Marker for early colorectal neoplastic lesion diagnosis and application thereof

Abstract

The invention discloses a marker for early colorectal neoplastic lesion diagnosis and application, and belongs to the technical field of biological medicine. Aiming at the problems of low colonoscopy coincidence rate of colorectal cancer patients at present and limited sensitivity and specificity of existing biomarker diagnosis, LncRNA sequencing research is combined with expanded sample verification to obtain high-specificity and high-sensitivity LncRNA which is highly related to colorectal neoplastic lesions (including adenoma and colorectal cancer), the LncRNA is specifically LOC401585, and the LncRNA has the advantages of high specificity, high sensitivity, high specificity and high sensitivity and can be used for detecting colorectal neoplastic lesions (including adenoma and colorectal cancer). The diagnosis efficacy AUC of the LOC401585 on the adenoma and the colorectal cancer is 0.952 and 0.876 respectively. Therefore, the blood LOC401585 marker can be used for auxiliary diagnosis of colorectal neoplastic lesions, and provides data support for finding novel small molecule drugs with potential treatment value.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of biological medicine, in particular to a marker for early diagnosis of colorectal neoplastic lesions and application thereof. BACKGROUND

[0002] According to the latest global cancer statistics, colorectal cancer (CRC) is the third most common cancer worldwide and the second most common cause of death. In 2015, the number of new cases and deaths of colorectal cancer in China was 390,000 and 190,000, respectively. In addition, this figure will continue to rise in the coming years. A recent study showed that about 85% of CRCs may be transformed from adenomas. Among different types of adenomas, advanced adenomas have been proven to be a more obvious risk factor for CRC. Therefore, in clinical applications, early screening and diagnosis of colorectal neoplastic lesions, including adenomas and CRC, are crucial for subsequent treatment.

[0003] Colonoscopy is considered to be the gold standard for screening of colorectal neoplastic lesions. However, colonoscopy has drawbacks such as missed detection rate and incomplete coverage. In addition, in Chinese cities, the compliance rate of colonoscopy for high-risk groups of colorectal cancer is only about 15%. All these burdens interfere with the early screening and diagnosis of colorectal neoplastic lesions. Although some tumor markers have been found, such as carcinoembryonic antigen (CEA) and carbohydrate antigens (such as CA19-9, CA74-2, etc.), the sensitivity and specificity for the diagnosis of colorectal neoplastic lesions (including adenomas and CRC) are limited, especially in the discovery of early colorectal neoplastic lesions and the identification of invasive painless tumors. Therefore, more and more attention is paid to finding new markers with high specificity and good sensitivity at home and abroad, and it is urgent to establish a new simple and easy screening technology for colorectal neoplastic lesions that can improve the compliance rate.

[0004] Currently, there is no stable biomarker reported for the diagnosis of colorectal neoplastic lesions (including adenomas and CRC). If LncRNA abnormally expressed in colorectal neoplastic lesions (including adenomas and CRC) can be screened as a biomarker and corresponding diagnostic kits and therapeutic drugs are developed, it will strongly promote the screening, diagnosis and treatment of colorectal neoplastic lesions (including adenomas and CRC) in China. SUMMARY

[0005] In view of the above problems, the present application aims to provide a marker and application for early colorectal neoplastic lesion diagnosis, through LncRNA sequencing and sample expansion verification, a high specificity and sensitivity LncRNA highly related to colorectal neoplastic lesion (including adenoma and colorectal cancer) is obtained, which can be used as a marker for early colorectal neoplastic lesion diagnosis, the LncRNA is LOC401585, in addition, based on the amplification primer of LOC401585 and the RNA reverse transcription primer of LOC401585, a kit for early colorectal neoplastic lesion diagnosis is prepared, which provides data support for the screening and diagnosis of colorectal neoplastic lesion (including adenoma and colorectal cancer), and provides data support for discovering new small molecule drugs with potential therapeutic value.

[0006] In order to achieve the above-mentioned purpose, the technical scheme adopted by the present application is as follows: On the one hand, the present application provides the use of a reagent for detecting LOC401585 in the preparation of a product for early colorectal neoplastic lesion diagnosis.

[0007] Specifically, the product includes a detection reagent, a kit or a chip.

[0008] More specifically, the chip is composed of a solid phase carrier and a probe for LOC401585 fixed on the solid phase carrier.

[0009] On the other hand, the present application also provides a detection reagent for early colorectal neoplastic lesion, which includes an amplification primer of LOC401585 and / or an RNA reverse transcription primer of LOC401585.

[0010] The amplification primer of LOC401585 includes a primer pair as shown in SEQ ID NO. 1 and SEQ ID NO. 2.

[0011] On the other hand, the present application also provides a detection reagent kit for early colorectal neoplastic lesion, which includes the detection reagent as described above, and also includes a reverse transcription reaction reagent and a PCR amplification reagent.

[0012] The reverse transcription reaction reagent includes reverse transcriptase and buffer; The PCR amplification reagent includes dNTPs, MgCl2, DEPC water and Taq enzyme.

[0013] On the other hand, the present application also provides the use of a reagent for specifically inhibiting the expression level of LOC401585 in the preparation of a drug for treating colorectal cancer.

[0014] The present application has the following advantages: 1、The application adopts LncRNA sequencing to obtain the differentially expressed LncRNA in the colorectal tumorous lesion (including adenoma and colorectal cancer) cases and paracancerous tissues, and obtains the LncRNA marker stably related to the colorectal tumorous lesion (including adenoma and colorectal cancer), that is, LOC401585. The AUC of the LncRNA marker for adenoma and colorectal cancer is 0.952 and 0.876, respectively. In addition, the expression of LOC401585 in the whole blood of the colorectal tumorous lesion (including adenoma and colorectal cancer) patients is also significantly increased. Therefore, LOC401585 can be used for the clinical screening diagnosis of the colorectal tumorous lesion (including adenoma and colorectal cancer), and helps to reflect the disease state of the asymptomatic high-risk population of the colorectal tumorous lesion (including adenoma and colorectal cancer), and provides support for clinicians to quickly and accurately grasp the patient's condition and timely adopt a more personalized prevention and treatment plan.

[0015] 2、The application uses the RNA reverse transcription primer and DNA amplification primer of the LncRNA marker related to the auxiliary diagnosis of the colorectal tumorous lesion (including adenoma and colorectal cancer) to prepare a kit, and the kit has high sensitivity, strong specificity, simple operation and convenient use, and can be used for the auxiliary diagnosis of the colorectal tumorous lesion (including adenoma and colorectal cancer) and the screening of the asymptomatic high-risk population of the colorectal tumorous lesion (including adenoma and colorectal cancer), so that the diagnosis of the colorectal tumorous lesion (including adenoma and colorectal cancer) is more convenient and easy, and the clinician can quickly and accurately screen and diagnose the asymptomatic high-risk population of the colorectal tumorous lesion (including adenoma and colorectal cancer), lay a foundation for clinical treatment effect evaluation, and provide help for discovering new small molecule drug targets with potential treatment value. BRIEF DESCRIPTION OF DRAWINGS

[0016] Figure 1 It is the result graph of the LncRNA high-throughput sequencing analysis of 5 pairs of adenomas, 5 pairs of colorectal cancers and their matched paracancerous tissues in the application; Figure 2 It is the expression profile of LOC401585 in 39 normal paracancerous tissues, 32 adenomas and 112 colorectal cancers in the application.

[0017] Figure 3 It is the ROC curve of LOC401585 in adenoma and colorectal cancer in the application.

[0018] Figure 4 It is the expression profile of LOC401585 in 7 cases of healthy population whole blood, 7 cases of adenoma and 7 cases of colorectal cancer patient whole blood in the application.

[0019] Figure 5 Figure 1 shows the relationship between LOC401585 and the survival and prognosis of colorectal cancer patients in the present application. DETAILED DESCRIPTION

[0020] In order for those skilled in the art to better understand the technical solutions of the present application, the technical solutions of the present application will be further described below in combination with the drawings and examples. Example 1

[0021] The present application adopts LncRNA sequencing to detect and analyze the LncRNA expression profiles of colorectal tumor lesions (including adenomas and colorectal cancer) cases and paracancer tissue samples, obtains differentially expressed LncRNAs in colorectal tumor lesions (including adenomas and colorectal cancer) cases and paracancer tissues, and obtains LncRNA markers stably associated with colorectal tumor lesions (including adenomas and colorectal cancer), the LncRNA marker is LOC401585. The specific research includes the following contents: 1. Materials and reagents In this embodiment, 5 pairs of adenomas, 5 pairs of colorectal cancer and their paired paracancer tissues were screened for differentially expressed LncRNAs by high-throughput sequencing method. Among them, all adenomas, colorectal cancer and paired paracancer tissues were collected from the Department of Gastroenterology and Endoscopy of Longhua Hospital Affiliated to Shanghai University of Traditional Chinese Medicine, and were confirmed by pathological examination. The patients were informed and agreed that the samples would be used for the study, and the study was approved and implemented by the Ethics Committee of Longhua Hospital.

[0022] 2. Research methods Trizol (Thermo Fisher Scientific, Waltham, MA, USA) was used to extract total RNA from the sample, and rRNA Removal Kit (GenSeq, Inc., Shanghai, China) was used to remove ribosomal RNA (rRNA) in the total RNA. After removing the ribosome, the RNA was fragmented to ~300nt in length, and then RNA Library Prep Kit (GenSeq, Inc., Shanghai, China) was used to construct the sequencing library.

[0023] First, reverse transcriptase and random primers were used to synthesize first-strand cDNA, and second-strand synthesis was performed in a mixture containing dUTP for strand-specific labeling. Double-stranded cDNA fragments were end-repaired, ligated, and the cDNA with ligated adapters was subjected to PCR amplification and purification to obtain the sequencing library. Finally, 150 bp double-end sequencing was performed on a sequencer.

[0024] After sequencing, paired-end reads were harvested and quality controlled using Q30. FastP software was used to filter the raw data, removing adapters and low-quality reads to obtain high-quality reads. HISAT2 software (v2.0.4) was used to align the high-quality reads to a reference genome. Then, featureCounts software (v2.0.6) was used to obtain the raw transcript counts as lncRNA expression profiles. EdgeR software (v3.16.5) was used to normalize the data and calculate the fold change and p-value between the two groups of samples, screening for differentially expressed lncRNAs.

[0025] 3. Research Results The results of aberrantly expressed lncRNAs in 5 pairs of adenomas, 5 pairs of colorectal cancers, and their paired adjacent normal tissues are attached. Figure 1 As shown, in the appendix Figure 1 The left image shows LncRNAs that are significantly different in adenomas compared to adjacent normal tissue, while the right image shows LncRNAs that are significantly different in colorectal cancer compared to adjacent normal tissue. (From the attached image...) Figure 1 The results show that, compared with normal adjacent normal tissue, colorectal cancer showed 81 significantly upregulated LncRNAs and 3 significantly downregulated LncRNAs. Conversely, compared with normal adjacent normal tissue, adenomas showed 154 significantly upregulated LncRNAs and 54 significantly downregulated LncRNAs. Taking the intersection of these two groups revealed 26 LncRNAs that were significantly upregulated in both adenomas and colorectal cancer, with LOC401585 showing the highest expression level in both. Example 2

[0026] Example 2 further validated the expression of LOC401585 in colorectal neoplastic lesions (including adenomas and colorectal cancer) and its diagnostic value in colorectal neoplastic lesions (including adenomas and colorectal cancer) by expanding the sample size. The specific research process included the following: We collected tissue samples from 39 normal adjacent normal tissues, 32 adenomas, and 112 colorectal cancer patients, as well as whole blood samples from 7 healthy individuals, 7 adenomas, and 7 colorectal cancer patients. All adenomas, colorectal cancer, normal adjacent normal tissues, and whole blood samples were collected from the Department of Gastrointestinal Surgery and Endoscopy at Longhua Hospital, affiliated with Shanghai University of Traditional Chinese Medicine, and were confirmed by pathological examination. Patients provided informed consent for the use of their samples in this study, and the study was approved and implemented by the Ethics Committee of Longhua Hospital.

[0027] The specific experimental steps are as follows: I. Extraction of tissue RNA

[0028] 1. Tissue homogenate Per 50-100 mg tissue sample, add 1 ml of TRIZOL reagent and homogenize with an electric homogenizer.

[0029] 2. Phase separation To each 1 ml of homogenized sample in TRIZOL reagent, add 0.2 ml of chloroform. After shaking the tube vigorously for 15 seconds, incubate at room temperature for 10 minutes. Centrifuge at 12,000 rpm for 15 minutes at 4°C. After centrifugation, the mixture will separate into a lower red phenol-chloroform phase, an intermediate layer, and an upper colorless aqueous phase. The RNA is partitioned into the aqueous phase.

[0030] 3. RNA precipitation Transfer the aqueous phase to a new centrifuge tube and add an equal volume of isopropanol to precipitate the RNA. After mixing, incubate at room temperature for 10 minutes and centrifuge at 12,000 rpm for 10 minutes at 4°C.

[0031] 4. RNA washing Remove the supernatant and add 1 ml of 75% ethanol to wash the RNA pellet. After shaking, centrifuge at 7,500 rpm for 5 minutes at 4°C.

[0032] 5. Resolubilize the RNA pellet Remove the ethanol solution and air dry the RNA pellet for 5-10 minutes. Add RNase-free water and incubate at 55-60°C for 10 minutes. The resulting RNA solution is stored at -70°C.

[0033] 6. Measure the RNA concentration and purity using a NanoDrop® ND-1000.

[0034] II. Extraction of RNA from whole blood

[0035] 1. Take 300 μl of whole blood from the -80°C freezer and add 800 μl of TRIzol LS; 2. Shake the EP tube up and down to mix the sample well and let it stand for 5 minutes to completely dissociate the nuclear protein complex.

[0036] 3. Add 200 μl of chloroform, cover the tube cap, mix well, and let it stand for 10 minutes.

[0037] 4. Centrifuge at 12,000 g for 15 minutes at 4°C. Transfer the supernatant containing the RNA to a new EP tube.

[0038] 5. Add 500 μl of isopropanol (TRIZOL:isopropanol = 3:2), let it stand for 10 minutes. Centrifuge at 12,000 x g for 10 minutes at 4°C and discard the supernatant.

[0039] 6. Add 1 ml 75% ethanol (75% ethanol:TRIZOL = 4:3), vortex, 7500 g centrifuge at 4°C for 5 min, discard supernatant, and air dry for 5-10 min.

[0040] 7. Add 20 μl DEPC water, and incubate at 55-60°C for 10-15 min.

[0041] 8. Measure the concentration and purity of RNA using NanoDrop® ND-1000.

[0042] III. RNA pretreatment and cDNA synthesis

[0043] 1. RNA pretreatment Mix 5 μg RNA with 3 μL Deacylation Reaction Buffer and 1 μL RNase Inhibitor by vortexing, and incubate at 37°C for 40 min. Then mix 1 μL Adaptor, 10 μL Ligation Reaction, and 3 μL Ligation Enzyme Mix, and incubate at 25°C for 1 h. The pretreated RNA can be used for subsequent cDNA synthesis.

[0044] 2. Preparation of cDNA synthesis reagents Incubate at 50°C for 1 h using a thermal cycler.

[0045] IV. Verification of expression levels of tRF-Ala-AGC-060 and tRF-Tyr-GTA-081 by qPCR

[0046] Using the cDNA obtained by reverse transcription as a template, prepare the reaction solution according to the following qPCR reaction system: 2 × Master Mix 5 μl; 10 uM of PCR specific primer F 0.5 μl; 10 uM of PCR specific primer R 0.5 μl; cDNA 2 μl Add water to a total volume of 10 μl All indicators are subjected to the following program: pre-denaturation: 95°C, 10 min; 95°C, 10 s; 60°C, 60 s, a total of 40 PCR cycles.

[0047] V. Research results The expression profile of LOC401585 in 39 normal cancer-adjacent tissues, 32 adenomas, and 112 colorectal cancers is shown in the following table: Figure 2 As shown in the table,Figure 2 It can be seen that the expression level of LOC401585 in colorectal neoplastic lesions (including adenomas and colorectal cancer) is significantly higher than that in normal adjacent tissues.

[0048] The ROC curves of LOC401585 in adenomas and colorectal cancers are shown in the attached figure. Figure 3 As shown, A is the ROC curve of LOC401585 in adenoma, and B is the ROC curve of LOC401585 in colorectal cancer. Figure 3 It can be seen that when using LOC401585 as an indicator to distinguish between adenoma and colorectal cancer, the AUC values ​​are 0.952 and 0.876, respectively, and the sensitivities are 100% and 88.39%, respectively.

[0049] Among the aforementioned subjects, the expression profiles of LOC401585 in whole blood from 7 healthy individuals, 7 patients with adenomas, and 7 patients with colorectal cancer are shown in the attached figure. Figure 4 As shown, from the appendix Figure 4 As can be seen, the expression level of LOC401585 in the whole blood of patients with colorectal neoplastic lesions (including adenomas and colorectal cancer) is significantly higher than that in healthy individuals.

[0050] The relationship curve between LOC401585 and survival and prognosis in colorectal cancer patients is shown in the attached figure. Figure 5 As shown, A is the curve showing the relationship between LOC401585 and overall survival in colorectal cancer patients, and B is the curve showing the relationship between LOC401585 and disease-free survival in colorectal cancer patients. (From the attached...) Figure 5 As can be seen, LOC401585 is significantly negatively correlated with overall survival and progression-free survival in colorectal cancer patients. Example 3

[0051] Example 3 provides a kit for detecting a LncRNA biomarker (LOC401585) associated with the auxiliary diagnosis of colorectal neoplastic lesions (including adenomas and colorectal cancer). The kit contains a detection reagent for detecting LOC401585, as well as a reverse transcription reaction reagent and a PCR amplification reagent; it may also contain standards and / or controls.

[0052] Specifically, the detection reagents include LOC401585 reverse transcription primers and / or DNA amplification primers used in the qPCR experiment, wherein the LOC401585 reverse transcription primers are Oligo(dt) primers; The amplification primers for LOC401585 include Forward primer (SEQ ID NO.1): 5' GGCTTCTACACTGCCACC 3' Reverse primer (SEQ ID NO. 2): 5' GGGAAATGAGGACCACCG 3'.

[0053] Further, the reverse transcription reaction reagent includes reverse transcriptase and buffer; the PCR amplification reagent dNTPs, MgCl2, DEPC water and Taq enzyme, etc.; the PCR amplification reagent includes dNTPs, MgCl2, DEPC water and Taq enzyme.

[0054] In addition, the kit further comprises detection reagents for detecting the internal reference gene; the internal reference gene is β-Actin, and the detection reagents for the internal reference gene include RNA reverse transcription primers and / or DNA amplification primers used in QPCR experiments, the RNA reverse transcription primers are Oligo(dt) primers, and the nucleotide sequence of the DNA amplification primer for detecting β-Actin includes: Forward primer (SEQ ID NO. 3): 5' CTACCTCATGAAGATCCTCACCGA 3'; Reverse primer (SEQ ID NO. 4): 5' TTCTCCTTAATGTCACGCACGATT 3'.

[0055] The detection method of the kit comprises the following steps: (1) extracting total RNA of a sample; (2) pre-denaturing and reverse transcribing the extracted RNA into cDNA; (3) amplifying and detecting LOC401585 and a reference gene on a fluorescent real-time quantitative PCR instrument; (4) analyzing the target band through a melting curve, and performing relative quantification through a ΔΔCT method.

[0056] The kit has the value that by detecting adenoma tissue samples, the expression of LOC401585 is detected through the most simple and specific primers to assist in judging the probability of developing into colorectal cancer in the later stage of a patient, which is not only stable, convenient to detect, but also accurate in quantification, greatly improves the sensitivity of disease diagnosis, and therefore the kit is put into practice, which can help to guide accurate diagnosis in the clinic.

[0057] The above shows and describes the basic principles, main features and advantages of the present application. It should be understood by those skilled in the art that the present application is not limited to the above-mentioned embodiments, and the above-mentioned embodiments and descriptions in the specification are only to illustrate the principles of the present application, and various changes and improvements can be made without departing from the spirit and scope of the present application, and these changes and improvements all fall within the scope of the present application. The scope of protection of the present application is defined by the appended claims and their equivalents.

Claims

1. Use of a reagent for detecting LOC401585 in the manufacture of a product for the diagnosis of early colorectal neoplastic lesions.

2. Use according to claim 1, characterized in that: The product comprises a detection reagent, a kit or a chip.

3. Use according to claim 2, characterized in that: The chip consists of a solid support and a probe against LOC401585 immobilized on the solid support.

4. An assay for the early detection of colorectal neoplastic lesions characterized by: The detection reagent comprises an amplification primer of LOC401585 and / or an RNA reverse transcription primer of LOC401585.

5. The detection reagent according to claim 4, characterized in that: The amplification primer of LOC401585 comprises a primer pair as shown in SEQ ID NO. 1 and SEQ ID NO.

2.

6. A test kit for early detection of colorectal neoplastic lesions, characterized by: The detection reagent comprises a primer pair as claimed in claim 4 or 5.

7. The test kit according to claim 6, characterized in that: The kit further comprises a reverse transcription reaction reagent and a PCR amplification reagent.

8. The test kit according to claim 7, characterized in that: The reverse transcription reaction reagent comprises a reverse transcriptase and a buffer; The PCR amplification reagent comprises dNTPs, MgCl2, DEPC water and Taq enzyme.

9. Use of a reagent that specifically inhibits the expression level of LOC401585 in the manufacture of a medicament for the treatment of colorectal cancer.

Images