pETDuet-a6pp-alse are transformed into E. coli BL21 (DE3), and the pfkA gene is knocked out by using the CRISPR / Cas9 technology to obtain a recombinant E. coli Ec01;
[0016] The Mlc gene and the glpK G913S gene are connected on the vector pRSFDuet-1 to obtain a recombinant plasmid pRSFDuet-Mlc-glpK G913S ; the recombinant plasmid pRSFDuet-Mlc-glpK G913S is transformed into the recombinant E. coli Ec01 to obtain a recombinant E. coli Ec02.
[0017] The construction process of the recombinant E. coli Ec03 is specifically as follows:
[0018] The aldO gene, the rhaD gene and the yqaB gene are connected on the vector PACYCDuet-1 to obtain a recombinant plasmid PACYCDuet-aldO-rhaD-yqaB; the recombinant plasmid PACYCDuet-aldO-rhaD-yqaB is transformed into the recombinant E. coli Ec02 to obtain the recombinant E. coli Ec03.
[0019] The fermentation is performed according to the following method: the recombinant E. coli Ec02 or the recombinant E. coli Ec03 is inoculated into an LB liquid culture medium to obtain a seed liquid; the seed liquid is inoculated into a fermentation liquid to perform fermentation; wherein the inoculation amount of the recombinant E. coli Ec02 or the recombinant E. coli Ec03 into the fermentation liquid is 1%; the LB liquid culture medium is prepared according to the following formula: 5 g / L yeast extract, 10 g / L peptone, 10 g / L sodium chloride.
[0020] The fermentation liquid adopts different formulas for different strains, wherein: the corresponding fermentation liquid of the recombinant E. coli Ec02 is: a composite carbon source, 5.0 g / L yeast extract, 10.0 g / L peptone, 10.0 g / L sodium chloride, 15 g / L agar powder, 50 μg / mL ampicillin, 50 μg / mL streptomycin sulfate, 50 μg / mL kanamycin; the composite carbon source is D-glucose and glycerol, D-glucose 5 g / L, glycerol 4 g / L;
[0021] The corresponding fermentation broth of the recombinant E. coli Ec03 is: peptone 12 g / L, yeast extract 24 g / L, potassium dihydrogen phosphate 2.31 g / L, dipotassium hydrogen phosphate 12.54 g / L, complex carbon source 20-50 g / L, 50 μg / mL ampicillin, 50 μg / mL streptomycin sulfate, 50 μg / mL kanamycin, 50 μg / mL chloramphenicol; the complex carbon source is D-glucose and glycerol, and the ratio of D-glucose / glycerol is (9:1)-(1:9).
[0022] The beneficial effects of the present application are as follows:
[0023] The recombinant E. coli Ec02 enhances the utilization ability of glycerol and reduces the glucose effect on the basis of the recombinant E. coli Ec01, a D-glucose / glycerol co-utilization system is constructed, the strain growth ability is maintained by glycerol, D-allulose is synthesized efficiently by taking D-glucose as a substrate, the phenomenon of insufficient cell mass and too long lag phase caused by knocking out pfkA is avoided, and the final OD of the recombinant E. coli Ec02 is 2.34, which is higher than that of the recombinant E. coli Ec01 (1.54). 600 The final OD of the recombinant E. coli Ec02 is 2.34, which is higher than that of the recombinant E. coli Ec01 (1.54).
[0024] On the basis of the recombinant E. coli Ec02, the recombinant E. coli Ec03 for synthesizing D-allulose by aldol reaction with glycerol as a substrate is constructed, the aldol reaction for synthesizing D-allulose is successfully coupled with the complex carbon source utilization platform, a D-allulose synthesis system with D-glucose / glycerol as a substrate is constructed, the problems of growth inhibition of the recombinant E. coli and further alleviation of the glucose effect are solved, and the final D-allulose yield reaches 2.89 g / L, and the yield is increased to 5.40 g / L after optimization of the fermentation conditions. BRIEF DESCRIPTION OF DRAWINGS
[0025] Figure 1 The cell factory diagram for the E. coli described in the present application to synthesize D-allulose by using a D-glucose / glycerol complex carbon source system.
[0026] In the figure, glk: glucose kinase gene; pgi: 6-phosphogluconate isomerase gene; alse: D-allulose-6-phosphate epimerase gene; a6pp: D-allulose-6-phosphate-phosphatase gene; Mlc: transcriptional repressor gene; glpk G913S : glycerol kinase mutant gene; pfkA / pfkB: phosphofructokinase gene; aldO: sugar alcohol oxidase gene; rhaD: L-rhamnose-1-phosphate aldolase gene; yqaB: acid phosphatase gene.
[0027] Figure 2Construction scheme for pCDFDuet-pgi-glk.
[0028] Figure 3 Construction scheme for pETDuet-a6pp-alse.
[0029] Figure 4 Construction scheme for pRSFDuet-Mlc-glpK G913S Construction scheme.
[0030] Figure 5 Construction scheme for PACYCDuet-aldO-rhaD-yqaB. DETAILED DESCRIPTION
[0031] The present application will be further described in conjunction with specific examples. If not specifically indicated, the technical means used in the examples are conventional means known to those skilled in the art.
[0032] The raw materials and reagents used in the embodiments of the present application are conventional chemical reagents, which can be purchased through commercial channels. The LB liquid culture medium is prepared according to the following components: 5 g / L yeast extract, 10 g / L peptone, 10 g / L sodium chloride; the LB solid culture medium is prepared according to the following components: add agar powder (15 g / L) to the LB liquid culture medium to solidify it.
[0033] Figure 1 The cell factory diagram for the Escherichia coli to synthesize D-allulose by using D-glucose / glycerol composite carbon source system in the present application. Two D-allulose synthesis pathways are constructed in the present application: (1) taking Escherichia coli as the chassis host strain, overexpressing pgi gene and glk gene, combining alse gene and a6pp gene to construct the D-glucose substrate-based D-allulose synthesis pathway; (2) knocking out pfkA gene on the basis of the above, overexpressing Mlc gene and glpk G913S gene to construct a recombinant Escherichia coli that can grow by using glycerol; in addition, introducing aldO gene, and using rhaD gene and yqaB gene to construct a glycerol substrate-based D-allulose synthesis metabolic pathway, thereby realizing the D-glucose / glycerol composite carbon source system-based simultaneous synthesis of D-allulose.
[0034] Example 1
[0035] This example is an embodiment of recombinant Escherichia coli Ec01 construction and fermentation preparation of D-allulose, and the specific process is as follows:
[0036] Construction of recombinant plasmid pCDFDuet-pgi: the pgi gene in the wild type BL21(DE3) genome was used as a template, pgi-F: AGATATACATATGGCAGATCTCATGAAAAACATCAATCCAACGCAG was used as an upstream primer, and pgi-R: GGTTTCTTTACCAGACTCGAGTTAACCGCGCCACGCTTTATA was used as a downstream primer to perform PCR amplification, and then the obtained 1650 bp target gene fragment was directionally cloned into the plasmid pCDFDuet-1 treated with Xho I / Bgl II restriction endonuclease to obtain the recombinant plasmid pCDFDuet-pgi.
[0037] Construction of recombinant plasmid pCDFDuet-pgi-glk: the glk gene in the wild type BL21(DE3) genome was used as a template, glk-F: CCACAGCCAGGATCCGAATTCAATGAGCCTGACCACCGC was used as an upstream primer, and glk-R: GCATTATGCGGCCGCAAGCTTTTAACCACGCGCGCCC was used as a downstream primer to perform PCR amplification, and then the obtained 960 bp target gene fragment was directionally cloned into the plasmid pCDFDuet-pgi treated with BamH I / Not I restriction endonuclease to obtain the recombinant plasmid pCDFDuet-pgi-glk. The schematic diagram of the construction thereof is shown in Figure 2
[0038] Construction of recombinant plasmid pETDuet-alse: the alse gene in the wild type BL21(DE3) genome was used as a template, alse-F: AGATATACATATGGCAGATCTAATGCGTTACTTCAAAGAAGAAGTTG was used as an upstream primer, and alse-R: GGTTTCTTTACCAGACTCGAGTTAGATACCGAAAACGTGCCTAC was used as a downstream primer to perform PCR amplification, and then the obtained 696 bp target gene fragment was directionally cloned into the plasmid pETDuet-1 treated with BamH I / Hind III restriction endonuclease to obtain the recombinant plasmid pETDuet-alse.
[0039] Construction of recombinant plasmid pETDuet-a6pp-alse: Using a6pp-F: TCATCACCACAGCCAGGATCCGATGAAAATCTCCCCCTCGTTAATG as the upstream primer and a6pp-R: GCATTATGCGGCCGCAAGCTTTTATGCTGTTTTTGCATGAGGCT as the downstream primer, the a6pp gene from Bacteroides fragilis NCTC 9343 was used as the template to perform PCR amplification, and then the obtained 669 bp target gene fragment was directionally cloned into the plasmid pETDuet-alse treated by Xho I / Bgl II restriction endonuclease to obtain the recombinant plasmid pETDuet-a6pp-alse.
[0040] Transformation of recombinant plasmid pCDFDuet-pgi-glk and recombinant plasmid pETDuet-a6pp-alse: The recombinant plasmid pCDFDuet-pgi-glk and the recombinant plasmid pETDuet-a6pp-alse were co-transformed into E. coli BL21 (DE3) by using the chemical transformation method, and the schematic diagram of the construction is shown in Figure 3
[0041] Construction of recombinant E. coli Ec01: The pfkA gene of recombinant E. coli into which the recombinant plasmid pCDFDuet-pgi-glk and the recombinant plasmid pETDuet-a6pp-alse have been transferred was knocked out. First, specific primers were designed, and a 552 bp homologous fragment was amplified by upstream homologous arm primers pfkA-UP-F: GCATTTTGTGTATAAAATACCGCCATTTGG and pfkA-UP-R: CGATGATGTCGTGGTGAACCTTTGATGTCGTTGTCGATAGTGCCC, and a 514 bp homologous fragment was amplified by downstream primers pfkA-DOWN-F: GGTTCACCACGACATCATCGAC and pfkA-DOWN-R: TACAATTCGCGCGTTGGATCATATGAAA. Then, a knockout cassette was constructed, the pfkA gene was used as a template to design a knockout site, and the knockout site was integrated into the PTargetT plasmid by PTargetT-pfkA-1: GTATTTTATACACAAAATGCTGGCGAGCGGCATCTTATTTG and PTargetT-pfkA-2: GATCCAACGCGCGAATTGTAGTCGATTGGCTGAGCTCATGAAG. Finally, the two homologous fragments were seamlessly cloned into PTargetT to increase the success rate of subsequent knockout. The plasmid was introduced into the host bacteria containing the pCas9 plasmid by chemical transformation, and positive strains were screened by colony PCR after colony growth, to obtain recombinant E. coli Ec01.
[0042] The recombinant E. coli Ec01 and the recombinant E. coli before the pfkA gene was knocked out were cultured in the following manner.
[0043] Culturing conditions: LB solid medium (containing 50 μg / mL ampicillin and 50 μg / mL streptomycin sulfate) was used for static culture at 37°C to activate the recombinant E. coli plate. A single colony was inoculated into 5 mL of LB liquid medium containing double antibiotics, and cultured at 37°C and 220 rpm to the logarithmic growth phase to obtain a seed solution.
[0044] Fermentation: The seed solution was inoculated into 50 mL of fermentation liquid (5.0 g / L yeast extract, 10.0 g / L peptone, 10.0 g / L sodium chloride, D-glucose 10 g / L, 50 μg / mL ampicillin, 50 μg / mL streptomycin sulfate) at an inoculation amount of 1% (v / v), pH 7.0, and cultured under the same conditions to an OD 600When the OD reached 0.4 or above, IPTG was added to a final concentration of 0.1 mM to induce protein expression, and then the culture temperature was adjusted to 30C, and the culture was continuously shaken for 72 h, during which time samples were taken every 12 h and OD was measured 600 and product yield.
[0045] Fermentation product detection analysis: The detection of D-allulose, D-fructose and D-glucose in the reaction system used high performance liquid chromatography (HPLC; G1362A, Agilent Technologies Inc., China), the detector was 1260 RID (G1362A), the chromatographic column was Aminex HPX-87C, 300 mm x 7.8 mm, the column temperature was maintained at 80°C during the detection process, ultrapure water was used as the mobile phase, the flow rate was constant at 0.6 mL / min, and the injection volume was 20 μL.
[0046] Fermentation results: As shown in Table 1, the fermentation results of recombinant E. coli Ec01 were significantly improved, showing that recombinant E. coli Ec01 had obvious advantages in improving D-allulose yield compared to before the pfkA gene was knocked out. However, after the pfkA gene was knocked out, the OD 600 Significant changes began to occur after 60 h, and the OD 600 was significantly lower than that of the recombinant E. coli without the pfkA gene knocked out.
[0047] By the 72nd hour, the final yield of D-allulose in the fermentation product of recombinant E. coli Ec01 was 2.04 g / L, while the yield of D-allulose in the fermentation product of recombinant E. coli without the pfkA gene knocked out was 1.16 g / L; it can be seen that the knockout of the pfkA gene can effectively balance the synthesis of D-allulose; however, the knockout of the pfkA gene weakened the growth rate and final bacterial amount (final OD 600 of the production strain (the final OD 600 of the recombinant E. coli without the pfkA gene knocked out was 1.71).
[0048] Example 2
[0049] This example is an example of the construction and fermentation of recombinant E. coli Ec02 to prepare D-allulose, and the specific process of construction is as follows:
[0050] Construction of recombinant plasmid pRSFDuet-Mlc: Using the Mlc gene from the wild-type BL21(DE3) genome as a template, Mlc-F: CCACAGCCAGGATCCGAATTCAGTGGTTGCTGAAAACCAGCCTG as the upstream primer and Mlc-R: GACTTAAGCATTATGCGGCCGCAAGCTTTTAACCCTGCAACAGACGAATCAACAA as the downstream primer, the obtained 1221 bp target gene fragment was directionally cloned into plasmid pRSFDuet-1 treated with EcoR I / Hind III restriction endonuclease to obtain recombinant plasmid pRSFDuet-Mlc.
[0051] Recombinant plasmid pRSFDuet-Mlc-glpK G913S Construction: Using glpK from the wild-type BL21(DE3) genome G913S Using the gene as a template, glpK-F was employed: GAAGGAGATATACATATGGCAGATCTAATGACTGAAAAAAAATATATCGTTGCGCTCGA,glpK G913S -R: CACCGCACTTTCCAACGC and glpK G913S -F: GCGTTGGAAAGTGCGGTG, glpK-R: GCAGCGGTTTCTTTACCAGACTCGAGTTATTCGTCGTGTTCTTCCCACGC After PCR amplification using primers, the obtained 1608 bp target gene fragment was directionally cloned into the plasmid pRSFDuet-Mlc treated with Bgl I / Xho I restriction endonucleases, resulting in the recombinant plasmid pRSFDuet-Mlc-glpK. G913S The schematic diagram of its construction is as follows Figure 4 As shown.
[0052] Construction of recombinant Escherichia coli Ec02: The recombinant plasmid pRSFDuet-Mlc-glpK was constructed. G913S Recombinant Escherichia coli Ec01 was transformed into recombinant Escherichia coli Ec02 using a chemical transformation method.
[0053] Culture conditions: Recombinant *E. coli* were activated on plates by static incubation at 37°C using LB solid medium (containing 50 µg / mL ampicillin, 50 µg / mL streptomycin sulfate, and 50 µg / mL kanamycin). Single colonies were picked and inoculated into 5 mL of LB liquid medium (containing 50 µg / mL ampicillin, 50 µg / mL streptomycin sulfate, and 50 µg / mL kanamycin) and cultured at 37°C with shaking at 220 rpm until the logarithmic growth phase.
[0054] Fermentation: Transfer to 50 mL fermentation broth (D-glucose 5 g / L, glycerol 4 g / L, 10.0 g / L sodium chloride, 10.0 g / L peptone, 5.0 g / L yeast extract, 50 μg / mL ampicillin, 50 μg / mL streptomycin sulfate, 50 μg / mL kanamycin) at 1% (v / v) inoculation amount, pH 7.0, and maintain the same conditions until OD 600 0.4, add IPTG to a final concentration of 0.1 mM to induce protein expression, then adjust the culture temperature to 30°C, continue to shake culture for 72 h, and take samples every 12 h to measure OD 600 and product yield.
[0055] Fermentation results: As shown in Table 2, the recombinant E. coli Ec02 reached OD 600 2.34, while the glycerol consumption was 1.80 g / L, and the final D-allulose yield reached 1.22 g / L in the medium with 5 g / L D-glucose as the synthetic substrate. Its OD 600 and yield were higher than those of Example 1, and the results showed that the combination of moderate retention of key node genes and synergistic utilization of complex carbon sources could effectively coordinate the contradiction between microbial growth and product synthesis.
[0056] Example 3
[0057] This example is an example of constructing and fermenting recombinant E. coli Ec03 to prepare D-allulose, and the specific process is as follows:
[0058] Construction of recombinant plasmid PACYCDuet-aldO: Using the aldO gene derived from S. coelicolor M145 as a template, PCR amplification was performed using aldO-F: ATGCAAAACATTACCCAGTCCTGG and aldO-R: AGCATTATGCGGCCGCAAGCTTTTAGCCAGCCAGAACGCCAC primer pairs, and then the obtained 1257 bp was combined with the MCS1 region of the PACYCDuet vector to obtain the recombinant plasmid PACYCDuet-aldO.
[0059] Construction of recombinant plasmid PACYCDuet-aldO-rhaD-yqaB: The target genes were amplified from the wild-type BL21(DE3) genome using the primers rhaD-F: ATGCAAAACATTACCCAGTCCTGG, rhaD-R: GCTGCCGCCGCCTCCTTACAGCGCCAGCGCAC; yqaB-F: GGAGGCGGCGGCAGCATGTACGAGCGTTATGCAGG, yqaB-R: TCACAGCAAGCGAACATCCACG, and the two target genes were linked by a flexible linker GGGGS verified in the laboratory in an earlier stage to integrate them into the MCS2 region of the PACYCDuet-aldO recombinant vector, reduce the spacing of the downstream enzyme system, and improve the final transformation efficiency, to obtain the recombinant plasmid PACYCDuet-aldO-rhaD-yqaB, and the construction schematic is shown in Figure 5 .
[0060] Construction of recombinant Escherichia coli Ec03: The recombinant plasmid PACYCDuet-aldO-rhaD-yqaB was transformed into the recombinant Escherichia coli Ec02 using the chemical transformation method to obtain the recombinant Escherichia coli Ec03.
[0061] Culture conditions: LB solid medium (containing 50 μg / mL ampicillin, 50 μg / mL streptomycin sulfate, 50 μg / mL kanamycin, and 50 μg / mL chloramphenicol) was used for static culture at 37°C, and the recombinant Escherichia coli plate was activated. A single colony was inoculated into 5 mL of LB liquid medium (containing 50 μg / mL ampicillin, 50 μg / mL streptomycin sulfate, 50 μg / mL kanamycin, and 50 μg / mL chloramphenicol) and cultured at 37°C, 220 rpm for the logarithmic growth phase.
[0062] Inoculation was performed at a rate of 1% (v / v) into 50 mL of fermentation broth (containing peptone 12 g / L, yeast extract 24 g / L, potassium dihydrogen phosphate 2.31 g / L, dipotassium hydrogen phosphate 12.54 g / L, glycerol 10 g / L, and D-glucose 10 g / L, and containing 50 μg / mL ampicillin, 50 μg / mL streptomycin sulfate, 50 μg / mL kanamycin, and 50 μg / mL chloramphenicol), pH 7.0, and the same conditions were maintained for culture until the OD 600 was greater than 0.4, 0.1 mM IPTG was added to induce protein expression, and then the culture temperature was adjusted to 30°C, and the shaking culture was continued for 72 h, during which time samples were taken every 12 h, and the OD 600 and product yield were measured.
[0063] Fermentation results: As shown in Table 3, the yield of D-allulose was increased to 2.89 g / L, OD 600 8.2, and 0.92 g / L of D-sorbose was produced, and the glycerol consumption rate was also increased to a certain extent, compared with the yield before the introduction of the aldol reaction synthesis pathway.
[0064] Example 4
[0065] This example is to find the optimal fermentation conditions of the recombinant Escherichia coli Ec03 by optimizing and adjusting the fermentation conditions.
[0066] (1) Fermentation under a gradient of IPTG concentrations of 0.1-0.5 mM
[0067] Fermentation was carried out under a gradient of IPTG concentrations of 0.1-0.5 mM; LB solid medium (containing 50 μg / mL ampicillin, 50 μg / mL streptomycin sulfate, 50 μg / mL kanamycin, and 50 μg / mL chloramphenicol) was used for static culture at 37°C to activate the recombinant Escherichia coli plate. A single colony was inoculated into 5 mL of LB liquid medium (containing 50 μg / mL ampicillin; 50 μg / mL streptomycin sulfate; 50 μg / mL kanamycin; 50 μg / mL chloramphenicol) and cultured at 37°C with 220 rpm shaking until the logarithmic growth phase.
[0068] Inoculation was performed at a ratio of 1% (v / v) into 50 mL of fermentation broth (containing peptone 12 g / L, yeast extract 24 g / L, potassium dihydrogen phosphate 2.31 g / L, dipotassium hydrogen phosphate 12.54 g / L, glycerol 10 g / L, and D-glucose 10 g / L; containing 50 μg / mL ampicillin, 50 μg / mL streptomycin sulfate, 50 μg / mL kanamycin, and 50 μg / mL chloramphenicol), pH 7.0, and the same conditions were maintained for culture until OD 600 0.4, 0.1-0.5 mM of IPTG was added to induce protein expression, and then the culture temperature was adjusted to 30°C, and the shaking culture was continued for 72 h, during which time samples were taken every 12 h, and OD 600 and product yield were measured.
[0069] After the addition of IPTG, the yield of D-allulose changed, and the change was not linear, and the specific results are shown in Table 4. From Table 4, it can be seen that when the IPTG concentration is 0.1-0.5 mM, good results are shown; and when the IPTG concentration is 0.3 mM, the best results are shown.
[0070] (2) Fermentation under different OD 600 values when adding the inducer
[0071] OD at 0.3-1.1 600 LB solid medium (containing 50 μg / mL ampicillin, 50 μg / mL streptomycin sulfate, 50 μg / mL kanamycin, and 50 μg / mL chloramphenicol) was added with IPTG at a concentration of 0.5 mM, and the recombinant E. coli was activated by static culture at 37°C. A single colony was inoculated into 5 mL of LB liquid medium (containing 50 μg / mL ampicillin, 50 μg / mL streptomycin sulfate, 50 μg / mL kanamycin, and 50 μg / mL chloramphenicol) and cultured at 37°C with 220 rpm shaking until the logarithmic growth phase.
[0072] Inoculation was performed at a rate of 1% (v / v) into 50 mL of fermentation medium (containing peptone 12 g / L, yeast extract 24 g / L, potassium dihydrogen phosphate 2.31 g / L, dipotassium hydrogen phosphate 12.54 g / L, glycerol 10 g / L, and D-glucose 10 g / L; and containing 50 μg / mL ampicillin, 50 μg / mL streptomycin sulfate, 50 μg / mL kanamycin, and 50 μg / mL chloramphenicol) at pH 7.0, and the same conditions were maintained until the OD 600 IPTG was added at a final concentration of 0.5 mM to induce protein expression, and then the culture temperature was adjusted to 30°C, and the culture was continued for 72 h with continuous shaking, during which sampling was performed every 12 h, and the OD 600 and product yield were measured.
[0073] Different initial OD 600 D-allulose and final OD 600 As shown in Table 5. It can be seen that when the inducer IPTG was added, the initial OD 600 all showed good effects; the initial OD 600 was 0.5-0.9, but when the initial OD 600 was greater than 0.9, the effect decreased.
[0074] (3) Change in D-allulose and OD 600 at the optimal combination of fermentation conditions
[0075] OD 600LB solid medium (containing 50 μg / mL ampicillin, 50 μg / mL streptomycin sulfate, 50 μg / mL kanamycin, and 50 μg / mL chloramphenicol) at 37°C. Single colonies were inoculated into 5 mL of LB liquid medium (containing 50 μg / mL ampicillin, 50 μg / mL streptomycin sulfate, 50 μg / mL kanamycin, and 50 μg / mL chloramphenicol) and incubated at 37°C, 220 rpm until the logarithmic growth phase.
[0076] Inoculation was performed at a 1% (v / v) ratio into 50 mL of fermentation medium (containing peptone 12 g / L, yeast extract 24 g / L, potassium dihydrogen phosphate 2.31 g / L, dipotassium hydrogen phosphate 12.54 g / L, glycerol 10 g / L, and D-glucose 10 g / L; and containing 50 μg / mL ampicillin, 50 μg / mL streptomycin sulfate, 50 μg / mL kanamycin, and 50 μg / mL chloramphenicol), pH 7.0, and incubation was continued under the same conditions until OD 600 0.7 was reached, and 0.3 mM IPTG was added to induce protein expression, after which the incubation temperature was adjusted to 30°C, and the incubation was continued for 72 h with continuous shaking, during which sampling was performed every 12 h, and OD 600 and product yield were measured.
[0077] The results are shown in Table 6. When 0.3 mM IPTG was added at OD 600 0.7 to induce fermentation for 72 h, the final D-allulose yield was increased to 3.46 g / L, and the final OD 600 was increased to 9.2. The results confirmed that the optimized culture conditions were very significant for cell mass and yield improvement.
[0078] (4) Changes in different D-glucose and glycerol ratios
[0079] Fermentation was performed using a total of 20 g / L carbon source as the substrate, with D-glucose and glycerol concentrations of 9:1, 4:1, 3:2, 1:1, 2:3, 1:4, and 1:9. LB solid medium (containing 50 μg / mL ampicillin, 50 μg / mL streptomycin sulfate, 50 μg / mL kanamycin, and 50 μg / mL chloramphenicol) was used for incubation at 37°C. Single colonies were inoculated into 5 mL of LB liquid medium (containing 50 μg / mL ampicillin, 50 μg / mL streptomycin sulfate, 50 μg / mL kanamycin, and 50 μg / mL chloramphenicol) and incubated at 37°C, 220 rpm until the logarithmic growth phase.
[0080] Inoculate 1% (v / v) into 50 mL of fermentation broth (containing peptone 12 g / L, yeast extract 24 g / L, potassium dihydrogen phosphate 2.31 g / L, dipotassium hydrogen phosphate 12.54 g / L, and different proportions of D-glucose and glycerol totaling 20 g / L carbon source; and containing 50 μg / mL ampicillin, 50 μg / mL streptomycin sulfate, 50 μg / mL kanamycin, and 50 μg / mL chloramphenicol), pH 7.0, and maintain the same conditions to culture to OD 600 0.7, add IPTG to induce protein expression at a final concentration of 0.3 mM, then adjust the culture temperature to 30°C, continue to shake culture for 72 h, during which time sample every 12 h, and measure OD 600 and product yield.
[0081] The fermentation results are shown in Table 7.
[0082] After optimization, when the D-glucose:glycerol ratio is 1:1, add 0.3 mM IPTG at OD 600 0.7 to induce, the final D-allulose yield is 3.46 g / L, and the final OD 600 is increased to 9.2; under the condition of a total carbon source of 20 g / L, the D-glucose and glycerol ratio is adjusted in a gradient (9:1-1:9), and finally the fermentation effect is optimal in a composite carbon source with a D-glucose:glycerol ratio of 4:1 (16 g / L D-glucose+4 g / L glycerol): D-allulose yield of 3.92 g / L, OD 600 is increased to 10.4.
[0083] (5) Changes under different total carbon source concentrations
[0084] Using a total of 30-50 g / L carbon source as the substrate, the D-glucose and glycerol concentration is 4:1 for fermentation production; use LB solid medium (containing 50 μg / mL ampicillin, 50 μg / mL streptomycin sulfate, 50 μg / mL kanamycin, and 50 μg / mL chloramphenicol) to culture at 37°C to activate the recombinant E. coli plate. Pick a single colony and inoculate into 5 mL of LB liquid medium (containing 50 μg / mL ampicillin, 50 μg / mL streptomycin sulfate, 50 μg / mL kanamycin, and 50 μg / mL chloramphenicol), and culture at 37°C, 220 rpm shaking to the logarithmic growth phase.
[0085] Inoculated at 1% (v / v) into 50 mL of fermentation broth (containing peptone 12 g / L, yeast extract 24 g / L, potassium dihydrogen phosphate 2.31 g / L, dipotassium hydrogen phosphate 12.54 g / L, and 30-50 g / L of carbon source with a ratio of D-glucose and glycerol of 4:1, and containing 50 μg / mL ampicillin, 50 μg / mL streptomycin sulfate, 50 μg / mL kanamycin, and 50 μg / mL chloramphenicol), pH 7.0, and cultured under the same conditions until OD 600 0.7, 0.3 mM IPTG was added to induce protein expression, and then the culture temperature was adjusted to 30°C, and the culture was continued for 72 h with shaking, during which time samples were taken every 12 h, and the product yield was measured.
[0086] The fermentation results are shown in Table 8.
[0087] Using 30-50 g / L of carbon source (D-glucose:glycerol ratio of 4:1) as the substrate, and using OD 600 0.7, 0.3 mM IPTG was added to induce protein expression, and then the culture temperature was adjusted to 30°C, and the culture was continued for 72 h with shaking, during which time samples were taken every 12 h, and the product yield was measured.
[0088] Table 1 Change in D-allulose and OD 600 at different times for recombinant E. coli before and after knocking out pfkA
[0089]
[0090] Table 2 Change in D-allulose and OD 600 at different times for recombinant E. coli Ec02 when fermenting D-glucose / glycerol
[0091]
[0092] Table 3 Change in D-allulose and OD 600 at different times for recombinant E. coli Ec03 when fermenting D-glucose / glycerol
[0093]
[0094] Table 4 Change in D-allulose and OD 600 at different times for recombinant E. coli Ec03 when induced by IPTG
[0095]
[0096] Table 5 Change in D-allulose and OD 600 at different OD 600 for recombinant E. coli Ec03 when adding an inducer
[0097]
[0098] Table 6 Change of D-allulose and OD under the best combination of fermentation conditions 600
[0099]
[0100] Table 7 Change of D-allulose and OD under different D-glucose and glycerol ratios 600
[0101]
[0102] Table 8 Change of D-allulose under 30-50 g / L total carbon source concentration
[0103]
[0104] The present application is based on metabolic engineering of E. coli glycolytic pathway, partial knockout of phosphofructokinase pfkA gene to regulate carbon metabolic flow distribution, and construction of D-glucose / glycerol co-utilization system to optimize D-allulose synthesis capacity. In Example 1, the recombinant E. coli Ec01 with pfkA gene knocked out has a D-allulose yield of 2.04 g / L in 10 g / L D-glucose fermentation, but the OD 600 is only 1.54, while the OD 600 of the recombinant E. coli without pfkA gene knocked out is 1.71. To further balance the growth and synthesis of the recombinant E. coli, glycerol is introduced as an auxiliary carbon source in Example 2, and Mlc-glpk G913S gene overexpression system is constructed to relieve glucose effect. In 5 g / L D-glucose and 4 g / L glycerol complex carbon source, the OD 600 of the recombinant E. coli Ec02 is increased to 2.34, the glycerol consumption is 1.80 g / L, and the D-allulose yield is increased to 1.22 g / L. The experiment proves that pfkA gene is a key node for regulating the distribution of fructose-6-phosphate, and its partial knockout combined with metabolic division strategy can effectively coordinate the growth and product synthesis of the bacteria, while the utilization of complex carbon source reduces acetic acid accumulation and maintains the function of TCA cycle, providing a new idea for efficient biosynthesis of D-allulose. In Example 3, by constructing a hydroxy aldehyde reaction synthesis system, D-allulose is synthesized from glycerol. In the recombinant E. coli Ec03, after 10 g / L glycerol is used as the substrate for fermentation for 72 h, the D-allulose yield is increased to 2.89 g / L, but due to the influence of glucose effect and plasmid metabolic burden, the OD 600 of the bacteria is decreased to 8.2 and the carbon source residue is significant. In Example 4, by optimizing the induction conditions, it is determined that the OD 600 The induction of 0.3 mM IPTG can balance the protein expression and the growth of the bacteria, and the yield of D-allulose is increased to 3.46 g / L. Further regulation of the carbon source ratio, when D-glucose:glycerol = 4:1, the OD 600 of the bacteria is 10.4, and the yield of D-allulose is 3.92 g / L. Finally, the concentration of the carbon source is increased, and when the total carbon source is 50 g / L, the yield of D-allulose is 5.40 g / L. The experiment proves that the synergistic effect of the aldol reaction pathway and the glycolysis pathway can effectively widen the carbon metabolic flow, and the dynamic regulation of the carbon source ratio can significantly alleviate the glucose effect and reduce the metabolic pressure, and this strategy provides a new reference for the synthesis of rare ketose.
[0105] The above only describes the preferred examples of the present application and does not limit the present application, and any modification, equivalent replacement and improvement made within the spirit and principle of the present application shall be included in the protection scope of the present application.
[0106] The principle of the present application is as follows:
[0107] The present application finally successfully constructs a D-allulose synthesis platform based on the glycolysis pathway and the aldol reaction by exploring the multi-module carbon metabolic engineering strategy with Escherichia coli as the chassis cell. First, a glycolysis pathway is constructed to synthesize D-allulose, realizing the synthesis of D-allulose through the glycolysis pathway with D-glucose as the carbon source. Then, the carbon metabolic flow distribution of the pathway is explored, and it is verified that the pfkA gene is the key carbon metabolic gene in the synthesis pathway. By knocking out the pfkA gene, the final conversion rate can be improved, but at the same time, the bacterial amount is further reduced. Further introduction of the glucose effect inhibitor (Mlc gene) and the glycerol kinase mutant (glpk G913S gene) realizes the metabolic division and synergistic utilization from a single carbon source (D-glucose) to a composite carbon source (D-glucose / glycerol), and the glycerol meets the demand of bacterial growth, and more D-glucose is directed to the synthesis of D-allulose. Then, a glycerol-based aldol reaction system is constructed to synthesize D-allulose, and after successfully synthesizing D-allulose and the byproduct D-sorbose, the system is combined with the composite carbon source utilization system, which widens the downstream glycerol utilization capacity and relieves the glucose effect, and increases the final yield of D-allulose. Finally, the fermentation conditions are optimized to obtain a higher yield of D-allulose under the condition of ensuring the bacterial amount.
Claims
1. A method for the simultaneous synthesis of D-allulose by Escherichia coli using a D-glucose / glycerol composite carbon source system, characterized by: D-glucose / glycerol as the substrate, by fermentation of recombinant Escherichia coli; the recombinant Escherichia coli is recombinant Escherichia coli Ec02 and / or recombinant Escherichia coli Ec03; The recombinant E. coli Ec02 overexpresses pgi gene, glk gene, alse gene and a6pp gene on the basis of E. coli BL21 (DE3), and overexpresses Mlc gene and glpk G913S gene, and knocks out pfkA gene; The recombinant E. coli Ec03 overexpresses pgi gene, glk gene, alse gene, a6pp gene, and overexpresses Mlc gene and glpk G913S gene, and the yqaB gene while knocking out the pfkA gene.
2. The method of synthesizing D-psicose according to claim 1, wherein: The recombinant E. coli Ec02 is constructed by the following method: taking E. coli BL21 (DE3) as a chassis host strain, overexpressing pgi gene, glk gene, alse gene, a6pp gene, knocking out pfkA gene to obtain recombinant E. coli Ec01; on the basis of the recombinant E. coli Ec01, overexpressing Mlc gene and glpk G913S gene to obtain the recombinant E. coli Ec02.
3. The method of synthesizing D-psicose according to claim 1, wherein: The recombinant E. coli Ec03 is constructed by the following method: taking E. coli BL21 (DE3) as a chassis host strain, overexpressing pgi gene, glk gene, alse gene, a6pp gene, knocking out pfkA gene to obtain recombinant E. coli Ec01; on the basis of the recombinant E. coli Ec01, overexpressing Mlc gene and glpk G913S gene to obtain recombinant E. coli Ec02; on the basis of the recombinant E. coli Ec02, overexpressing genes aldO gene, rhaD gene and yqaB gene to obtain recombinant E. coli Ec03.
4. The method of synthesizing D-psicose according to claim 1, wherein: The a6pp gene is derived from Bacteroides fragilis NCTC 9343; and the aldO gene is derived from Streptomyces coelicolor M145.
5. The method of synthesizing D-psicose according to claim 1, wherein: The fermentation uses IPTG as an inducer.
6. The method of synthesizing D-psicose according to claim 5, wherein: The fermentation conditions are as follows: the IPTG concentration is 0.1-0.5 mM; the D-glucose and glycerol concentration ratio is (9~1):(1~9); and the fermentation time is 12-72 h.
7. The method of synthesizing D-psicose according to claim 1, wherein: The construction process of the recombinant Escherichia coli Ec02 is as follows: The pgi gene and the glk gene are linked to the vector pCDFDuet-1 to obtain the recombinant plasmid pCDFDuet-pgi-glk; the a6pp gene and the alse gene are linked to the vector pETDuet-1 to obtain the recombinant plasmid pETDuet-a6pp-alse; the recombinant plasmids pCDFDuet-pgi-glk and pETDuet-a6pp-alse are transformed into Escherichia coli BL21 (DE3), and the pfkA gene is knocked out to obtain the recombinant Escherichia coli Ec01. The Mlc gene, glpK G913S gene was ligated to the vector pRSFDuet-1 to obtain the recombinant plasmid pRSFDuet-Mlc-glpK G913S ; The recombinant plasmid pRSFDuet-Mlc-glpK G913S was transformed into the recombinant E. coli Ec01 to obtain the recombinant E. coli Ec02.
8. The method of synthesizing D-psicose according to claim 1, wherein: The construction process of the recombinant Escherichia coli Ec03 is as follows: The aldO gene, the rhaD gene and the yqaB gene are linked to the vector PACYCDuet-1 to obtain the recombinant plasmid PACYCDuet-aldO-rhaD-yqaB; the recombinant plasmid PACYCDuet-aldO-rhaD-yqaB is transformed into the recombinant Escherichia coli Ec02 to obtain the recombinant Escherichia coli Ec03.
9. The method of synthesizing D-psicose according to claim 1, wherein: The fermentation is performed as follows: the recombinant Escherichia coli Ec02 or the recombinant Escherichia coli Ec03 is inoculated into LB liquid medium for culture to obtain a seed liquid; The seed liquid is inoculated into a fermentation liquid for fermentation; The inoculation amount of the recombinant Escherichia coli Ec02 or the recombinant Escherichia coli Ec03 into the fermentation liquid is 1%; and the LB liquid medium is prepared according to the following formula: 5 g / L yeast extract, 10 g / L peptone and 10 g / L sodium chloride.
10. The method of synthesizing D-psicose according to claim 9, wherein: Different formulations are used for different strains, wherein: the corresponding fermentation liquid for the recombinant Escherichia coli Ec02 is: a composite carbon source, 5.0 g / L yeast extract, 10.0 g / L peptone, 10.0 g / L sodium chloride, 15 g / L agar powder, 50 µg / mL ampicillin, 50 µg / mL streptomycin sulfate and 50 µg / mL kanamycin; and the composite carbon source is D-glucose and glycerol, with the D-glucose being 5 g / L and the glycerol being 4 g / L. The corresponding fermentation broth of recombinant E. coli Ec03 is: peptone 12 g / L, yeast extract 24 g / L, potassium dihydrogen phosphate 2.31 g / L, dipotassium hydrogen phosphate 12.54 g / L, complex carbon source 20-50 g / L, 50 μg / mL ampicillin, 50 μg / mL streptomycin sulfate, 50 μg / mL kanamycin, 50 μg / mL chloramphenicol; the complex carbon source is D-glucose and glycerol, and the ratio of D-glucose to glycerol is (9:1)-(1:9). The corresponding fermentation broth of recombinant E. coli Ec03 is: peptone 12 g / L, yeast extract 24 g / L, potassium dihydrogen phosphate 2.31 g / L, dipotassium hydrogen phosphate 12.54 g / L, complex carbon source 20-50 g / L, 50 μg / mL ampicillin, 50 μg / mL streptomycin sulfate, 50 μg / mL kanamycin, 50 μg / mL chloramphenicol; the complex carbon source is D-glucose and glycerol, and the ratio of D-glucose to glycerol is (9:1)-(1:9). The corresponding fermentation broth of recombinant E. coli Ec03 is: peptone 12 g / L, yeast extract 24 g / L, potassium dihydrogen phosphate 2.31 g / L, dipotassium hydrogen phosphate
Citation Information
Patent Citations
Method for biosynthesizing D-allose by utilizing D-glucose
CN112501224A
Whole-cell synthesis method of D-psicose by taking glycerol as substrate
CN114426994A
Method for efficiently synthesizing D-psicose by fermenting recombinant escherichia coli
CN115074376A
Method for efficiently co-producing D-psicose and gluconic acid
CN115976135A
Method for producing D-allose by using recombinant escherichia coli through glucose fermentation
CN118127097A