Fluorescent quantitative qPCR (quantitative polymerase chain reaction) method for rapidly and accurately measuring baculovirus titer and application of fluorescent quantitative qPCR method in expression of limulus C factor zymogen

Abstract

The invention discloses a fluorescent quantitative qPCR (quantitative polymerase chain reaction) method for rapidly and accurately measuring baculovirus titer and application of the fluorescent quantitative qPCR method in expression of limulus C factor zymogen, and relates to the field of bioengineering. The method comprises molecular target screening and verification, standard substance preparation, virus titer determination and application thereof in protein expression. The method comprises the following steps: collecting a virus stock solution, extracting total nucleic acid, and carrying out fluorescent quantitative qPCR on the total nucleic acid; and carrying out gradient dilution on the standard substance, drawing a standard curve of fluorescent quantitative qPCR, and calculating the titer of the virus liquid. The method is suitable for rapid detection of viruses in the recombinant tachypleus tridentatus C factor zymogen table. When the titer of the baculovirus measured by the method is 1.60 * 10 < 1 >-1.60 * 10 < 9 > VG / mu L, the detection time is only 2-3 hours, and the consumed time is short. Compared with the traditional virus titer detection method, the method has the advantages of simplicity in operation, rapidness, accuracy and the like, the detection efficiency is greatly improved, and the method is particularly suitable for meeting the requirement of rapid determination of the virus titer in protein expression.

Description

TECHNICAL FIELD

[0001] The application belongs to the field of bioengineering, and particularly relates to a fluorescence quantitative qPCR method for rapidly and accurately determining baculovirus titer and application thereof in limulus C factor proenzyme expression. BACKGROUND

[0002] The insect baculovirus expression system (BEVS) has the advantages of high-efficiency expression, high safety, stable expression product, post-translational processing and modification, and is widely used in the fields of recombinant protein production, vaccine research and development, and biological insecticide preparation. Together with the E. coli expression system, the yeast expression system and the mammalian expression system, the BEVS is one of the four recognized expression systems and one of the most valuable commercial expression systems.

[0003] The limulus C factor proenzyme is a serine protease proenzyme highly sensitive to trace endotoxin and is a key component of the enzyme cascade reaction of limulus reagent. The serine enzyme activity of the limulus C factor proenzyme can be activated by endotoxin and hydrolyze an artificial synthetic polypeptide signal substrate, and the fluorescence signal is proportional to the endotoxin content, thereby realizing quantitative detection of endotoxin. However, when the limulus C factor proenzyme is recombinantly expressed by using the insect baculovirus expression system, optimization of MOI is a necessary condition for obtaining high-efficiency and high-quality recombinant protein. Therefore, a rapid and accurate virus titer determination method is the basis for protein expression and process optimization.

[0004] Common virus titer determination methods include plaque method, endpoint dilution method, immunostaining method, and real-time quantitative PCR. The plaque method and endpoint dilution method are the gold standard for baculovirus titer identification. However, due to the defect of the polyhedron protein gene of the recombinant baculovirus, the inclusion body cannot be formed, resulting in no obvious cytopathic effect. In addition, due to the reasons of long time consumption (7 days), poor stability, high requirement for operators, etc., the application of the method is limited. In 2020, Wang Yan et al. established a recombinant baculovirus titer determination method based on GP64 monoclonal antibody, which needs 48-72 hours for detection. In 2023, Xiong Yu et al. established a recombinant baculovirus titer determination method based on immunofluorescence method, which needs 72 hours for detection. In 2024, Li Jing established a baculovirus titer determination method based on immunostaining method, which needs 72 hours for detection. However, due to the reasons of high price, long time consumption, high requirement for equipment, etc., the method has not been widely used. In 2007, Hitchman et al. constructed a qPCR method for baculovirus titer based on the gp64 gene, but the method has non-specificity and the detection limit is only 1000 PFU / mL. In 2021, Wu Qingsheng et al. constructed a qPCR method for baculovirus titer based on the recombinant H5N1 influenza hemagglutinin gene, but the method has the particularity of target gene and has not been popularized, so a rapid, accurate, high-sensitivity and inexpensive baculovirus titer determination method is needed to solve the problems in the prior art. SUMMARY

[0005] The present application aims to provide a rapid baculovirus titer determination method and kit to solve the problem of low efficiency in virus titer determination. The molecular marker sequence of baculovirus is used as the target gene, and specific primers are designed to establish a rapid baculovirus titer determination qPCR method and kit. Compared with the traditional virus titer detection method, the method is simple, fast and accurate, greatly improving the detection efficiency of baculovirus titer, and is especially suitable for rapid baculovirus titer determination in protein expression.

[0006] The present application provides a qPCR reaction amplification primer for rapid and accurate determination of baculovirus titer, characterized by comprising:

[0007] qF2: AGCGGCAGAATAACAATCACTTT;

[0008] qR2: AATCATACTCACGCCGTCTCG.

[0009] The present application provides a qPCR reaction kit for rapid and accurate determination of baculovirus titer, characterized by comprising the amplification primer of claim 1.

[0010] Preferably, a standard is included, and the nucleotide sequence of the standard is shown as SEQ ID NO. 2.

[0011] The present application provides a qPCR method for determining baculovirus titer, characterized by comprising the following steps:

[0012] A. A standard curve is prepared using a standard, and the nucleotide sequence of the standard is shown as SEQ ID NO. 2.

[0013] B. The total nucleic acid of the liquid containing baculovirus is extracted, then gradient diluted, and subjected to qPCR reaction to obtain the virus titer.

[0014] Preferably, the baculovirus is AcMNPV and Bombyx mori nucleopolyhedrovirus.

[0015] The present application provides a method for determining the expression status of recombinant factor C proenzyme, characterized by subculturing Sf9 cells to the logarithmic growth phase, inoculating AcMNPV in the Sf9 cells, and determining the activity of recombinant factor C proenzyme at different times.

[0016] In order to achieve the above-mentioned purposes, the technical solutions adopted by the present application comprise the following steps:

[0017] S1: A pair of qPCR primers for rapidly determining baculovirus titer is designed, taking the single copy gene gp64 of baculovirus as the detection object, and using primer 5.0 and online software Primer-BLAST to design, screen and verify specific primers for the gene, to obtain a primer group. Then, the actual sample sensitivity test and specificity verification are performed, and a primer group qF2 / qR2 with high specificity and high sensitivity is successfully screened.

[0018] S2: Based on the specific primers of step S1, a qPCR method and detection kit for baculovirus titer are further established.

[0019] S3: Based on the qPCR method or detection kit for baculovirus titer of step S2, the baculovirus titer in the cell fermentation broth is detected.

[0020] S4: Based on the virus titer detection method and detection kit of step S3, the application in the high-efficiency expression of recombinant factor C proenzyme or other proteins.

[0021] In the baculovirus titer detection method and the detection kit of the present application, the cell lines include: Spodoptera frugiperda Sf9 and Sf21 cells, Trichoplusiani Tn-368 cells and Hign Five cells, and BmN cell line of Bombyx mori.

[0022] In the baculovirus titer detection method and the detection kit of the present application, the detection method and the kit further include: prepared virus standard nucleic acid, qPCR reaction system, reaction conditions, etc.

[0023] In the baculovirus titer detection method and the detection kit of the present application, the virus titer Titer (VG / mL) is defined as the number of virus vector genomes (VG) contained in each milliliter of liquid, which indirectly represents the number of viral particles (VP). The calculation formula of the virus titer Titer is: Titer (VG / mL) = qPCR detected number of virus vector genomes (VG / mL) x 500. The number of virus vector genomes detected by qPCR is the number of virus vector genomes contained in the sample calculated by the standard curve; the method extracts 200 μL of fermentation broth for nucleic acid extraction, the elution volume is 100 μL, and the qPCR reaction volume is 1 μL.

[0024] In the baculovirus titer detection method and the detection kit of the present application, the multiplicity of infection (MOI) is defined as the ratio of the number of virus vector genomes to the number of cells during infection, that is, the number of viral particles / cell, and the unit is VG / cell.

[0025] The present application at least includes the following beneficial effects:

[0026] (1) The present application aims to establish an absolute quantitative PCR method for rapidly and accurately determining the titer of baculovirus with a specific molecular target (SEQ ID NO. 1) of baculovirus, which can accurately reflect the number of virus particles and has higher sensitivity and specificity than the former. The traditional end-point dilution method (plaque assay) for determining virus titer is susceptible to cell quality, operator proficiency and other factors, and has a high possibility of misjudgment and missed detection due to the non-obvious cytopathic effect. However, the detection results of the virus titer determination method or kit of the present application are not affected by subjective and experiential factors, and it has higher accuracy, reproducibility and stability. The traditional end-point dilution method has a long detection period, usually taking one week or even up to half a month. The detection time of the method of the present application is 2-3 hours, which greatly shortens the detection time and improves the detection efficiency. The method lays a foundation for high-efficiency expression of proteins by insect baculovirus expression system.

[0027] (2) The baculovirus titer determination method and kit of the present application have good linear range, sensitivity and repeatability. The linear range of the method is 1.6 x 10 1 ~ 1.6 x 10 9 VG / μL.

[0028] Other advantages, objects and features of the present application will be partly embodied by the following description, and will be partly understood by those skilled in the art through research and practice of the present application. BRIEF DESCRIPTION OF DRAWINGS

[0029] In order to more clearly illustrate the technical scheme of the baculovirus titer determination method and kit of the present application, the following will briefly introduce the drawings used.

[0030] Figure 1 is a specific molecular target screening;

[0031] Figure 2 is standard PCR amplification and purification recovery (M: DL5000 DNA Maker; 1: PCR blank control; 2: standard; 3: standard gel recovery);

[0032] Figure 3 is an absolute quantitative standard curve;

[0033] Figure 4 is a melting curve;

[0034] Figure 5 is recombinant factor C proenzyme expression optimization. DETAILED DESCRIPTION

[0035] For better explanation and understanding of the method and core idea of the present application, the present application is described in detail below in combination with specific embodiments and drawings, so that those skilled in the art can implement the present application according to the description. However, the content of the present application is not limited to the following examples, and it should be understood that the detailed description is a more detailed description of certain aspects, characteristics and embodiments of the present application, rather than a limitation of the present application. The use of any and all examples, or exemplary language herein, such as "for example" or "including", is intended merely to better illustrate the present application and does not pose a limitation on the scope of the present application unless claims are made. The use of the terms "including", "having" or "containing", including the use of grammatical synonyms thereof, should generally be understood as open and non-limiting. In addition, the numerical ranges and parameters used to define the present application are approximate values, and the related values in the specific examples have been presented as accurately as possible. However, any numerical value inevitably contains a standard deviation due to the individual test method, which is within 10%, 5%, 1% or 0.5% of the actual value or specific value or range. It should be noted that the experimental methods described in the following embodiments, unless otherwise specified, are conventional methods, and the reagents and materials, unless otherwise specified, can be obtained commercially.

[0036] Example 1 Screening and verification of baculovirus-specific targets

[0037] According to the baculovirus sequence, the single copy gene gp64 thereof was taken as the detection object, and specific primer design and screening were performed on the gene, as shown in Figure 1 The process is as follows: specific primer design is performed on the fragment by primer 5.0, and specific primer verification is performed on NCBI by Primer-BLAST online software to obtain a group of primers, as shown in Table 1. Subsequently, actual sample sensitivity test and specificity verification are performed, and a group of high-specificity primers qF2 / qR2 are successfully screened, as shown in Tables 2 and 3. The molecular target sequence is as follows: AGCGGCAGAATAACAATCACTTTGC GCACCACACGTGCAACAAATCGTGGCGATGCGGCATTTCCACTTCGAAAATGTACAGCAGGCTCGAGTGCCAGGACGACACGGACGAGTGCCAGGTATACATTTTGGACGCTGAGGGCAACCCCATCAACGTGACCGTGGACACTGTGCTTCATCGAGACGGCGTGAGTATGATT (SEQ ID NO. 1); the amplified fragment is 200 bp. The amplification primers are

[0038] qF2: AGCGGCAGAATAACAATCACTTT;

[0039] qR2: AATCATACTCACGCCGTCTCG;

[0040] Table 1 Primer set design

[0041]

[0042] Note: "+" means the primer is verified by Primer-BLAST to be specific; Rating is the score of primer by primer 5.0

[0043] Table 2 Primer sensitivity test

[0044]

[0045] Table 3 Primer set qF2 / qR2 specificity verification

[0046]

[0047] Example 2 Standard preparation

[0048] According to the baculovirus sequence, the sequence containing the heteromolecular target is used as a standard. The process is as follows: the specific primers of the fragment are designed and screened by primer 5.0. The amplification primer sequence is:

[0049] F: GCGGAGCACTGCAACGCGCAAATG;

[0050] R: TTAATATTGTCTATTACGGTTTCTAATCATACAGTAC;

[0051]

[0052] Preparation of standard curve in Example 3

[0053] 1) Calculation of copy number of standard

[0054] The standard in Example 2, purified nucleic acid of AcMNPV was used to calculate the copy number of the standard using the following formula: 3.0 The nucleic acid concentration was measured by a fluorometric quantitative instrument, and the copy number of the standard was calculated = (mass ÷ relative molecular mass) x 6.02 x 10 23 .

[0055] 2) Preparation of standard curve

[0056] The standard was diluted in a gradient of 10 times, and qPCR reaction was performed, the reaction system was shown in Table 4, and the reaction condition was shown in Table 5. The absolute quantitative standard curve was plotted with copy number as abscissa and Ct value as ordinate (see Figure 3 ). The melting curve was single peak, and the Tm value was greater than 80℃, which excluded the possibility of non-specific amplification caused by primer dimer, and the melting curve was consistent, which indicated that the primer had good specificity (see Figure 4 ). The amplification efficiency (E%) = (10 -1 / linear slope -1) x 100%, the amplification efficiency was 94.07%, and the detection linear range was 1.60 x 10 1 ~ 1.60 x 10 9 VG / μL, which had good sensitivity (see Table 6).

[0057] Table 4 qPCR reaction system

[0058]

[0059] Table 5 qPCR reaction condition

[0060]

[0061] Table 6 Ct value of standard diluted in different gradients

[0062]

[0063] Rapid determination of virus titer in culture supernatant in Example 4

[0064] 1) Propagation and collection of baculovirus liquid

[0065] The Sf9 cells were passed to logarithmic phase, and the cell density was diluted to 3 x 10 6cell / mL. Inoculation was performed with AcMNPV at MOI = 1.0 VG / cell, and the culture was carried out at 27°C and 200 r / min for 72 h. The supernatant was collected by centrifugation and filtered through a 0.22 μm filter, and stored at 4°C. 250 μL of the virus stock was extracted for total nucleic acid extraction, and the elution volume was 100 μL.

[0066] 2) Rapid detection of virus titer

[0067] The extracted virus total nucleic acid stock was diluted by 10 times in gradient, and the dilution factor was 10 1 ~ 10 8 . 1 μL was taken for virus titer determination (refer to the reaction system and reaction conditions of Example 3), and the detection results are shown in Table 7. The virus content in the extracted virus total nucleic acid stock was 1.10 x 10 7 VG / μL, and the virus titer in the supernatant of the fermentation broth was 4.40 x 10 9 VG / mL.

[0068] Table 7 qPCR actual sample detection

[0069]

[0070] Example 5 Optimization of recombinant Limulus C factor proenzyme expression

[0071] Sf9 cells were subcultured at an initial density of 1.0 x 10 6 cells / ml at 27°C and 200 r / min to the logarithmic growth phase. The cells were diluted to 2.0 x 10 6 cells / ml, inoculated in 150 mL conical flasks, and the inoculation amount was 50 mL. Different virus (AcMNPV) inoculation amounts were set, and the MOI was 500, 50, and 5, respectively. Sampling was performed every 12 hours, and the supernatant was stored at 4°C. The activity of recombinant Limulus C factor proenzyme at different time periods was determined. Incubation was performed at 37°C for 1 h, and the values at 0 h and 1 h were read under excitation light at 360 nm and emission light at 460 nm, and the difference was recorded as ΔRFU (Relative Fluorescence Unit). The optimal expression conditions of recombinant Limulus C factor proenzyme at different MOI and expression time were MOI = 5 VG / mL and expression time of 84 h Figure 5 .

[0072] The above examples are only the preferred embodiments of the present application, and should not be considered as limiting the scope of the present application. Therefore, equivalent changes and improvements made without departing from the principles of the present application should still be included in the patent coverage of the present application.

Claims

1. An amplification primer for a qPCR reaction for rapid and accurate determination of baculovirus titer, characterized in that, Comprising: qF2: AGCGGCAGAATAACAATCACTTT; qR2: AATCATACTCACGCCGTCTCG.

2. A kit for rapid and accurate determination of baculovirus titer by qPCR reaction, characterized in that, The amplification primer of claim 1.

3. The kit of claim 2, wherein The standard sample, wherein the nucleotide sequence of the standard sample is shown as SEQ ID NO.

2.

4. A qPCR method for determining baculovirus titer, characterized in that, Comprising the following steps: A. Making a standard curve with a standard sample, wherein the nucleotide sequence of the standard sample is shown as SEQ ID NO. 2; B. Extracting total nucleic acid from the liquid containing the baculovirus, then gradient dilution, qPCR reaction, and obtaining virus titer.

5. The qPCR method according to claim 4, characterized in that, The baculovirus is AcMNPV and Bombyx mori nuclear polyhedrosis virus.

6. A method for determining the expression level of recombinant Limulus Factor C pro-enzyme, characterized by, Sf9 cells are subcultured to the logarithmic growth phase, and AcMNPV is inoculated into the Sf9 cells to determine the recombinant Limulus C factor proenzyme activity at different times.

Images