RNAi preparation for preventing or treating obesity and combination therapy using same

Abstract

The present invention relates to an RNAi preparation for preventing or treating obesity and a combination therapy using the same, and more specifically, to a pharmaceutical composition for preventing or treating obesity and a combination preparation with a GLP-1 receptor agonist or a GLP-1 / GIP receptor dual agonist, which comprises an RNAi preparation as an active ingredient, the RNAi formulation comprises an antisense strand that is complementary to the MARC1mRNA sequence and a sense strand that is complementary to the antisense strand.

Description

TECHNICAL FIELD

[0001] The present application relates to an RNAi agent for preventing or treating obesity and a combination therapy using the same, and more particularly, to a pharmaceutical composition for preventing or treating obesity, which comprises an RNAi agent targeting MARC1 as an effective ingredient. BACKGROUND

[0002] Due to factors such as living environment, processed food, and eating out, the population of obese people is increasing year by year due to excess nutrient intake and reduced exercise. The World Health Organization (WHO) classifies obesity as a disease, not a physiological phenomenon or symptom, and diagnoses obesity when the body mass index (BMI) reaches 30 or higher. In general, BMI refers to a body weight higher than the normal standard value, and is also referred to as obesity when the body weight is lower than the standard value, but the proportion of fat in the body is high.

[0003] Obesity refers to excessive accumulation of fat in the body due to an imbalance between energy intake and consumption, which leads to an increase in the number and size of fat cells. Energy in the body is stored in the form of triglycerides in fat cells, and when energy is depleted, the stored fat is broken down into free fatty acids and glycerol and used as an energy source, but excess energy intake promotes fat cell differentiation, increasing the amount of fat stored in the body, which is a direct cause of obesity. Obesity causes fat to accumulate in the internal organs and abdomen, which leads to a change in body shape and becomes a risk factor for increasing the incidence of various diseases. Excessive accumulation of visceral fat causes problems in glucose metabolism in the body and symptoms such as abnormal hormone secretion, abnormal cytokine secretion, etc. Obesity-induced increases in triglycerides and low-density lipoprotein cholesterol and decreases in high-density lipoprotein cholesterol cause abnormal fat metabolism in the body and reduce insulin receptors in tissues, reducing insulin sensitivity, which inhibits glucose entry into cells and can trigger hyperglycemia and diabetes. In addition, obesity is known to be closely related to the occurrence of metabolic diseases such as hyperlipidemia, cardiovascular disease, cancer, respiratory disease, stroke, and osteoarthritis.

[0004] Obesity treatment drugs can be broadly divided into appetite suppressants, fat absorption inhibitors, and glucagon-like peptide-1 (GLP-1) analogs. Among them, semaglutide, a GLP-1 analog, has been approved by the U.S. Food and Drug Administration (FDA) as an anti-obesity drug for long-term management of body weight in adults. However, according to data from the National Institutes of Health (NIH), the proportion of patients who stopped using products with semaglutide as the main ingredient after 12 months was 23.2%, and the proportion of patients who stopped using products with semaglutide as the main ingredient after 24 months was 34.2%. A report analyzing changes in body weight and cardiovascular metabolic risk factors in patients one year later indicates that target patients increased by two-thirds of the reduced amount on average one year later, and cardiovascular metabolic risk factors also rose to a similar level as body weight.

[0005] In addition, a disease treatment method using the RNA interference phenomenon targets mRNA and uses small interfering RNA (siRNA) that regulates gene expression at the translation level, and thus is attracting attention as a safer therapeutic drug.

[0006] Accordingly, the present inventors have endeavored to develop a drug for treating obesity or improving the efficacy of an existing obesity treatment drug, and as a result, have finally developed an RNA preparation using RNA interference technology, and based on this, have completed the present invention. SUMMARY

[0007] TECHNICAL PROBLEM

[0008] The present invention is directed to providing a pharmaceutical composition for preventing or treating obesity, which comprises an RNAi preparation that specifically inhibits MARC1 expression as an active ingredient.

[0009] Another object of the present invention is to provide a combination preparation for preventing or treating obesity, which is used in combination with a GLP-1 receptor agonist or a GLP-1 / GIP receptor dual agonist, and which comprises the RNAi preparation as an active ingredient.

[0010] Another object of the present invention is to provide a method for preventing or treating obesity, which comprises administering the RNAi preparation to a subject.

[0011] TECHNICAL SOLUTION

[0012] To achieve the above object, there is provided a pharmaceutical composition for preventing or treating obesity, which comprises an RNAi preparation that specifically inhibits MARC1 expression, the RNAi preparation comprising an antisense strand consisting of mU*fG*mAmGmUmAfAmGfCmAmAmUmCfUmG*fG*mU*mC*mC*mU*mU, P-mA*fG*mAmUmCfCmAfGfAmGmCmUmGfCmG*fC*mC*mA*mC, or EVP-mU*fG*mAmUmCfCmAfGfAmGmCmUmGfCmG*fC*mC*mA*mC, and a sense strand consisting of mC*mC*mAfGmAfUmUmGmCmUmUmAmCmUmCmA-GalNAc, mG*fC*mGfCfAfGmCfUmCfUmGfGmAfUmCfU-GalNAc, or mG*fC*mGfCfAfGmCfUmCfUmGfGmAfUmCfA-GalNAc.

[0013] Another aspect provides a combination preparation for preventing or treating obesity, which comprises a GLP-1 receptor agonist or a GLP-1 / GIP receptor dual agonist, and the RNAi agent as an effective ingredient.

[0014] Another aspect provides a method for preventing or treating obesity, which comprises administering the RNAi agent to an individual.

[0015] Another aspect provides use of the RNAi agent in the manufacture of a medicament for preventing or treating obesity.

[0016] Other objects and advantages of the present application will become more apparent from the following claims and the accompanying drawings and the detailed description of the application. As long as what is not described in the present specification is well known to those skilled in the art or those skilled in similar technical fields, the related description thereof is omitted.

[0017] Advantages

[0018] The RNAi agent according to an aspect can reduce the body weight of an individual by inducing an increase in basal metabolic rate and promotion of fat oxidation of the individual, and thus can be used as an effective ingredient of a medicament for treating obesity.

[0019] The RNAi agent according to an aspect has an improved effect of reducing body weight when administered in combination with a medicament based on a GLP-1 receptor agonist or a GLP-1 / GIP dual agonist, and the effect of reducing body weight is maintained for a long time even after the administration is stopped. Thus, the RNAi agent can be used as an effective ingredient of a combination preparation for improving the efficacy or reducing side effects of an existing medicament for treating obesity. BRIEF DESCRIPTION OF DRAWINGS

[0020] Figure 1 is a result of determining the relative body weight change (%) based on the day of first administration of the test substance over time after administration of OLX702A-031-1 according to an aspect to an obese animal model.

[0021] Figure 2 is a graph of visually determining the body weight change after about 4 weeks of administration of the test substance after administration of OLX702A-031-1 according to an aspect to an obese animal model, Figure 2 A of is a result of a group in which a normal diet was provided, Figure 2 B of is a result of a group in which 1X PBS was administered to an obese animal model, Figure 2 C of is a result of a group in which OLX700A-001-8 was administered to an obese animal model, Figure 2 D of is a result of a group in which OLX702A-031-1 was administered to an obese animal model.

[0022] Figure 3 is a result of determining relative body weight change (%) based on a control group over time after the OLX702A-031-2 according to an aspect is administered to an obese animal model.

[0023] Figure 4 is a result of determining food intake change after the OLX702A-031-2 according to an aspect is administered to an obese animal model, Figure 4 A of which is a result of determining cumulative food intake over time, Figure 4 B of which is a comparison result after calculating daily average food intake.

[0024] Figure 5 is a result of determining locomotor activity change within 48 hours after the OLX702A-031-2 according to an aspect is administered to an obese animal model, Figure 5 A of which is a result of determining locomotor activity level over time, Figure 5 B of which is a comparison result after calculating average locomotor activity per hour.

[0025] Figure 6 is a result of determining energy expenditure change within 48 hours after the OLX702A-031-2 according to an aspect is administered to an obese animal model, Figure 6 A of which is a result of determining energy expenditure level over time, Figure 6 B of which is a comparison result after calculating average energy expenditure.

[0026] Figure 7 is a result of determining respiratory exchange ratio (RER) change within 48 hours after the OLX702A-031-2 according to an aspect is administered to an obese animal model, Figure 7 A of which is a result of determining respiratory exchange ratio over time, Figure 7 B of which is a comparison result after calculating average respiratory exchange ratio during the experiment.

[0027] Figure 8 is a result of determining respiratory exchange ratio under light condition or dark condition within 48 hours after the OLX702A-031-2 according to an aspect is administered to an obese animal model, Figure 8 A of which is a comparison result after calculating respiratory exchange ratio under light condition, Figure 8 B of which is a comparison result after calculating respiratory exchange ratio under dark condition.

[0028] Figure 9 is a result of determining FGF21 level after the OLX702A-031-2 according to an aspect is administered to an obese animal model, Figure 9 A of which is a comparison result of FGF21 mRNA expression level in liver tissue,Figure 9 B represents the comparison results of serum FGF21 levels.

[0029] Figure 10 The results were obtained by comparing FGF21 levels in an obese animal model after administering OLX702A-031-2 according to one aspect with those in the semaglutide administration group. Figure 10 A represents the comparison of FGF21 mRNA expression levels in liver tissue. Figure 10 B represents the comparison results of serum FGF21 levels.

[0030] Figure 11 The results were determined over time based on the change in relative body weight (%) in the control group after OLX702A-031-2 and smegglutinin were administered in combination to an obese animal model.

[0031] Figure 12 The results confirmed changes in food intake after combining OLX702A-031-2 and smegglutinin in an obese animal model. Figure 12 A represents the cumulative food intake determined over time. Figure 12 B represents the comparison results after calculating the average daily food intake before discontinuing smegglutinin. Figure 12 C represents the comparison result after calculating the average daily food intake during the entire experimental period.

[0032] Figure 13 The results were determined over time based on the change in relative body weight (%) in the control group (carrier administration group) after OLX702A-031-2 and smegglutinin were administered to an obese animal model every other week.

[0033] Figure 14 The cumulative food intake was determined over time after OLX702A-031-2 and smegglutinin were administered to an obese animal model every other week.

[0034] Figure 15 The results of relative weight change (%) based on the control group were determined over time after OLX702A-031-2 and smegglutinin were administered to an obese animal model every other day.

[0035] Figure 16 The cumulative food intake was determined over time after OLX702A-031-2 and smegglutinin were administered to an obese animal model every other day.

[0036] Figure 17 is a result of determining relative body weight change (%) based on a control group (normal diet control group) over time after the combination of OLX702A-031-2 according to an aspect and tirzepatide is administered to an obese animal model.

[0037] Figures 18A to 18C is a result of confirming food intake change after the combination of OLX702A-031-2 according to an aspect and tirzepatide is administered to an obese animal model, Figure 18A is a result of determining cumulative food intake over time, Figure 18B is a comparison result calculated from the daily food intake during the period before the tirzepatide is discontinued, Figure 18C is a comparison result calculated from the daily food intake during the entire period of the experiment.

[0038] Figure 19 is a result of determining relative body weight change (%) based on the day of first administration of the test substance over time after the combination of OLX702A-075-16 according to an aspect and semaglutide is administered to an obese primate animal model.

[0039] Figure 20 is a result of determining daily food intake change (%) based on the day of first administration of the test substance over time after the combination of OLX702A-075-16 according to an aspect and semaglutide is administered to an obese primate animal model.

[0040] Figure 21 is a comparison result calculated from the body fat rate over time after the combination of OLX702A-075-16 according to an aspect and semaglutide is administered to an obese primate animal model.

[0041] Figure 22 is a comparison result calculated from the abdominal circumference over time after the combination of OLX702A-075-16 according to an aspect and semaglutide is administered to an obese primate animal model. DETAILED DESCRIPTION

[0042] The various explanations and embodiments disclosed in the present application can also be applied to various other explanations and embodiments. That is, all combinations of the various elements disclosed in the present application are within the scope of the present application. Also, it cannot be determined that the scope of the present application is limited to the specific recitations described below.

[0043] In one aspect, there is provided a pharmaceutical composition for preventing or treating obesity, comprising, as an effective ingredient, a double-stranded RNAi agent comprising a sense strand and an antisense strand, the antisense strand consisting of EVP-mU*fG*mAmGmUmAfAmGfCmAmAmUmCfUmG*fG*mU*mC*mC*mU, P-mA*fG*mAmUmCfCmAfGfAmGmCmUmGfCmG*fC*mC*mA*mC or EVP-mU*fG*mAmUmCfCmAfGfAmGmCmUmGfCmG*fC*mC*mA*mC consisting of a sequence complementary to a MARC1 (Mitochondrial amidoxime reducing component 1) mRNA sequence, and the sense strand consisting of mC*mC*mAfGmAfUmUmGmCmUmUmAmCmUmCmA-GalNAc, mG*fC*mGfCfAfGmCfUmCfUmGfGmAfUmCfU-GalNAc or mG*fC*mGfCfAfGmCfUmCfUmGfGmAfUmCfA-GalNAc.

[0044] In another aspect, there is provided a use of the RNAi agent for manufacturing a medicament for preventing or treating obesity.

[0045] RNAi agent

[0046] In the present specification, the term "RNAi (RNA interference)" refers to a mechanism in which expression of a target gene is known to be inhibited by introducing double-stranded RNA (dsRNA) consisting of a strand having a sequence homologous to mRNA of the target gene and a strand having a sequence complementary thereto into a cell or the like, thereby inducing degradation of the mRNA of the target gene.

[0047] In the present specification, the term "RNAi agent" or "nucleic acid molecule inducing RNAi" refers to any agent or nucleic acid molecule that can inhibit gene expression or inhibit or down-regulate viral replication by mediating the RNA interference in a sequence-specific manner. Each of the above terms can refer to a single nucleic acid molecule, a plurality of the above nucleic acid molecules, or a pool of the above nucleic acid molecules. In one embodiment, the RNAi agent can be an siRNA.

[0048] In the present specification, the term "small interfering RNA (siRNA)" means a short double-stranded RNA (dsRNA) that mediates efficient gene silencing in a sequence-specific manner.

[0049] In the present specification, the term "gene" should be understood in the broadest sense, and it can encode a structural protein or a regulatory protein. At this time, the regulatory protein includes a transcription factor, a heat shock protein, or a protein involved in DNA / RNA replication, transcription, and / or translation. In the present application, the target gene whose expression needs to be inhibited is inherent in the viral genome, and can be integrated into an animal gene or exist as an extrachromosomal element.

[0050] In the present specification, the term "antisense strand" means a polynucleotide that is substantially complementary or 100% complementary to a target nucleic acid of interest, for example, can be complementary to all or part of a mRNA (messenger RNA), a non-mRNA RNA sequence (e.g., microRNA, piwiRNA, tRNA, rRNA, and hnRNA), or a coding or non-coding DNA sequence.

[0051] In the present specification, the term "sense strand" means a polynucleotide having the same nucleic acid sequence as a target nucleic acid, which is a polynucleotide that is identical to all or part of a mRNA (messenger RNA), a non-mRNA RNA sequence (e.g., microRNA, piwiRNA, tRNA, rRNA, and hnRNA), or a coding or non-coding DNA sequence.

[0052] In the present specification, the term "complementarity" or "complementary" refers to the generally accepted meaning in the art. The above terms can generally refer to the formation or presence of hydrogen bonds between one nucleic acid sequence and another nucleic acid sequence by traditional Watson-Crick or other non-traditional bonding means. Perfect complementarity can refer to the formation of hydrogen bonds between all consecutive residues of a nucleic acid sequence and the same number of consecutive residues of a second nucleic acid sequence. Partial complementarity can include various mismatches or non-base paired nucleotides (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more mismatches, e.g., 1 to 3 mismatches, non-nucleotide linkers, or non-base paired nucleotides) within a nucleic acid molecule. The partial complementarity can result in bulges, loops, overhangs, or blunt ends between the sense strand and the antisense strand of a nucleic acid molecule, or between the antisense strand of a nucleic acid molecule and its corresponding target nucleic acid molecule.

[0053] In the present specification, the term "blunt end" refers to the generally accepted meaning in the art. In the case of an RNAi agent or a nucleic acid molecule in the present specification, the term can refer to the end of a double-stranded siRNA molecule in which there is no overhanging nucleotide. The siRNA molecule in the present specification can form a blunt end at the 5' end of the antisense strand and the 3' end of the sense strand.

[0054] RNAi agent for inhibiting MARC1 expression

[0055] "MARC1 (Mitochondrial amidoxime reducing component 1)" is a mammalian molybdenum-containing enzyme, which is also referred to as MTARC1 or MOSC1, and the deficiency of the MARC1 enzyme is associated with low blood cholesterol levels and fat metabolism regulation, and thus it is known as a potential therapeutic target for obesity. The MARC1 protein, which can be understood to include naturally occurring wild-type MARC1 and functional variants thereof, the sequence of the MARC1 protein or a gene encoding the same can be obtained from known databases, such as GenBank of the National Institutes of Health, etc.

[0056] In the present specification, the term "expression" refers to the meaning generally accepted in the art. The above term generally refers to the process in which a gene finally produces a protein. The above expression includes transcription, splicing, post-transcriptional modification, or translation, but is not limited thereto. As used in the present specification, the expression level can be determined or monitored by detecting the mRNA level or the protein level.

[0057] The term "inhibiting" or "reducing" in relation to the expression of MARC1 gene of an individual means statistically significantly reduced compared to a non-treated group or a normal control group. The above reduction can be, for example, at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 60%, 65%, 70%, 70%, 80%, 85%, 90%, or 95% or more, but according to the detection method or the assay method, it can be lower than the detection level.

[0058] In addition, the RNAi agent according to an embodiment can increase the expression or the level in plasma of fibroblast growth factor 21 (FGF21). "FGF21" regulates various metabolic pathways, including glucose metabolism and energy homeostasis, and it has been reported that administration of FGF21 to an obese animal model can improve insulin sensitivity and lipoprotein profile. The above increase can be, for example, at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 60%, 65%, 70%, 70%, 80%, 85%, 90%, or 95% or more compared to a non-administration group, but according to the detection method or the assay method, it can be higher than the detection level.

[0059] siRNA is a small interfering RNA (small interfering RNA) involved in RNAi (RNA interference) action. RNAi is a cellular gene regulation mechanism that was first discovered in Caenorthabditis elegans in 1998, and its mechanism of action is known to be complementary binding of the antisense strand in the double-stranded RNA introduced into the cell to the mRNA of the target gene, thereby inducing degradation of the target gene, and is a new drug development candidate technology that has attracted much attention.

[0060] However, contrary to such a possibility, there are continuous reports of side effects and disadvantages of siRNA. In order to develop an RNAi-based therapeutic method, the following obstacles need to be overcome: 1) lack of an effective delivery system, 2) off-target effects, 3) induction of immune responses, and 4) saturation of intracellular RNAi mechanisms, etc. Although siRNA is an effective method of directly controlling the expression of target genes, the development of therapeutic drugs is in a dilemma due to the above problems. In this regard, asymmetric siRNA (asiRNA, asymmetric shorter duplex siRNA) is an asymmetric RNAi-inducing structure having a short double helix length compared to the 19+2 structure of the existing siRNA. This technology overcomes the problems of off-target effects, saturation of RNAi mechanisms, TLR3 immune responses, etc. existing in the existing siRNA structure technology, and thus it is possible to develop a new RNAi drug with less side effects.

[0061] Based on this, the present embodiment proposes an asymmetric siRNA including a sense strand and an antisense strand complementary to the sense strand, and the siRNA according to an embodiment does not cause problems such as off-target effects, saturation of RNAi mechanisms, etc., and thus it is possible to stably maintain high delivery efficiency and effectively inhibit the expression of the MARC1 gene to the desired level.

[0062] In a specific embodiment, in the RNAi agent, at least one chemical modification can be included in the sense strand or the antisense strand.

[0063] The conventional siRNA cannot pass through the cell membrane due to high negative charge and high molecular weight, etc. caused by the phosphate backbone structure, and is rapidly degraded and removed in the blood, and thus it is difficult to deliver a sufficient amount of siRNA for inducing RNAi to the actual target site. At present, as an example of in vitro, a highly efficient delivery method using a cationic lipid and a cationic polymer has been developed, but in vivo, it is difficult to deliver siRNA with the same efficiency as in vitro, and the siRNA delivery efficiency is decreased due to interaction with various proteins present in vivo.

[0064] To this end, the present embodiment proposes an RNAi agent that can achieve efficient intracellular delivery in target cells after transfection of a cell or animal model expressing MARC1 without using an additional carrier, by introducing chemical modifications to an asymmetric siRNA (antisense strand of SEQ ID NO: 1 (UGAGUAAGCAAUCUGGUCCUU), SEQ ID NO: 2 (AGAUCCAGAGCUGCGCCAC), or SEQ ID NO: 3 (UGAUCCAGAGCUGCGCCAC) and sense strand of SEQ ID NO: 4 (CCAGAUUGCUUACUCA), SEQ ID NO: 5 (GCGCAGCUCUGGAUCU), or SEQ ID NO: 6 (GCGCAGCUCUGGAUCA)) excellent in knockdown efficiency.

[0065] In the present application, the chemical modification in the sense strand or the antisense strand can include one or more selected from the group consisting of binding to an N-acetylgalactosamine (GalNAc) derivative, modification of a nucleotide binding to a phosphorothioate, a boranophosphate, or a methyl phosphonate, substitution of an -OH group at a 2' carbon position of a sugar structure within a nucleotide with -CH3 (methyl), -OCH3 (methoxy), -NH2, -F, -O-2-methoxyethyl, -O-propyl, -O-2-methylthioethyl, -O-3-aminopropyl, or -O-3-dimethylaminopropyl, a phosphate group, an E-vinylphosphonate, or a cell-penetrating peptide.

[0066] In a specific embodiment, the N-acetylgalactosamine (GalNAc) derivative can have the structure of Chemical Formula 1 below. The RNAi agent having the N-acetylgalactosamine (GalNAc) derivative bound to the terminal can improve intracellular delivery in target cells (e.g., hepatocytes), thereby providing an effective therapeutic effect.

[0067] [Chemical Formula 1]

[0068]

[0069] In a specific embodiment, the sense strand can comprise one or more chemical modifications selected from: 2 to 4 nucleotides adjacent to the 5' terminus modified to phosphorothioate, boranophosphonate, or methylphosphonate; -OH group replaced by -CH3(methyl), -OCH3(methoxy), -NH2, -F, -O-2-methoxyethyl -O-propyl, -O-2-methylthioethyl, -O-3-aminopropyl, or -O-3-dimethylaminopropyl in the 2' carbon position of the sugar structure within one or more nucleotides; and conjugation to an N-acetylgalactosamine (GalNAc) derivative or a cell-penetrating peptide in the 3' terminus.

[0070] In a specific embodiment, the antisense strand can comprise one or more chemical modifications selected from: 2 to 7 nucleotides adjacent to the 3' terminus or the 5' terminus modified to phosphorothioate, boranophosphonate, or methylphosphonate; -OH group replaced by -CH3(methyl), -OCH3(methoxy), -NH2, -F, -O-2-methoxyethyl -O-propyl, -O-2-methylthioethyl, -O-3-aminopropyl, or -O-3-dimethylaminopropyl in the 2' carbon position of the sugar structure within one or more nucleotides; and conjugation to a phosphate group, E-vinylphosphonate, or a cell-penetrating peptide in the 5' terminus.

[0071] In another specific embodiment, the RNAi agent can comprise one or more modifications selected from the group consisting of: 2 to 7 nucleotides adjacent to the 3' terminus or the 5' terminus modified to phosphorothioate in the sense strand or the antisense strand; -OH group replaced by -OCH3(methoxy) or -F in the 2' carbon position of the sugar structure within one or more nucleotides in the sense strand or the antisense strand; conjugation to an N-acetylgalactosamine (GalNAc) derivative in the 3' terminus of the sense strand; and conjugation to a phosphate group or E-vinylphosphonate in the 5' terminus of the antisense strand.

[0072] In a specific embodiment, the antisense strand can consist of EVP-mU*fG*mAmGmUmAfAmGfCmAmAmUmCfUmG*fG*mU*mC*mC*mU*mU, P-mA*fG*mAmUmCfCmAfGfAmGmCmUmGfCmG*fC*mC*mA*mC, or EVP-mU*fG*mAmUmCfCmAfGfAmGmCmUmGfCmG*fC*mC*mA*mC, and the sense strand can consist of mC*mC*mAfGmAfUmUmGmCmUmUmAmCmUmCmA-GalNAc, mG*fC*mGfCfAfGmCfUmCfUmGfGmAfUmCfU-GalNAc, or mG*fC*mGfCfAfGmCfUmCfUmGfGmAfUmCfA-GalNAc. In the above sequences, * indicates a phosphorothioate bond, m indicates 2'-O-methyl, P indicates a 5'-phosphate bond, f indicates 2'-fluoro, EVP indicates a 5'-E-ethylenylphosphonate bond, and GalNAc indicates a trivalent GalNAc derivative of Chemical Formula 1.

[0073] Obesity

[0074] The pharmaceutical composition can be used for preventing or treating obesity by inhibiting the expression of the MARC1 gene.

[0075] Obesity refers to a disease caused by energy imbalance due to long-term nutrient intake exceeding energy consumption, and the World Health Organization (WHO) defines it as a state in which abnormal or excessive fat is accumulated in adipose tissue to a degree that is harmful to health. Obesity is a representative disease of metabolic syndrome, and obesity itself is known to be a disease that increases the risk of developing metabolic disorder-caused diseases such as type 2 diabetes, hypertension, hyperlipidemia, and coronary artery disease.

[0076] Obesity treatment drugs can be broadly divided into appetite suppressants, fat absorption inhibitors, and glucagon-like peptide-1 (GLP-1) analogs. The appetite suppression method as the first approach gives a feeling of satiety by stimulating the nerves of the brain, and diethylproprion, phendimetrazine, phentermine, etc. have been approved by the U.S. FDA and commercialized. The second approach is a method of inhibiting the absorption of fat that has been ingested, which acts on the digestive system to block the absorption of fat, and orlistat is representative. Finally, glucagon-like peptide-1 analogs (GLP-1 analogs) are existing drugs for the treatment of diabetes, which have important biological activities such as promoting insulin secretion and suppressing glucagon secretion. Semaglutide is a GLP-1 analog that has been approved by the U.S. Food and Drug Administration (FDA) as an anti-obesity drug for long-term management of body weight in adults. However, according to the data of the U.S. National Institutes of Health (NIH), a report analyzing the changes in body weight and cardiovascular metabolic risk factors of patients when the above-mentioned treatment drugs were discontinued for one year indicated that the target patients increased by two-thirds of the amount of reduction on average after one year, and the cardiovascular metabolic risk factors also rose to a similar level as the body weight. In this technical background, there is a need to develop a new drug that can improve the efficacy or reduce the side effects of existing obesity treatment drugs.

[0077] Pharmaceutical composition

[0078] In the present specification, the term "effective ingredient" refers to a moderately effective amount of an ingredient that brings a favorable or preferred effect on clinical or biochemical results. Specifically, it can refer to an effective amount of a formulation, an activator, or an RNAi formulation. The effective amount can be administered once or more, and it can be a moderate amount for preventing a disease, or, without limitation, for achieving alleviation of symptoms of a disease, reduction in the range of a disease, stabilization of a condition (i.e., not worsening), delay or reduction in the speed of progression of a disease, or improvement or temporary alleviation and relief (partial or total) of a condition.

[0079] In the present specification, the term "prevention" refers to any action that prevents the occurrence of a disease in advance, inhibits a disease, or delays progression. For example, it refers to preventing the occurrence of the obesity or its characteristic properties, hindering the occurrence of a disease, or defending against or protecting against the obesity or its characteristic properties.

[0080] In the present specification, the term "treatment" refers to therapeutic treatment and prophylactic or preventative measures. Furthermore, it refers to all measures involving the alleviation of symptoms and / or an amelioration of the disease state. For example, prevention, reduction or improvement of the obesity or its characteristic features, or delaying (weakening) the obesity or its characteristic features in an individual.

[0081] In the present specification, the term "effective amount" refers to the generally accepted meaning in the art. The above term can generally refer to the amount of a molecular compound or construct sought by a researcher, veterinarian, physician or other clinician, etc., which is capable of inducing the intended biological response (e.g., a beneficial response) of a cell, tissue, system, animal or human. In particular, a "therapeutically effective amount" refers to the amount of a molecule, compound or construct, for example, which is capable of causing the preferred medical response in a subject, such as a therapeutically relevant change in a measurable parameter associated with a disease or disorder, such that the particular clinical treatment is considered effective. A therapeutically effective amount of a drug for treating a disease or disorder can be the amount required to cause a therapeutically relevant change in the parameter.

[0082] The method of administration of the pharmaceutical composition can be determined by those skilled in the art according to the symptoms and the degree of illness of the general patient. In addition, it can be formulated as a powder, tablet, capsule, solution, injection, ointment, and syrup, etc., and can be provided in the form of a unit dose or a multiple dose container, such as a sealed ampoule and a bottle. In addition, it can be formulated with at least one other agent currently used for the prevention or treatment of a disease. The effective amount of the above-mentioned other agonist is determined according to the content in the formulation, the severity of the disease, and other factors.

[0083] The pharmaceutical composition of the present application can be administered orally or parenterally. The administration route of the composition according to the present application can be, for example, oral, intravenous, intramuscular, intra-arterial, intra-osseous, intrathecal, intracardiac, transdermal, subcutaneous, intraperitoneal, enteral, sublingual or topical, but is not limited thereto. The dosage range of the composition according to the present application varies depending on the body weight, age, sex, health status, diet, administration time, administration method, excretion rate or severity of the disease of the patient, and can be easily determined by those skilled in the art. In addition, the composition of the present application can be formulated into an appropriate dosage form using known techniques for clinical administration.

[0084] The pharmaceutical composition of the present application can be administered in combination with an existing obesity treatment drug (e.g., a GLP-1 receptor agonist or a GLP-1 / GIP receptor dual agonist). In addition, the pharmaceutical composition can be administered alone, simultaneously or sequentially with the GLP-1 receptor agonist or the GLP-1 / GIP receptor dual agonist.

[0085] In one aspect, there is provided a combination preparation for preventing or treating obesity, comprising: a first active ingredient comprising a GLP-1 receptor agonist or a GLP-1 / GIP receptor dual agonist; and a second active ingredient comprising a double-stranded RNAi agent, the double-stranded RNAi agent comprising a sense strand and an antisense strand, wherein the antisense strand consists of EVP-mU*fG*mAmGmUmAfAmGfCmAmAmUmCfUmG*fG*mU*mC*mC*mU*mU, P-mA*fG*mAmUmCfCmAfGfAmGmCmUmGfCmG*fC*mC*mA*mC or EVP-mU*fG*mAmUmCfCmAfGfAmGmCmUmGfCmG*fC*mC*mA*mC complementary to a MARC1 (Mitochondrial amido xime reducing component 1) mRNA sequence, and the sense strand consists of mC*mC*mAfGmAfUmUmGmCmUmUmAmCmUmCmA-GalNAc, mG*fC*mGfCfAfGmCfUmCfUmGfGmAfUmCfU-GalNAc or mG*fC*mGfCfAfGmCfUmCfUmGfGmAfUmCfA-GalNAc.

[0086] In another aspect, there is provided a pharmaceutical use of the RNAi agent for preventing or treating obesity by administering in combination with a GLP-1 receptor agonist or a GLP-1 / GIP receptor dual agonist; and a use of the RNAi agent in the manufacture of a combination preparation of a GLP-1 receptor agonist or a GLP-1 / GIP receptor dual agonist for preventing or treating obesity.

[0087] In another aspect, there is provided a kit for preventing or treating obesity, comprising the combination preparation, and provided to an individual in a form that the first active ingredient is contained in a first compartment and the second active ingredient is contained in a second compartment.

[0088] The combination preparation for preventing or treating obesity and the kit for preventing or treating obesity contain the above-mentioned RNAi preparation or pharmaceutical composition as they are, or utilize the same, and thus the description of the common content therebetween is omitted to avoid the present specification from being too complex.

[0089] Combination and kit comprising the combination

[0090] In the present specification, the term "combination preparation" refers to at least two drugs / preparations which are used simultaneously or almost simultaneously (administered separately in order, or administered on the same day) in order to achieve a therapeutic synergy. The combination preparation is a general term for pharmaceutical compositions which achieve a combined therapeutic effect by administering at least two drugs separately, simultaneously or sequentially, or by administering them alternately at certain or indefinite intervals, etc. The combined therapeutic effect is not limited thereto, but can be defined as a more therapeutically superior effect or a synergistic effect, as determined by, for example, the degree of response, the speed of response, the time until disease progression, or survival time, compared to the effect that can be obtained when one or the remaining components of the combination therapy are administered at a conventional dose.

[0091] In the present specification, the terms "synergy", "therapeutic synergy", and "synergistic effect" refer to a phenomenon in which a more therapeutically superior result is exhibited when a patient is treated with a combination of therapeutic drugs (for example, a GLP-1 receptor agonist or a GLP-1 / GIP receptor dual agonist administered in combination with the RNAi preparation according to an embodiment) than the result achieved when each of the components of the combination is used alone or each of the components of the combination material. In this regard, the therapeutically superior result includes at least one of the following: (a) an enhanced effect of a greater therapeutic response than the individual effect of each agonist of the same dose in the combination material, whether one or both; (b) a reduction in the dose of at least one agonist on the premise that the therapeutic efficacy is not reduced; (c) a reduction in the incidence of side effects in the process of obtaining the same or more therapeutic benefit than monotherapy of each agonist of the same dose in the combination material; (d) a reduction in dose-limiting toxicity in the process of obtaining more therapeutic benefit than monotherapy of each agonist; (e) a delay or minimization of the induction of drug resistance.

[0092] In a specific embodiment, the combination preparation can include: a first active ingredient including a GLP-1 receptor agonist or a GLP-1 / GIP receptor dual agonist; and a second active ingredient including the RNAi agent for preventing or treating obesity. The first active ingredient and the second active ingredient can be administered separately, simultaneously or sequentially, and such a combination therapy can 1) exhibit a superior therapeutic efficacy than the individual effect of the GLP-1 receptor agonist or the GLP-1 / GIP receptor dual agonist alone, 2) reduce the dose of the GLP-1 receptor agonist or the GLP-1 / GIP receptor dual agonist on the premise that the therapeutic efficacy is not decreased, 3) address side effects or problems caused by the GLP-1 receptor agonist or the GLP-1 / GIP receptor dual agonist (e.g., rapid weight gain after discontinuation).

[0093] In a specific embodiment, the combination preparation or the kit including the combination preparation can be provided to an individual in the form in which the first active ingredient is included in a first compartment and the second ingredient is included in a second compartment.

[0094] GLP-1 receptor agonist

[0095] Glucagon-like peptide-1 (GLP-1, Glucagon-like peptide-1) is an incretin hormone consisting of 30 amino acids that is secreted by intestinal L cells after eating. In a healthy human body, GLP-1 plays an important role in controlling postprandial blood glucose by promoting the secretion of glucose-dependent insulin produced by the pancreas. GLP-1 also inhibits the secretion of glucagon, thereby causing the liver to reduce glucose production. In addition, GLP-1 can delay gastric emptying and small intestinal peristalsis, thereby delaying food absorption.

[0096] A GLP-1 receptor agonist or a GLP-1 analog has an effect of stimulating insulin synthesis and secretion, inhibiting glucagon secretion, inhibiting gastric emptying, enhancing glucose utilization, and inhibiting food intake. The GLP-1 receptor agonist was developed as a drug for treating type 2 diabetes, but in recent years, it has attracted attention as an effective ingredient for treating obesity. However, it has been reported that the GLP-1 receptor agonist can cause vomiting and nausea when taken as an obesity treatment drug, and weight can rebound after discontinuation. The GLP-1 receptor agonist can be selected from the group consisting of, for example, Semaglutide, Liraglutide, Exenatide, Taspoglutide, Albiglutide, Lixisenatide, and Dulaglutide.

[0097] GLP-1 / GIP receptor dual agonist Label Chemical modification

[0098] Glucose-dependent insulinotropic polypeptide (GIP, Glucose-dependent insulinotropic polypeptide) is an incretin hormone consisting of 42 amino acids that is secreted by K cells after intake of glucose or fat. In a healthy human body, GIP plays a role in promoting insulin secretion from the pancreas in a blood glucose concentration-dependent manner and contributes to lowering blood glucose levels, and reports indicate that it has GLP-1 activity increasing effects, anti-inflammatory effects, and lipid metabolism improving effects, etc.

[0099] A GIP receptor agonist or a GIP analog is a substance that can supplement the effects of a GLP-1 receptor agonist, and reports indicate that it has a greater effect on blood glucose and body weight when used in combination with a GLP-1 receptor agonist. Therefore, a GLP-1 / GIP receptor dual agonist is used as an effective ingredient for treating obesity. The GLP-1 / GIP receptor dual agonist can be selected from the group consisting of, for example, Tirzepatide, NN9709, SAR-438335, ZP-DI-70.

[0100] In one aspect, there is provided a method for preventing or treating obesity, comprising administering the RNAi agent to an individual.

[0101] In another aspect, there is provided a combination therapy for preventing or treating obesity, comprising administering the RNAi agent to an individual, alone, simultaneously or sequentially with the GLP-1 receptor agonist or the GLP-1 / GIP receptor dual agonist.

[0102] The method or combination therapy for preventing or treating obesity as described above contains or utilizes the RNAi agent, the pharmaceutical composition, or the combination preparation as described above as they are, and thus the description of the common content therebetween is omitted to avoid the present specification from being too complicated.

[0103] In the present specification, the term "individual" refers to a subject in need of treatment of a disease, particularly a subject in need of treatment of a liver disease, and more particularly, it can include a human or a non-human primate, a mouse, a dog, a cat, a horse, a cow, a sheep, a pig, a goat, a camel, and a giraffe, etc. mammal.

[0104] Hereinafter, the present application will be described in further detail by way of examples. However, these examples are for illustratively describing the present application only, and the scope of the present application is not limited to these examples.

[0105] [Examples]

[0106] Example 1. Synthesis of RNAi agent

[0107] In the present example, nucleic acid molecules for inducing RNAi targeting MARC1 were synthesized. Specifically, RNAi agents according to an embodiment were synthesized by introducing various chemical modifications (2'OMe, P, Fluoro, EVP, etc.) and incorporating a derivative labeled as "trivalent GalNAc" to the 3' end of the sense strand. The synthesis method of the present example employed methods known in the art, and the sequence information of the synthesized RNAi agents is shown in Table 1 below.

[0108] [Table 1]

[0109]

[0110] Specifically, the chemical modifications labeled as "*", "m", "f", "P", "GalNAc" in Table 1 above are as shown in Table 2 below.

[0111] [Table 2]

[0112] Phosphorothioate bond 2'-O-Methyl * 2'-Fluoro m 5'-Phosphate group f EVP P E-Vinylphosphonate "GalNAc” Trivalent GalNAc derivative of Formula 1 Figure 1 Figure 2

[0113] Specifically, in Table 2 above, "*" indicates a form in which the existing phosphodiester bond is replaced with a phosphorothioate bond, and "m" indicates a form in which the existing 2'-OH is replaced with 2'-O-methyl. In addition, "f" such as fG indicates a form in which the existing 2'-OH of G (guanine) is replaced with fluorine, and "P" indicates a form in which a phosphate group is bound to the 5' end (the phosphate group is bound to the oxygen of carbon 5 in the 5' end base). In addition, "EVP" indicates a form in which E-vinylphosphonate is bound to the 5' end of the antisense strand, and "GalNAc" indicates a form in which a trivalent GalNAc derivative of Chemical Formula 1 below is bound to the 3' end of the sense strand.

[0114] In addition, the structure of the trivalent GalNAc derivative is as shown in Chemical Formula 1 below.

[0115] [Chemical Formula 1]

[0116]

[0117] [Experimental Example]

[0118] I. Confirmation of Anti-Obesity Effect after Administration of RNAi Agents According to an Embodiment

[0119] Experimental Example 1. Anti-Obesity Effect after Administration of OLX702A-031-1 or OLX702A-031-2

[0120] In the present experimental example, the body weight change after administration of OLX702A-031-1 or OLX702A-031-2 was measured for a diet-induced obesity (DIO) animal model, and thus the anti-obesity effect was evaluated.

[0121] 1-1. Confirmation of body weight reduction effect after administration of OLX702A-031-1

[0122] For C57BL / 6 mice (8 weeks old, male, Koatech), the animal model group was divided into a normal diet provided group (NCD) and a high-fat diet provided group (HFD) for 32 weeks, and the high-fat diet provided animal model group (fat content 60%, 60% HFD) was divided into a group to which 1X-PBS was administered (HFD-VC), a group to which OLX700A-001-8 targeting Factor IX was administered (HFD-NC), and a group to which OLX702A-031-1 according to an embodiment was administered (HFD-031-1) according to the administered substance. The specific experimental conditions for the above animal model groups are shown in Table 3 below.

[0123] [Table 3]

[0124]

[0125] After 28 weeks of high-fat diet provision, OLX702A-031-1 according to an embodiment was administered at a dose of 10 mpk subcutaneously every other week for a total of 4 times. The experiment was continued for 4 weeks, and the body weight was measured 3 times a week while the test substance was administered. In addition, the body weight change of each animal model group was visually evaluated about 4 weeks after the administration of the test substance. In addition, the group to which 1X PBS (HFD-VC) was administered was used as a control group, and the group to which OLX700A-001-8 was administered at a dose of 10 mpk every other week (HFD-NC) was used as a negative control group.

[0126] As shown in Figure 3 , the group to which OLX702A-031-1 according to an embodiment was administered (HFD-031-1) showed a clear body weight reduction effect about 10 days after the administration of the test substance, and maintained a body weight reduction level of about 15% during the experiment. In addition, as shown in Figure 4 , the HFD-031-1 group according to an embodiment also showed a clear body weight reduction effect at a visually measurable level.

[0127] 1-2. Confirmation of body weight reduction effect after administration of OLX702A-031-2

[0128] C57BL / 6 mice (8 weeks old, male, Koatech) fed a high-fat diet (60% fat content, 60% HFD) for 8 weeks were divided into three groups based on the substances administered: a group administered 1X PBS (vector), a group administered smegglutinin (smegglutinin), and a group administered OLX702A-031-2 according to one embodiment (OLX702A-031-2). Specific experimental conditions for these animal model groups are shown in Table 4 below.

[0129] [Table 4]

[0130]

[0131] After 8 weeks of high-fat diet, OLX702A-031-2 according to one embodiment was administered via subcutaneous injection at a dose of 10 mpk every two weeks for a total of 4 times. The experiment lasted 8 weeks, and body weight (FX-2000i, A&D company, 0.01g to 2200g) and food intake (CSG201F, OHAUS, 0.1g to 200g) were measured twice weekly during administration of the test substance. Food intake was calculated by measuring the difference between the supplied amount and the remaining amount for each individual. Furthermore, the group receiving 1X PBS (carrier) served as the control group, and the group receiving subcutaneous injections of 0.42 mpk every two weeks (for a total of 8 times) served as the positive control group. Here, mpk represents mg (drug) / kg (target animal).

[0132] The results are as follows Figure 5 As shown in Table 5, a significant weight loss effect was confirmed in the group (OLX702A-031-2) that was applied according to one embodiment.

[0133] [Table 5]

[0134]

[0135]

[0136] In addition, such as Figure 6 As shown in Table 6, compared with the positive control group, the reduction in food intake in the OLX702A-031-2 group was smaller, indicating that the weight loss effect was not simply due to a reduction in food intake.

[0137] [Table 6]

[0138]

[0139] Experiment Example 2. Confirming the effects of increased basal metabolic rate and fat oxidation.

[0140] In the present experimental example, the changes in basal metabolic rate and fat oxidation level after administration of OLX702A-031-2 were measured for a diet-induced obesity (DIO) animal model, and thus the main factor of the anti-obesity effect was found.

[0141] The food intake, energy consumption, and locomotor activity of the animal model groups in Experimental Example 1-2 above were measured using an experimental animal energy metabolism monitoring system (CLAMS; Columbus instruments, Columbus, OH, USA). Specifically, on the 12th day after the initial administration of the test substance, the animal model groups were placed in the CLAMS to adapt to the changing environment, and the oxygen uptake (VO2), carbon dioxide consumption (VCO2), locomotor activity (measured by infrared rays), food intake, and water intake were measured every 10 minutes from 9 a.m. on the next day (i.e., the 13th day after the initial administration of the test substance) for 48 hours. Thereafter, the respiratory exchange ratio (RER) was calculated from the ratio of carbon dioxide consumption to oxygen uptake (VCO2 / VO2), and the energy consumption was calculated from Equation 1 below.

[0142] [Equation 1]

[0143] Energy consumption = (3.815 + 1.232 x respiratory exchange ratio) x VO2

[0144] The results are shown in Table 7 and Table 8, and there was no difference in locomotor activity between each animal model group, and the energy consumption level of the group administered with semaglutide (semaglutide) was similar to that of the control group. In contrast, the energy consumption of the group administered with OLX702A-031-2 according to an embodiment (OLX702A-031-2) was significantly increased without being affected by locomotor activity. Figure 7 Figure 8 [Table 7]

[0145] [Table 8]

[0146]

[0147] [Table 8]

[0148]

[0149] In addition, as shown in Table 7 and Table 8, Figure 9 Figure 10 ​​and Table 9, the respiratory exchange ratio of the OLX702A-031-2 group was closer to 0.7 than that of the semaglutide group (in general, it is known that the respiratory exchange ratio is about 0.7 after fat decomposition and about 1.0 after carbohydrate decomposition). Among them, the value close to 0.7 indicates that fat oxidation (i.e., fat burning) is actively performed. In addition, this tendency was observed in both light and dark conditions, and was more significant in the dark condition.

[0150] [Table 9]

[0151]

[0152] From the above results, it can be seen that the weight loss effect of the RNAi preparation according to an embodiment is derived from an increase in energy consumption, i.e., an increase in basal metabolic rate, and also exhibits an excellent fat oxidation effect.

[0153] Experimental Example 3. Confirmation of the mechanism of the anti-obesity effect

[0154] In this experimental example, with respect to an animal model in which obesity was induced by a high-fat diet, the FGF21 (Fibroblast Growth Factor 21) level after administration of OLX702A-031-2 was evaluated, and the FGF21-related effect was compared with that of the semaglutide administration group.

[0155] 3-1. FGF-21 expression promotion effect

[0156] With respect to C57BL / 6 mice (8 weeks old, male, Koatech) to which a high-fat diet was provided for 10 weeks, the animal model group was divided into a group to which 1X PBS (vehicle) was administered and a group to which OLX702A-031-2 (OLX702A-031-2) according to an embodiment was administered according to the administered substance. The specific experimental conditions for the above animal model groups are shown in Table 10 below.

[0157] [Table 10]

[0158]

[0159] After 10 weeks of providing a high-fat diet, OLX702A-031-2 according to an embodiment was subcutaneously injected (1 time in total) at a dose of 10 mpk. Thereafter, each of the animal model groups was sacrificed 12 days after the above subcutaneous injection, and the expression level of FGF21 mRNA in the liver tissue and the level of FGF21 in the serum were measured. In addition, the group to which 1X PBS was administered (vehicle) was used as a control group.

[0160] The results are shown in Table 11 below. Figure 11As shown, the FGF21 mRNA expression level in the liver tissue and the FGF21 level in the serum of the group to which OLX702A-031-2 according to an embodiment was administered (OLX702A-031-2) were significantly increased compared to the control group.

[0161] 3-2. Comparison with the semaglutide administration group

[0162] For C57BL / 6 mice to which a high-fat diet was provided for 8 weeks, the animal model groups were divided into a group to which 1X PBS (vehicle) was administered, a group to which semaglutide was administered (semaglutide), and a group to which OLX702A-031-2 according to an embodiment was administered (OLX702A-031-2) according to the administered substance. The specific experimental conditions for the above animal model groups are shown in Table 11 below.

[0163] [Table 11]

[0164]

[0165] After 8 weeks of providing a high-fat diet, OLX702A-031-2 according to an embodiment was administered at a dose of 10 mpk subcutaneously every two weeks for a total of 4 times. Thereafter, after 8 weeks of the above subcutaneous injection, each animal model group was sacrificed, and the expression level of FGF21 mRNA in the liver tissue and the level of FGF21 in the serum were measured. In addition, the group to which 1X PBS (VC) was administered was used as a control group, and the group to which 0.42 mpk was subcutaneously injected (a total of 8 times) every week was used as a positive control group.

[0166] The results thereof are shown in Table 12 below. Figure 12 As shown, the expression level of FGF21 mRNA in the liver tissue and the level of FGF21 in the serum of the semaglutide administration group (semaglutide) were similar to or showed a decreasing tendency compared to the control group, and, in contrast, the FGF21 expression level of the group to which OLX702A-031-2 according to an embodiment was administered (OLX702A-031-2) was significantly increased as in the above experimental results. It can be seen therefrom that, unlike semaglutide, OLX702A-031-2 according to an embodiment has an effect of increasing the expression of FGF21 through an additional mechanism of action for weight loss.

[0167] Based on the above experimental results, unlike existing therapeutic drugs based on GLP-1 receptor agonists, the weight loss effect of the MARC1-targeting RNAi preparation according to an embodiment is based on an increase in basal metabolic rate / energy metabolic rate, and is not identical in terms of mechanism of action, which additionally increases the expression of FGF21. Therefore, as confirmed in this experimental example, the RNAi preparation according to an embodiment not only exhibits an anti-obesity effect when administered alone, but also exerts a further improved anti-obesity effect when administered in combination with therapeutic drugs based on GLP-1 receptor agonists.

[0168] II. Confirmation of improved anti-obesity effect after combined administration of GLP-1 receptor agonists or GLP-1 / GIP dual agonists

[0169] To confirm the efficacy of the combination preparation containing the MARC1-targeting RNAi preparation according to an embodiment, the anti-obesity effect after combined administration with the GLP-1 receptor agonist semaglutide and after combined administration with the GLP-1 / GIP receptor dual agonist tirzepatide was confirmed.

[0170] Experimental Example 1. Confirmation of weight loss effect after combined administration of OLX702A-031-2 and semaglutide

[0171] In this experimental example, the changes in body weight and food intake after combined administration of OLX702A-031-2 and the GLP-1 receptor agonist semaglutide were measured in an animal model induced to be obese by a high-fat diet, thereby evaluating the anti-obesity effect.

[0172] 1-1. Comparison of body weight changes

[0173] With respect to C57BL / 6 mice (6 weeks old, male, Koatech) provided with a high-fat diet for 8 weeks, the animal model group was divided into a group provided with a normal diet (NCD) and a group provided with a high-fat diet (HFD) for 8 weeks, and the group provided with a high-fat diet was divided into a group administered with 1X PBS (high-fat diet control group), a group administered with semaglutide (semaglutide), and a group administered with OLX702A-031-2 according to an embodiment and semaglutide in combination (OLX702A-031-2 + semaglutide) according to the administered substance. The specific experimental conditions for the above animal model groups are shown in Table 12 below.

[0174] [Table 12]

[0175]

[0176]

[0177] After providing a high-fat diet for 8 weeks, the OLX702A-031-2 according to an embodiment and semaglutide were administered in combination. Specifically, the semaglutide was subcutaneously injected at a dose of 0.42 mpk twice a week (total of 16 times), and then was discontinued for the remaining experimental period, and the OLX 702A-031-2 was subcutaneously injected at a dose of 10 mpk every two weeks (total of 8 times) for 16 weeks. The experiment was continued for 16 weeks, and the body weight of each individual was measured 5 times per week from the start day (D0) of the experiment to the 66th day, and then 3 times per week until the end of the experiment, while the test substance was administered. In addition, a group to which 1X PBS was administered to an obese animal model (VC) was used as a control group, and a group in which only the semaglutide was subcutaneously injected at a dose of 0.42 mpk twice a week (total of 16 times) for 8 weeks (semaglutide) was used as a comparison group.

[0178] Results are shown in Table 13. Figure 13 As shown in Table 13, the group in which only the semaglutide was administered (semaglutide) showed an effective weight loss effect during the administration period, but the body weight rapidly increased after the semaglutide was discontinued (after 8 weeks of administration of the test substance). On the other hand, the OLX702A-031-2 + sema group according to an embodiment showed an about 1.5-fold increased weight loss effect compared to the semaglutide group, not only during the administration of the semaglutide but also during the period in which the semaglutide was discontinued.

[0179] [Table 13]

[0180]

[0181] 1-2. Comparison of food intake

[0182] The food intake measurement for the animal model group in the above-described Experimental Example 1-1 was continued for 16 weeks, and the food intake of each individual was measured 2 times per week from the start day (D0) of the experiment to the 9th week, and then 5 times per week until the end of the experiment, while the test substance was administered. The food intake was calculated by measuring the difference between the amount supplied and the amount remaining for each individual, and the cumulative food intake during the entire experimental period, the period before the semaglutide was discontinued, and the average daily food intake during the entire experimental period were evaluated.

[0183] Results are shown in Table 13. Figure 14and Table 14, the group in which OLX702A-031-2 and semaglutide were combined (OLX702A-031-2 + semaglutide) did not differ from the control group and the group in which only semaglutide was administered (semaglutide) in terms of cumulative food intake. In addition, in terms of daily food intake, the food intake of the semaglutide group and the OLX702A-031-2 + sema group did not decrease compared to the control group before the administration of semaglutide was stopped, and the food intake of the OLX702A-031-2 + sema group showed similar levels without being affected by the discontinuation of semaglutide.

[0184] [Table 14]

[0185]

[0186] From the experimental results as above, it can be known that the increased weight loss effect after the combination administration with semaglutide, which is the GLP-1 receptor agonist, is derived from the increase in energy expenditure, not the decrease in food intake.

[0187] Experimental Example 2. Confirmation of OLX702A-031-2 combination administration effect according to variation in semaglutide administration frequency

[0188] In the present experimental example, for an animal model in which obesity was induced by a high-fat diet, the effect of the administration frequency of semaglutide on the anti-obesity effect brought about by the combination administration of OLX702A-031-2 and semaglutide was confirmed.

[0189] 2-1. Comparison of body weight change in the group administered once a week

[0190] For C57BL / 6 mice (8 weeks old, male, Koatech) to which a high-fat diet was provided for 8 weeks, the above animal model group was divided into a group in which 1X PBS was administered every other week (vehicle), a group in which only semaglutide was administered every other week (Sema QW), a group in which only OLX702A-031-2 according to an embodiment was administered every two weeks (OLX702A-031-2 Q2W), and a group in which OLX702A-031-2 according to an embodiment and semaglutide were combined (OLX702A-031-2 Q2W + sema QW) according to the administered substance. The specific experimental conditions for the above animal model groups are shown in Table 15 below.

[0191] [Table 15]

[0192]

[0193] After providing a high-fat diet for 8 weeks, the test substance was administered. Specifically, the semaglutide was subcutaneously injected at a dose of 0.42 mpk every other week (total of 6 times), and the OLX702A-031-2 was subcutaneously injected at a dose of 10 mpk every two weeks (total of 3 times). The experiment was continued for 6 weeks, and the body weight and food intake were measured every day while the test substance was administered. The food intake was calculated by measuring the difference between the amount supplied and the amount remaining for each individual. In addition, a group to which 1X PBS was administered to an obese animal model (vehicle) was used as a control group, a group to which semaglutide was subcutaneously injected at a dose of 0.42 mpk every other week (total of 6 times) (Sema QW) was used as a positive control group, and a group to which OLX702A-031-2 was subcutaneously injected at a dose of 10 mpk every two weeks (total of 3 times) (OLX702A-031-2 Q2W) was used as a positive control group.

[0194] The results are shown in Table 15 and FIG. 2. Figure 15 As shown in Table 15 and FIG. 2, the group in which the OLX702A-031-2 according to an embodiment and the semaglutide were administered in combination (OLX702A-031-2 + Semga QW) showed a significantly improved weight loss effect compared to the group in which the semaglutide was administered alone.

[0195] [Table 15]

[0196]

[0197] In addition, as shown in Table 16 and FIG. 3, the group in which the OLX702A-031-2 according to an embodiment and the semaglutide were administered in combination (OLX702A-031-2 + Semga QW) showed a significantly improved food intake reduction effect compared to the group in which the semaglutide was administered alone. Figure 16

[0198] [Table 16]

[0199]

[0200] 2-2. Comparison of body weight change in the group administered once a day

[0201] C57BL / 6 mice (8 weeks old, male, Koatech) to which a high-fat diet was provided for 8 weeks were divided into a group to which 1X PBS was administered every other week (vehicle), a group to which only semaglutide was administered every other day (Sema QD), a group to which only the OLX702A-031-2 according to an embodiment was administered every two weeks (OLX702A-031-2 Q2W), and a group to which the OLX702A-031-2 according to an embodiment and the semaglutide were administered in combination (OLX702A-031-2 Q2W + Sema QD) according to the administered substance. The specific experimental conditions for the above animal model groups are shown in Table 18 below.​

[0202] [Table 18]

[0203]

[0204] After an 8-week high-fat diet, OLX702A-031-2 and semaglutide according to one embodiment were administered in combination. Specifically, semaglutide was administered subcutaneously every other day (14 times in total), at a dose of 0.15 mpk, and then discontinued for the remainder of the experiment. OLX702A-031-2 was administered subcutaneously every two weeks (3 times in total). The experiment lasted for 6 weeks, and body weight and food intake were measured daily during administration of the test substances. Food intake was calculated by measuring the difference between the supplied and surplus amounts for each individual. In addition, the group that received 1X PBS in the obese animal model (carrier) served as the control group, the group that received subcutaneous injections of 0.15 mpk dose of semaglutide every other day (14 times in total) and then discontinued (Sema QD), and the group that received subcutaneous injections of 10 mpk dose of OLX702A-031-2 every two weeks (3 times in total) (OLX702A-031-2+Sema QD) served as the positive control group.

[0205] The results are as follows Figure 17 As shown in Table 19, under the condition of daily administration of semaglutide, the group that combined OLX702A-031-2 and semaglutide according to one embodiment (OLX702A-031-2+Sema QD) showed an improved weight loss effect compared to the group that administered semaglutide alone. In particular, the group that administered semaglutide every other day (Sema QD) showed a tendency to gain weight rapidly after discontinuing semaglutide, while the OLX702A-031-2+Sema QD group maintained the weight loss effect.

[0206] [Table 19]

[0207]

[0208] In addition, such as Figures 18A to 18C As shown in Table 20, in terms of cumulative food intake, the OLX702A-031-2+sema QD group did not show any difference from other groups as described above, which indicates that the aforementioned weight loss effect stemmed from increased energy expenditure.

[0209] [Table 20]

[0210]

[0211] From the above experimental results, it was confirmed that the further improved weight loss effect by the combined administration, as in Experimental Example 1 above, could be continuously exerted regardless of the number of times of administration of semaglutide.

[0212] Experimental Example 3. Confirmation of weight loss effect after combined administration of OLX702A-031-2 and tirzepatide

[0213] In this experimental example, for an animal model of obesity induced by a high-fat diet, the changes in body weight and food intake after combined administration of OLX702A-031-2 and GLP-1 / GIP receptor dual agonist tirzepatide were measured, thereby evaluating the anti-obesity effect.

[0214] 3-1. Comparison of body weight changes

[0215] For C57BL / 6 mice (7 weeks old, male, Koatech) provided with a high-fat diet for 9 weeks, the animal model group was divided into a normal diet provided group (NCD) and a group provided with a high-fat diet for 9 weeks (HFD), and the animal model group provided with a high-fat diet was divided into a group administered with 1X PBS (high-fat diet control group), a group administered with only a 10 nmol / kg dose of tirzepatide (tirzepatide 10 nmol), a group administered with only a 100 nmol / kg dose of tirzepatide (tirzepatide 100 nmol), and a group administered with a 5 mpk dose of OLX702A-031-2 according to an embodiment and a 10 nmol / kg dose of tirzepatide (OLX702A-031-2 + TZP 10 nmol) in combination, according to the administered substance and its dose. The specific experimental conditions for the above animal model groups are shown in Table 21 below.

[0216] [Table 21]

[0217]

[0218] After 9 weeks of providing a high-fat diet, OLX702A-031-2 according to an embodiment and tirzepatide were administered in combination. Specifically, 10 nmol / kg dose of the tirzepatide was subcutaneously injected twice a week (total of 8 times), and then discontinued for the remaining experimental period, and 5 nmol / kg dose of the OLX702A-031-2 was subcutaneously injected every two weeks (total of 4 times). The experiment was continued for 9 weeks, and the body weight of each individual was measured 5 times a week while the test substance was administered. In addition, a group to which 1X PBS was administered to an obesity animal model (high-fat diet control group) was used as a control group, and a group in which 10 nmol / kg dose of tirzepatide was subcutaneously injected twice a week (total of 8 times) (tirzepatide 10 nmol) and a group in which 100 nmol / kg dose of tirzepatide was subcutaneously injected twice a week (total of 8 times) (tirzepatide 100 nmol) were used as comparison groups.

[0219] Results are shown in Table 21 and FIG. 6. Figure 19 As shown in Table 21 and FIG. 6, the group administered only with tirzepatide (Tirzepatide 10 nmol, Tirzepatide 100 nmol) exhibited an effective weight loss effect during the administration period, but showed a tendency of rapid weight gain after the administration of tirzepatide was discontinued. In addition, the group administered with OLX702A-031-2 according to an embodiment and tirzepatide (OLX702A-031-2 + TZP 10 nmol) exhibited a weight loss effect similar to that of the group administered with high-dose tirzepatide (Tirzepatide 100 nmol) not only during the administration of tirzepatide but also during the period after the administration of tirzepatide was discontinued.

[0220] [Table 21]

[0221]

[0222] 3-2. Comparison of food intake

[0223] The measurement of food intake for the animal model groups in Experimental Example 3-1 above was continued for 9 weeks, and the food intake of each individual was measured 5 times a week while the test substance was being administered. The food intake was calculated by measuring the difference between the amount supplied and the amount remaining for each individual, and the cumulative food intake during the entire experiment, the period before the administration of tirzepatide was discontinued, and the daily food intake during the entire experiment were evaluated.

[0224] Results are shown in Table 22 and FIG. 7. Figure 20 As shown in Table 22 and FIG. 7, in terms of cumulative food intake, the group administered with OLX702A-031-2 according to an embodiment and tirzepatide (OLX702A-031-2 + TZP 10 nmol) did not exhibit a difference from the control group and the group administered only with tirzepatide (Tirzepatide 10 nmol, Tirzepatide 100 nmol). In addition, in terms of daily food intake, the OLX702A-031-2 + TZP 10 nmol group exhibited a higher level than the other groups during the period after the administration of tirzepatide was discontinued, but exhibited a similar level to the other groups during the entire experiment.

[0225] [Table 23]

[0226]

[0227] From the experimental results as above, it can be known that the increased weight loss effect after the administration of OLX702A-031-2 according to an embodiment in combination with tirzepatide, which is a GLP-1 / GIP receptor dual agonist, is derived from an increase in energy expenditure, not a decrease in food intake.

[0228] III. Confirmation of body weight reduction after combined administration of OLX702A-075-16 and semaglutide through a primate model

[0229] Experimental Example 1. Comparison of body weight change after combined administration with OLX702A-075-16

[0230] In this experimental example, the body weight and food intake changes after combined administration of OLX702A-075-16 and GLP-1 receptor agonist semaglutide were measured for a primate model of obesity induced by a high-fat diet, thereby evaluating the anti-obesity effect.

[0231] 1-1. Comparison of body weight change

[0232] For an obese monkey model (12 to 23 years old, male) provided with a high-fat diet for at least 2 years, the above animal model was divided into a group administered with 1X PBS (vehicle), a group administered with only semaglutide (semaglutide), a group administered with only OLX702A-075-16 according to an embodiment (OLX702A-075-16), and a group administered with both OLX702A-075-16 according to an embodiment and semaglutide (OLX702A-075-16 + semaglutide) according to the administered substance. The specific experimental conditions for the above animal model groups are shown in Table 24 below.

[0233] [Table 24]

[0234]

[0235] For an obese monkey model provided with a high-fat diet for at least 2 years, OLX702A-075-16 according to an embodiment and semaglutide were administered in combination. Specifically, the semaglutide was subcutaneously injected (a total of 4 times) at a dose of 30 pg / kg every other week, and then discontinued for the remaining experimental period, and the OLX702A-075-16 was subcutaneously injected (a total of 3 times) at a dose of 10 mpk every two weeks. The experiment lasted for 12 weeks, and the body weight of each individual was measured twice a week while the test substance was administered. In addition, a group to which 1X PBS was administered (vehicle) to the obese animal model was used as a control group, and a group to which semaglutide was subcutaneously injected (a total of 4 times) at a dose of 30 pg / kg every other week (semaglutide) and a group to which OLX702A-075-16 was subcutaneously injected (a total of 2 times) at a dose of 10 mpk every two weeks (OLX702A-075-16) were used as comparison groups.

[0236] Table 25 is a result of determining the relative body weight change (%) based on the day of the first administration of the test substance (Base) according to the passage of time for each animal model group.

[0237] [Table 25]

[0238]

[0239] The results are as follows Figure 21 As shown in Table 25, the group receiving only semaglutide (semaglutide) exhibited effective weight loss during the administration period, but weight rebounded after discontinuation of semaglutide. Furthermore, compared to the semaglutide group, the group receiving a combination of OLX702A-075-16 and semaglutide according to one embodiment (OLX702A-075-16 + semaglutide) showed superior weight loss, maintaining this effect not only during semaglutide administration but also during semaglutide discontinuation.

[0240] 1-2. Comparison of food intake

[0241] The food intake of the animal model group in Experiment 1-1 above was measured for 12 weeks, with the food intake of each individual measured daily starting 7 days before administration of the test substance. The food intake was calculated by measuring the difference between the supplied amount and the remaining amount for each individual, and the cumulative food intake and average daily food intake during the entire experimental period were evaluated.

[0242] Table 26 shows the results for each animal model group, determining the relative daily food intake change (%) based on the day of first administration of the test substance (Base).

[0243] [Table 26]

[0244]

[0245] The results are as follows Figure 22 As shown in Table 26, in terms of cumulative food intake, the group that received the combined administration of OLX702A-075-16 and smegglutinin according to one embodiment (OLX702A-075-16 + smegglutinin) showed a similar level to the group that received smegglutinin alone (smegglutinin).

[0246] Based on the above experiments, it can be inferred that the further enhanced weight loss effect brought about by the combined administration of Experiment Example 1-1 stems from the increase in energy expenditure rather than the reduction in food intake.

[0247] Experimental Example 2. Comparison of changes in body fat percentage after combined use with OLX702A-075-16

[0248] Body fat percentage measurements in the animal model group of Experiment 1-1 above were conducted for 12 weeks, with each individual's body fat percentage measured every four weeks from the date of administration of the test substance. The animal models were anesthetized by propofol injection and then transferred to a GE Lunar Prodigy Primo bone densitometer. Subsequently, body fat percentage was quantified and assessed using a GE Lunar Prodigy dual-energy X-ray absorptiometry (DEXA) scanner.

[0249] Table 27 shows the results of determining the change (%) in body fat percentage over time for each animal model group.

[0250] [Table 27]

[0251]

[0252] The results are as follows ​ As shown in Table 27, the group that received OLX702A-075-16 in combination with smegglutide (OLX702A-075-16 + smegglutide) showed an effective reduction in body fat percentage, and this effect was superior to that of the group that received smegglutide alone (smegglutide).

[0253] Experimental Example 3. Comparison of abdominal circumference changes after combined administration with OLX702A-075-16

[0254] The abdominal circumference of the animal model group in Experiment 1-1 above was measured for 12 weeks, with the abdominal circumference of each individual measured every four weeks from the date of administration of the test substance. The animal models were anesthetized by injection of propofol, and the anesthetized animal models were placed in a lateral recumbent position. The abdominal circumference was measured and evaluated with the umbilicus as the center.

[0255] Table 28 shows the results of determining the change in abdominal circumference (cm) over time for each animal model group.

[0256] [Table 28]

[0257]

[0258] The results are as follows ​ As shown in Table 28, the group that received OLX702A-075-16 in combination with smegglutinin (OLX702A-075-16 + smegglutinin) showed an effective reduction in waist circumference, and this effect was superior to that of the group that received smegglutinin alone (smegglutinin).

[0259] The specific details of the present invention have been described in detail above. For those skilled in the art, these specific techniques are merely preferred embodiments, and it is clear that the scope of the invention is not limited thereto. Therefore, the actual scope of the invention is defined by the appended claims and their equivalents.

Claims

1.A pharmaceutical composition for preventing or treating obesity, comprising, as an effective ingredient, a double-stranded RNAi agent comprising a sense strand and an antisense strand, the antisense strand consisting of EVP-mU*fG*mAmGmUmAfAmGfCmAmAmUmCfUmG*fG*mU*mC*mC*mU, mA*fG*mAmUmCfCmAfGfAmGmCmUmGfCmG*fC*mC*mA*mC or EVP-mU*fG*mAmUmCfCmAfGfAmGmCmUmGfCmG*fC*mC*mA*mC complementary to a MARC1 (Mitochondrial amidoxime reducing component 1) mRNA sequence, the sense strand consisting of mC*mC*mAfGmAfUmUmGmCmUmUmAmCmUmCmA-GalNAc, mG*fC*mGfCfAfGmCfUmCfUmGfGmAfUmCfU-GalNAc or mG*fC*mGfCfAfGmCfUmCfUmGfGmAfUmCfA-GalNAc, wherein * indicates a modification to a phosphorothioate bond, m indicates a substitution to 2’-O-methyl, P indicates a binding of a 5'-phosphate group, f indicates a substitution to 2’-fluoro, EVP indicates a binding of 5’-E-ethylenylphosphonate, and GalNAc indicates a binding of N-acetylgalactosamine derivative. wherein 2.The pharmaceutical composition of claim 1, wherein the N-acetylgalactosamine derivative has a structure of the following Chemical Formula 1: [Chemical Formula 1] 3.The pharmaceutical composition of claim 1, wherein a 5’-end of the antisense strand and a 3’-end of the sense strand form a blunt end. 4.The pharmaceutical composition of claim 1, wherein the composition increases expression of MARC1. 5.The pharmaceutical composition of claim 1, wherein the composition increases expression or a level in plasma of fibroblast growth factor 21 (FGF21). 6.The pharmaceutical composition of claim 1, wherein the composition is administered in combination with a GLP-1 receptor agonist or a GLP-1 / GIP receptor dual agonist. 7.The pharmaceutical composition of claim 6, wherein the GLP-1 receptor agonist is selected from the group consisting of semaglutide, liraglutide, exenatide, tasoglutide, albiglutide, lixisenatide and dulaglutide. 8.The pharmaceutical composition of claim 6, wherein the GLP-1 / GIP receptor dual agonist is selected from the group consisting of tirzepatide, NN9709, SAR-438335 and ZP-DI-70. 9.The pharmaceutical composition of claim 6, wherein the composition is administered alone, simultaneously or sequentially with the GLP-1 receptor agonist or the GLP-1 / GIP receptor dual agonist. ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ 10.A combination preparation for preventing or treating obesity, comprising: a first active ingredient comprising a GLP-1 receptor agonist or a GLP-1 / GIP receptor dual agonist; and a second active ingredient comprising a double-stranded RNAi agent comprising a sense strand and an antisense strand, wherein the antisense strand consisting of EVP-mU*fG*mAmGmUmAfAmGfCmAmAmUmCfUmG*fG*mU*mC*mC*mU, P-mA*fG*mAmUmCfCmAfGfAmGmCmUmGfCmG*fC*mC*mA*mC or EVP-mU*fG*mAmUmCfCmAfGfAmGmCmUmGfCmG*fC*mC*mA*mC complementary to a MARC1 mRNA sequence, the sense strand consisting of mC*mC*mAfGmAfUmUmGmCmUmUmAmCmUmCmA-GalNAc, mG*fC*mGfCfAfGmCfUmCfUmGfGmAfUmCfU-GalNAc or mG*fC*mGfCfAfGmCfUmCfUmGfGmAfUmCfA-GalNAc, wherein, * indicates a modified phosphorothioate bond, m indicates a substitution of 2'-O-methyl, P indicates a binding of 5'-phosphate group, f indicates a substitution of 2'-fluoro, EVP indicates a binding of 5'-E-ethylenylphosphonate, and GalNAc indicates a binding of N-acetylgalactosamine derivative. 11.The combination preparation of claim 10, wherein the GLP-1 receptor agonist is selected from the group consisting of semaglutide, liraglutide, exenatide, tasoglutide, albiglutide, lixisenatide and dulaglutide. 12.The combination preparation of claim 10, wherein the GLP-1 / GIP receptor dual agonist is selected from the group consisting of tirzepatide, NN9709, SAR-438335 and ZP-DI-70. 13.The combination preparation of claim 10, wherein the N-acetylgalactosamine derivative is a compound of the following Chemical Formula 1: 14.The combination preparation of claim 10, wherein 5' end of the antisense strand and 3' end of the sense strand form a blunt end. 15.The combination preparation of claim 10, wherein the first active ingredient and the second active ingredient are administered separately, simultaneously or sequentially. 16.A kit for preventing or treating obesity, comprising the combination preparation of any one of claims 10 to 15, and provided to an individual in a form that the first active ingredient is contained in a first compartment and the second active ingredient is contained in a second compartment.

Images