SiRNA preparation for treating benign prostatic hyperplasia

Abstract

The invention discloses a siRNA preparation for treating benign prostatic hyperplasia, and belongs to the technical field of biological pharmacy. By analyzing mRNA sequences of human and rat SRD5A2, two siRNA sequences for silencing SRD5A2 protein expression are designed and synthesized. The two kinds of siRNA transfect human normal prostate matrix immortalized cells through lipidosome, and both siRNA-1 and siRNA-2 can achieve a good SRD5A2 gene silencing effect. Two siRNA-liposome compounds are intravenously injected into a benign prostatic hyperplasia model rat induced by testosterone propionate, and the siRNA-1 and the siRNA-2 can effectively silence the expression of the SRD5A2 in the rat body. After a prostatic hyperplasia model rat is treated by the two siRNAs, the content of dihydrotestosterone DHT in serum is remarkably reduced compared with that of an untreated model group, and the prostate index is also remarkably reduced.

Description

Technical Field

[0001] This invention belongs to the field of biopharmaceutical technology, and in particular relates to an siRNA preparation for treating benign prostatic hyperplasia. Background Technology

[0002] Benign prostatic hyperplasia (BPH) is a common disease among middle-aged and elderly men, and its prevalence is positively correlated with patient age. In recent years, with the increasing aging of the population, the number of patients with BPH in China has continued to rise, making BPH an important medical problem. The molecular mechanism of BPH is not yet clear. However, most studies currently believe that its pathogenesis is related to 5α-reductase. 5α-reductase is an enzyme involved in hormone metabolism, mainly with two phenotypes, type 1 and type 2 (steroid 5α-reductase type 1, SRD5A1; steroid 5α-reductase type 2, SRD5A2). It is distributed in the skin, hair, prostate, epididymis, etc. The function of 5α-reductase is to convert testosterone (T) to dihydrotestosterone (DHT). DHT has stronger activity than T and can competitively replace T in binding to androgen receptors, thereby promoting rapid cell proliferation and leading to prostatic hyperplasia. SRD5A1 is mainly expressed in sebaceous glands, scalp hair follicles, and the liver, while SRD5A2 is most highly expressed in prostate stromal cells, such as fibroblasts and smooth muscle cells, and is the main site of DHT production, promoting prostate growth. Currently, 5α-reductase inhibitors used clinically include finasteride and dutasteride. However, these chemical drugs have been reported to have significant side effects in practical applications.

[0003] Small interfering RNA (siRNA) is a short double-stranded RNA molecule, typically composed of 20-25 nucleotides. It plays a crucial role in RNA interference (RNAi), efficiently and specifically silencing the expression of target genes. In recent years, siRNA drugs have become a research hotspot due to their significant efficacy, and several siRNA drugs have been marketed globally. Interfering with SRD5A2 expression using siRNA technology can achieve similar efficacy to 5α-reductase inhibitors with fewer side effects, and can play a role in the treatment of benign prostatic hyperplasia (BPH). Identifying siRNA targets on SRD5A2 and designing them rationally holds promise for developing siRNA drugs to replace traditional 5α-reductase inhibitors as novel small nucleic acid drugs for the treatment of BPH. Summary of the Invention

[0004] The purpose of this invention is to provide an siRNA preparation for treating benign prostatic hyperplasia, belonging to the field of biopharmaceutical technology.

[0005] To achieve the above objectives, the present invention provides the following technical solution: First, the present invention provides an siRNA preparation for treating benign prostatic hyperplasia, wherein the siRNA is selected from any of the following: (a) The sense chain sequence is shown in SEQ ID NO.1, and the antisense chain sequence is shown in SEQ ID NO.2; (b) The positive chain sequence is shown in SEQ ID NO.3, and the negative chain sequence is shown in SEQ ID NO.4.

[0006] Furthermore, the siRNA targets the human SRD5A2 gene.

[0007] Furthermore, the siRNA formulation is an siRNA-liposome complex prepared from siRNA and lipid nanoparticles.

[0008] Secondly, the present invention provides a pharmaceutical composition comprising the siRNA (a) and (b) as described in claim 1 and a pharmaceutically acceptable carrier.

[0009] Thirdly, this invention provides an siRNA for reducing human serum dihydrotestosterone levels, wherein the siRNA is selected from any of the following: (a) The sense chain sequence is shown in SEQ ID NO.1, and the antisense chain sequence is shown in SEQ ID NO.2; (b) The positive chain sequence is shown in SEQ ID NO.3, and the negative chain sequence is shown in SEQ ID NO.4.

[0010] Fourth, this invention provides a siRNA targeting the rat SRD5A2 gene, wherein the siRNA is selected from any of the following: (a) The sense chain sequence is shown in SEQ ID NO.1, and the antisense chain sequence is shown in SEQ ID NO.2; (b) The positive chain sequence is shown in SEQ ID NO.3, and the negative chain sequence is shown in SEQ ID NO.4.

[0011] Fifth, the present invention provides an siRNA for reducing serum dihydrotestosterone levels in rats, wherein the siRNA is selected from any of the following: (a) The sense chain sequence is shown in SEQ ID NO.1, and the antisense chain sequence is shown in SEQ ID NO.2; (b) The positive chain sequence is shown in SEQ ID NO.3, and the negative chain sequence is shown in SEQ ID NO.4.

[0012] The beneficial effects of this invention are as follows: This invention designs and synthesizes two siRNA sequences for silencing SRD5A2 protein expression by analyzing the mRNA sequences of SRD5A2 in humans and rats. Both siRNAs were transfected into immortalized human normal prostate stromal cells via liposomes. Both siRNA-1 and siRNA-2 achieved good SRD5A2 gene silencing effects. Intravenous injection of the two siRNA-liposome complexes into a rat model of benign prostatic hyperplasia induced by testosterone propionate showed that both siRNA-1 and siRNA-2 effectively silenced SRD5A2 expression in rats. After treatment with the two siRNAs, the serum dihydrotestosterone (DHT) level in the benign prostatic hyperplasia model rats was significantly lower than that in the untreated model group, and the prostate index was also significantly reduced. Both siRNA-1 and siRNA-2 of this invention have good therapeutic effects on benign prostatic hyperplasia. Attached Figure Description

[0013] Figure 1 Figure showing the effect of siRNA on the expression level of SRD5A2 in immortalized human normal prostate stromal cells; Figure 2 The graph shows the effect of siRNA on dihydrotestosterone levels in rats. Figure 3 Figure showing the effect of siRNA on the prostate index in BPH model rats; Figure 4 This is a graph showing the silencing efficiency of siRNA-1 on the rat SRD5A2 gene. Detailed Implementation

[0014] The following is a more detailed description of the present invention, illustrated by examples. It should be understood that these examples are merely illustrative of the invention and are intended to explain the principles and functions of the invention, and are not intended to limit the scope of protection of the invention.

[0015] Example 1: SRD5A2 (SRD5A2) siRNA Design In order to design siRNA that can efficiently inhibit the translation of 5α-reductase type 2 (SRD5A2) mRNA into active SRD5A2, and at the same time evaluate the therapeutic effect of siRNA on benign prostatic hyperplasia in a rat animal model of benign prostatic hyperplasia (BPH model), siRNA that can silence SRD5A2 expression in both humans and rats was designed. The gene sequences of Homo sapiens steroid 5alpha-reductase 2 (SRD5A2) mRNA and Rattus norvegicus steroid 5 alpha-reductase 2 (Srd5a2) mRNA were retrieved from GenBank. Referring to sequences NM_000348.4, XM_011533072.3, XM_011533069.3, XM_054343551.1, XM_054343550.1, XM_054343549.1, and NM_022711.5, the designed siRNA-1 sequence is as follows: (a) Chain of Justice: 5'-cauuacuuccacaggacauuu-3'; Antonym chain: 5'-aaauguccuguggaaguaauguu-3'.

[0016] The designed siRNA-2 sequence is as follows: (b) Chain of Justice: 5'-cagcucaggaagccuggagaa-3'; Antonym chain: 5'-uucuccaggcuuccugagcuguu-3'.

[0017] The synthesis and purification were commissioned to Sangon Biotech (Shanghai) Co., Ltd.

[0018] Example 2: Effect of siRNA on SRD5A2 expression level in normal human prostate stromal immortalized cells (1) Cell seeding: Immortalized human normal prostate stromal cells WPMY-1 were seeded into 6-well plates, and 2 mL of 1×10⁻⁶ cells were added to each well. 6 Cell culture medium was incubated at 37°C in a CO2 incubator until approximately 70% confluence was achieved. Four wells were also set up for a blank control (NC group), and four wells each for siRNA-1 and siRNA-2 groups.

[0019] (2) Transfection solution preparation: Prepare the following two solutions in EP tubes: Solution A: Dilute siRNA-1 and siRNA-2 to a final concentration of 50 nM with 125 μL of Opti-MEM™ medium, and add 5 μL of P3000™ reagent and mix thoroughly. Solution B: Add 7.5 μL of Lipofectamine™ 3000 reagent to 125 μL of Opti-MEM™ medium and mix thoroughly. Add the mixed solution A dropwise to solution B and mix thoroughly. Incubate at room temperature for 10-15 minutes to form siRNA lipid complex.

[0020] (3) Transfection preparation: Wash the cells twice with 2 mL of serum-free culture medium, and then add 1 mL of serum-free culture medium.

[0021] (4) Transfection: Slowly add the siRNA lipid complex to the culture medium, shake well, incubate at 37°C in a carbon dioxide incubator for 6 hours, remove the serum-free transfection solution, and replace with normal culture medium to continue culturing.

[0022] (5) Culture conditions: Continue to culture in a 37°C, 5% CO2 incubator for 48 hours.

[0023] (6) Verification of mRNA silencing efficiency: Total RNA was extracted 48 hours after transfection (Trizol method). It was reverse transcribed into cDNA and used for SRD5A2 real-time PCR with SRD5A2 primers / SRD5A2r primers. At the same time, GAPDHf / GAPDHr primers were used for real-time PCR of the internal reference gene GAPDH.

[0024] SRD5A2f: TTCACCACCATAGGTTCTAC; SRD5A2r:AGATGAATGGAATAAGGGCT.

[0025] GAPDHf: AGCAAGAGCACAAGAGGAAG; GAPDHr:TCTACATGGCAACTGTGAG.

[0026] (7) Calculate the silencing efficiency (ΔΔCt method, compared with negative control).

[0027] ΔCt experimental group = Ct target gene (experimental group) - Ct internal reference gene; ΔCtNC group = CtNC group - Ct internal reference gene; ΔCt = ΔCt_experimental group - ΔCt_NC_group; KD%=(1-2 -ΔΔCt )×100%.

[0028] from Figure 1The results showed that siRNA-1 had a silencing efficiency of 83.63% on the SRD5A2 gene, while siRNA-2 had a silencing efficiency of 81.79%. Both siRNAs achieved good silencing effects on the SRD5A2 gene.

[0029] Example 3: Therapeutic effect of siRNA on a rat model of benign prostatic hyperplasia (1) Animal grouping and administration: Forty clean-grade male SD rats, weighing 180-200g, were used. They were allowed free access to food and water, with a 12 / 12 h photoperiod, an ambient temperature of 22-23℃, and a relative humidity of 45%-50%. After one week of acclimatization, the rats were weighed and randomly divided into four groups according to their weight: normal control group, BPH model group, siRNA-1 group, and siRNA-2 group. Animals in the BPH model group and siRNA group were subcutaneously injected with testosterone propionate 5mg / kg once a day for a total of 4 weeks to induce a prostatic hyperplasia model. Three weeks after the prostatic model was induced, the siRNA-1 group and siRNA-2 group were intravenously injected with siRNA-liposome complex 200μL / day for one week.

[0030] (2) One day before the end of the sample collection experiment, the animals were fasted for 12 hours, weighed, and then anesthetized with 1 mL / kg of 3% pentobarbital. Blood was collected from the abdominal aorta, centrifuged at 3000 r / min for 10 minutes, and the serum was separated. The dihydrotestosterone (DHT) content of each group was detected using an ELISA kit. The animals were then sacrificed, and the prostate was collected, weighed, and the prostate index was calculated. Prostate index = prostate wet weight (g) / animal body weight (g).

[0031] from Figure 2 The results showed that the dihydrotestosterone content in the normal control group was 149.85 pg / mL, the prostate index in the benign prostatic hyperplasia model group was 635.34 pg / mL, the prostate index in the siRNA-1 group decreased to 313.95 pg / mL, and the prostate index in the siRNA-2 group decreased to 336.71 pg / mL.

[0032] from Figure 3 The results showed that the prostate index of rats in the normal control group was 3.55 mg / g, the prostate index of rats in the benign prostatic hyperplasia model group was 5.79 mg / g, the prostate index of rats in the siRNA-1 group decreased to 3.55 mg / g, and the prostate index of rats in the siRNA-2 group decreased to 4.31 mg / g.

[0033] (3) After weighing, the prostate was homogenized and total RNA was extracted (Trizol method). It was reverse transcribed into cDNA, and SRD5A2 real-time PCR was performed using SRD5A2f / SRD5A2r primers. At the same time, GAPDHf / GAPDHr real-time PCR was performed using the internal reference gene GAPDH. The silencing efficiency was calculated (ΔΔCt method, compared with the normal control group).

[0034] ΔCt experimental group = Ct target gene (experimental group) - Ct internal reference gene; ΔCt control group = Ct control group - Ct internal reference gene; ΔCt = ΔCt experimental group - ΔCt control group; KD%=(1-2 -ΔΔCt )×100%.

[0035] from Figure 4 The results showed that siRNA-1 had a silencing efficiency of 80.78% on the rat SRD5A2 gene, while siRNA-2 had a silencing efficiency of 77.28% on the rat SRD5A2 gene. Both siRNAs achieved good SRD5A2 gene silencing effects in rats.

[0036] It is evident that siRNA-1 and siRNA-2 of this invention can effectively silence SRD5A2 expression in both human normal prostate stromal immortalized cells WPMY-1 and rats. In rats with benign prostatic hyperplasia (BPH) models, serum dihydrotestosterone (DHT) levels were significantly lower than in the untreated group, and the prostate index was also significantly reduced. Both siRNA-1 and siRNA-2 of this invention have good therapeutic effects on benign prostatic hyperplasia.

Claims

1. A siRNA preparation for treating benign prostatic hyperplasia, characterized in that, The siRNA is selected from any of the following: (a) The sense chain sequence is shown in SEQ ID NO.1, and the antisense chain sequence is shown in SEQ ID NO.2; (b) The positive chain sequence is shown in SEQ ID NO.3, and the negative chain sequence is shown in SEQ ID NO.

4.

2. The siRNA formulation according to claim 1, characterized in that, The siRNA targets the human SRD5A2 gene.

3. The siRNA formulation according to claim 1, characterized in that, The siRNA formulation is an siRNA-liposome complex prepared from siRNA and lipid nanoparticles.

4. A pharmaceutical composition, characterized in that, The pharmaceutical composition comprises the siRNA (a) and (b) as described in claim 1 and a pharmaceutically acceptable carrier.

5. A siRNA for reducing human serum dihydrotestosterone levels, characterized in that, The siRNA is selected from any of the following: (a) The sense chain sequence is shown in SEQ ID NO.1, and the antisense chain sequence is shown in SEQ ID NO.2; (b) The positive chain sequence is shown in SEQ ID NO.3, and the negative chain sequence is shown in SEQ ID NO.

4.

6. A siRNA targeting the rat SRD5A2 gene, characterized in that, The siRNA is selected from any of the following: (a) The sense chain sequence is shown in SEQ ID NO.1, and the antisense chain sequence is shown in SEQ ID NO.2; (b) The positive chain sequence is shown in SEQ ID NO.3, and the negative chain sequence is shown in SEQ ID NO.

4.

7. A siRNA for reducing serum dihydrotestosterone levels in rats, characterized in that, The siRNA is selected from any of the following: (a) The sense chain sequence is shown in SEQ ID NO.1, and the antisense chain sequence is shown in SEQ ID NO.2; (b) The positive chain sequence is shown in SEQ ID NO.3, and the negative chain sequence is shown in SEQ ID NO.4.

Images