Synsepalum dulcificum protein-encoding gene endogenous promoter and application thereof

By cloning and validating the endogenous promoter and its truncated form of the Miraculin gene from Miraculin fruit, the problem of insufficient promoter research in gene editing and molecular breeding of Miraculin fruit was solved, enabling efficient expression and optimization of the Miraculin fruit genetic system, and improving the expression level and purity of Miraculin.

CN120924544BActive Publication Date: 2026-02-06HAINAN UNIVERSITY SANYA NANFAN RESEARCH INSTITUTE
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202511466588.4
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-10-14
Publication Date
2026-02-06
Estimated Expiration
2045-10-14

AI Technical Summary

Technical Problem

In the current technology, there is limited research on the promoter of the miracle fruit protein-encoding gene, which limits the development of miracle fruit gene editing and molecular breeding technology, especially in terms of efficient expression of miraculin.

Method used

The endogenous promoter proSdMIR.1 of the Miraculin gene and its truncated forms proSdMIR.1.2, proSdMIR.1.3, and proSdMIR.1.4 were cloned and fused with the GUS gene to construct a recombinant vector. The transcriptional activity of the vector was verified by infecting Arabidopsis thaliana with Agrobacterium-mediated transformation.

Benefits of technology

This study achieved efficient expression of the Miraculin gene promoter in Miraculin, optimized the genetic system of Miraculin, provided stable genetic resources and superior traits of Miraculin, and improved the expression level and purity of Miraculin.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120924544B_ABST
    Figure CN120924544B_ABST
Patent Text Reader

Abstract

The application discloses a miraculin gene endogenous promoter and application thereof. The miraculin gene endogenous promoter is any one of proSdMIR.1, proSdMIR.1.2, proSdMIR.1.3 and proSdMIR.1.4, the DNA nucleotide sequence of proSdMIR.1 is shown as SEQ ID NO.3, the DNA nucleotide sequence of proSdMIR.1.2 is shown as SEQ ID NO.4, the DNA nucleotide sequence of proSdMIR.1.3 is shown as SEQ ID NO.5, and the DNA nucleotide sequence of proSdMIR.1.4 is shown as SEQ ID NO.6. The miraculin gene promoter provided by the application is of great significance for optimizing a genetic system of miraculin and creating a miraculin germplasm resource with excellent traits.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, particularly the field of plant transgenic technology, and specifically relates to an endogenous promoter for a protein-encoding gene of miracle fruit and its application. Background Technology

[0002] Miracle fruit ( Synsepalum dulcificum Daniell, also known as the miracle fruit or the variegated fruit, belongs to the genus *Miracle Fruit* of the family Sapotaceae. Synsepalum dulcificum Miracle fruit is a perennial, low-growing shrub native to tropical West Africa. Introduced to my country in the 1960s, it is now cultivated in southern regions such as Guangdong, Guangxi, Yunnan, and Hainan. Its various tissues and parts are rich in flavonoids and phenolic compounds, exhibiting significant antioxidant activity. Among these, the signature component of miracle fruit—miraculin—is a natural acidic glycoprotein that requires no chemical synthesis. It possesses unique taste-modifying functions and, after being ingested, can be broken down into amino acids for human absorption and digestion. It has enormous application value and development potential in the food processing industry and the medical and health fields.

[0003] Gene editing technology is a revolutionary biotechnology that, based on a variety of tools, enables scientists to precisely edit and alter specific gene sequences. Applications of gene editing technology in agriculture include improving crop disease resistance and stress tolerance, modifying nutrient composition, increasing yield, and reducing pesticide use. Currently, the CRISPR-Cas system is the most widely used technology in plant gene editing. CRISPR-Cas technology is a gene editing technology developed based on bacterial innate immune mechanisms, achieving targeted modification of the genome through guide RNA precise positioning and Cas protein cleavage of DNA.

[0004] Promoters are not transcribed by themselves on DNA chains, and are mainly responsible for recruiting RNA polymerase and transcription factors, and their characteristics are initially identified by mutations that can increase or decrease the transcription rate of genes, and are mainly divided into constitutive, inducible and tissue-specific. The promoter region includes core elements such as TATA-box and CAAT-box, and multiple conserved 'cis-acting elements' that respond to hormones and environmental signals. The sequence is generally located upstream of the transcription start site of the structural gene. Gene expression regulation technology covers multiple levels, namely transcription, post-transcription, translation and post-translational regulation. As a 'fixed switch' on the DNA chain, the promoter, after combining with the trans-acting factor, regulates the expression of the gene on the DNA chain, and different promoters have different cis-acting element compositions, resulting in different expression of the regulated gene under different growth environment conditions and growth states such as temperature, light and growth period. The modification of endogenous promoters and the introduction of exogenous promoters mainly act on the transcription initiation stage, which is the core technology of current transcriptional regulation.

[0005] In the current plant genetic engineering and synthetic biological expression system, the most widely used heterologous promoter is the CaMV35S promoter from the cauliflower mosaic virus. Previous studies have used the CaMV35S promoter to connect the miraculin-encoding gene and introduce it into lettuce, strawberry and other plants, and stably inherit it to the offspring, but the content of miraculin in the offspring is extremely low. In transgenic tomatoes, miraculin can be stably inherited and highly expressed, but there are still major problems in purification. Previous studies have extracted high-purity and non-inactivated recombinant miraculin from transgenic tomatoes through nickel column chromatography combined with ion exchange chromatography, but this method is high in cost for industrial application and is not conducive to mass production and application. It also needs to be improved. In terms of endogenous promoters, the U6 endogenous promoter has been used to construct CRISPR / Cas9 editing systems in rice, Arabidopsis, tobacco, wheat, lettuce and grape species, and high-efficiency editing systems have been achieved.

[0006] At present, there are few studies on the promoter of miraculin, which hinders the research on gene editing and molecular breeding technology of miraculin. SUMMARY

[0007] The purpose of the present application is to solve the above problems, and provide a miraculin-encoding gene endogenous promoter and its application.

[0008] In order to achieve the purpose of the present application, the technical scheme adopted by the present application is:

[0009] The first aspect of the present application provides a Physalis alkekengi L. protein coding gene endogenous promoter, wherein the Physalis alkekengi L. protein coding gene endogenous promoter is any one of proSdMIR.1, proSdMIR.1.2, proSdMIR.1.3 and proSdMIR.1.4, the DNA nucleotide sequence of the proSdMIR.1 is shown in SEQ ID NO. 3, the DNA nucleotide sequence of the proSdMIR.1.2 is shown in SEQ ID NO. 4, the DNA nucleotide sequence of the proSdMIR.1.3 is shown in SEQ ID NO. 5, and the DNA nucleotide sequence of the proSdMIR.1.4 is shown in SEQ ID NO. 6.

[0010] The second aspect of the present application provides an expression cassette containing the above-mentioned promoter.

[0011] The third aspect of the present application provides a recombinant vector containing the above-mentioned promoter or the above-mentioned expression cassette.

[0012] Preferably, the recombinant vector is a recombinant expression vector or a recombinant cloning vector.

[0013] Preferably, the backbone vector of the recombinant expression vector is a plant binary expression vector pCAMBIA1303, and the backbone vector of the recombinant cloning vector is pMD 19-T.

[0014] The fourth aspect of the present application provides a recombinant bacterium containing the above-mentioned promoter, expression cassette or recombinant vector.

[0015] The fifth aspect of the present application provides the above-mentioned Physalis alkekengi L. protein coding gene endogenous promoter for any one of the following applications:

[0016] (1) application in constructing an expression cassette, a recombinant vector or a recombinant bacterium;

[0017] (2) application in constructing a transgenic plant;

[0018] (3) application in plant molecular breeding;

[0019] (4) application in starting expression of a target gene in a plant;

[0020] The plant is Physalis alkekengi L. or Arabidopsis thaliana.

[0021] The sixth aspect of the present application provides a method for expressing a target nucleic acid molecule in a plant, which comprises introducing a nucleic acid construct into the plant, wherein the nucleic acid construct contains the above-mentioned promoter and a target nucleic acid molecule operably linked to the promoter, and the plant is Physalis alkekengi L. or Arabidopsis thaliana.

[0022] The present application has the following beneficial effects:

[0023] The present application first clones the endogenous promoter of the miraculin gene, proSdMIR.1, in the genome DNA of miracle fruit, fuses it with the GUS gene through homologous recombination, and uses the agrobacterium-mediated method to infect the inflorescences of Arabidopsis thaliana, obtains T2 generation transgenic Arabidopsis thaliana, and verifies that the promoter has transcriptional activity in the rosette leaves, petioles, stems, pods and flower tissues of the transgenic Arabidopsis thaliana through stable expression of GUS, thereby providing a key molecular tool support for exploring the stable genetic system of miracle fruit in the later stage. In addition, the present application first truncates the miraculin gene promoter proSdMIR.1 with the starting activity to obtain miraculin gene truncated promoters proSdMIR.1.2, proSdMIR.1.3 and proSdMIR.1.4, respectively, constructs GUS gene fusion expression vectors for experiments, and the results show that the miraculin gene truncated promoters still have starting activity, and the activities of different truncations are significantly different, and the transcriptional activity of the proSdMIR.1.2 promoter truncated to 1389bp is the highest, which is higher than that of the control CaMV 35S promoter. The miraculin gene promoter provided by the present application has important significance for optimizing the genetic system of miracle fruit and creating excellent trait miracle fruit germplasm resources. BRIEF DESCRIPTION OF DRAWINGS

[0024] Figure 1 It is an agarose gel electrophoresis diagram of miracle fruit DNA genome.

[0025] Figure 2 It is an agarose gel electrophoresis diagram of proSdMIR.1 promoter amplification bands.

[0026] Figure 3 It is an agarose gel electrophoresis diagram of proSdMIR.1 promoter truncation body cloning detection.

[0027] Figure 4 It is an agarose gel electrophoresis diagram of proSdMIR.1 promoter and T1 generation transgenic Arabidopsis thaliana PCR positive identification of truncated promoter.

[0028] Figure 5 It is a GUS staining diagram of T2 generation transgenic Arabidopsis thaliana plant leaves of proSdMIR.1 promoter and GUS fusion expression vector of truncated promoter.

[0029] Figure 6 It is a GUS gene quantification result diagram of T2 generation transgenic Arabidopsis thaliana plants of proSdMIR.1 promoter and GUS fusion expression vector of truncated promoter.

[0030] Figure 7GUS staining pictures of different tissues of T2 generation transgenic Arabidopsis thaliana plants of proSdMIR.1 promoter and its truncated promoter GUS fusion expression vector. DETAILED DESCRIPTION

[0031] In order to make the objects, technical solutions and advantages of the present application clearer, the present application will be further described in detail below in combination with embodiments. It should be understood that the specific embodiments described herein are only used to explain the present application and do not limit the present application.

[0032] The methods involved in the following examples are all conventional methods unless otherwise specified.

[0033] Example 1 Obtaining of sequence of endogenous promoter proSdMIR.1 of Miraculin gene of miracle fruit

[0034] The research team of the present application has previously established a transcriptome database of miracle fruit, and the research team of the present application has studied the miracle fruit protein Chr10G0299340 The sequence of the gene is completely consistent with the sequence of the miracle fruit protein gene (GenBank: BAH84844.1) reported by others. The transcriptome research of the research team of the present application found that the miracle fruit protein (Miraculin) gene MIR, Chr10G0299340 ) is the gene with the highest expression level in the miracle fruit fruit, and further research showed that the MIR expression level of the gene in 6 tissues and 3 periods of miracle fruit, it was found that the gene was almost not expressed in roots, stems and leaves, had a certain expression level in seeds and flowers, and the expression level was always increasing during fruit development, and reached the highest in mature fruit, and was also the gene with the highest expression level in the transcriptome data of 6 tissues and 3 periods of miracle fruit (reference to the doctoral dissertation of Hainan University “Research on Genome Assembly of Miracle Fruit, Functional Evolution of Miracle Protein and Molecular Basis of Anthocyanin Synthesis” Yang Zhuang, 2022). The genome sequencing data of miracle fruit has been stored in CNGBdb CNGB sequence archive, accession number CNP0002330 (https: / / db.cngb.org / data_resources / project / CNP0002330). The transcriptome sequencing data has been stored in NCBI Sequence Read Archive database, accession number PRJNA778426 (https: / / www.ncbi.nlm.nih.gov / bioproject / PRJNA778426 / ).

[0035] According to the results of the previous research, we speculate that the promoter of the Miraculin gene has high efficiency, which may even be higher than the efficiency of the 35S promoter, so the present application is developed.

[0036] According to the sequence of the miracle fruit protein gene (MIR, Chr10G0299340 ), the upstream reference sequence of the gene was obtained, and the primer design tool Primer Premier 5 was used to design the amplification primer pair JT-Miraculin-s-F and JT-Miraculin-s-R to amplify the promoter of the Miraculin gene (named proSdMIR.1) plus a 51 bp sequence of the Miraculin gene containing the start codon. The nucleotide sequences of the primers JT-Miraculin-s-F and JT-Miraculin-s-R are:

[0037] JT-Miraculin-s-F (SEQ ID NO. 1):

[0038] 5'-TATTTCGGGTTTACAAAATTTTTGAA-3';

[0039] JT-Miraculin-s-R (SEQ ID NO. 2):

[0040] 5'-CAATGCAGAGACGAAGAAGAACG-3'.

[0041] 100 mg of fresh miracle fruit pulp was selected, frozen with liquid nitrogen, and ground into fine powder, and the CATB method was used to extract the genomic DNA of the miracle fruit pulp. The DNA concentration was determined by spectrophotometer, and the DNA quality was detected by agarose gel electrophoresis, and the results are shown in Figure 1 . The genomic DNA of the miracle fruit pulp was used as a template, and the PrimeSTAR® Max DNA Polymerase high-fidelity polymerase of Baorui Medical Biotechnology (Beijing) Co., Ltd. was used for PCR amplification. The reaction system was 1 μL of 10 μM JT-Miraculin-s-F / JT-Miraculin-s-R primer, 200 ng-500 ng of miracle fruit genomic DNA, 25 μL of PrimeSTAR® Max DNA Polymerase, and sterile water was added to 50 μL; the reaction program was 95°C pre-denaturation for 3 min; then 95°C for 15 s, 54°C for 2 min, 72°C for 30 s, 35 cycles; 72°C, 5 min, and the amplification results are shown in Figure 2 . The amplification band is 1872 bp, which is a 1821 bp promoter sequence + a 51 bp gene sequence.

[0042] Take 40 μL PCR product plus 9 μL Nanjing Novozyme Bio-tech Co., Ltd. 2x Taq Master Mix DNA polymerase, 72°C reaction for 20 min, add A tail, then measure the concentration, use pMDm19-T Vector Cloning Kit (TaKaRa, Japan) to construct the vector, the connection vector system is: Solution I 5 μL, pMD 19-T Vector 1 μL, PCR plus A tail product 800 ng, sterilized water to 10 μL, 16°C overnight connection to T vector pMD 19-T. Then through the chemical transformation method into the E. coli DH5α, after plating, pick bacteria for bacterial liquid PCR identification, correct after Sanger sequencing results, named p19T-proSdMIR.1, the inserted amplified fragment sequence is shown as SEQ ID NO. 12, which is the proSdMIR.1 promoter sequence + 51 bp of the Miraculin gene sequence shown in SEQ ID NO. 3.

[0043] Example 2 Construction of GUS fusion expression vector of Synsepalum dulcificum Miraculin gene promoter

[0044] The endogenous promoter proSdMIR.1 (1821 bp, nucleotide sequence as shown in SEQ ID NO. 3) of Synsepalum dulcificum in Example 1 was truncated from the 5' end to obtain three different truncations: the first truncation was 1389 bp, named proSdMIR.1.2 (nucleotide sequence as shown in SEQ ID NO. 4); the second truncation was 785 bp, named proSdMIR.1.3 nucleotide sequence as shown in SEQ ID NO. 5); the third truncation was 542 bp, named proSdMIR.1.4 nucleotide sequence as shown in SEQ ID NO. 6). The amplification primers of the truncation fragments were designed, and 19 bp of vector homologous arm sequences were added to the 5' end of the primers.

[0045] The p19T-proSdMIR.1 bacterial liquid in Example 1 was used as a template, and PCR amplification was performed using PrimeSTAR® Max DNA Polymerase high-fidelity polymerase (TaKaRa, Japan), and the reaction system was 50 μL: 1 μL of 10 μM concentration of upstream and downstream primers, 1 μL of p19T-proSdMIR.1 bacterial liquid, 25 μL of PrimeSTAR® Max DNA Polymerase, and sterilized water was added to 50 μL; the PCR reaction program was: 95°C pre-denaturation for 5 min; 95°C for 30 s, 65°C for 45 s, 72°C for 90 s, 35 cycles, 72°C for 5 min. The amplification primer sequences of proSdMIR.1, proSdMIR.1.2, proSdMIR.1.3, and proSdMIR.1.4 were (where the underlined lowercase bases were the vector homologous arm sequences):

[0046] The proSdMIR.1 promoter PCR amplification primer pair was JT-Miraculin-s-1 F / JT-Miraculin-s-1 R:

[0047] JT-Miraculin-s-1 F (SEQ ID NO. 7):

[0048] 5’- agctcggtacccggggatc TATTTCGGGTTTACAAAATTTTTGAA-3’;

[0049] JT-Miraculin-s-1 R (SEQ ID NO. 8):

[0050] 5’- actagtcagatctaccatg TGTTGTAGAGACTATAGGGCTGTTGAT-3’;

[0051] The proSdMIR.1.2 promoter PCR amplification primer pair was JT-Miraculin-s-2 F / JT-Miraculin-s-1 R:

[0052] JT-Miraculin-s-2 F (SEQ ID NO. 9):

[0053] 5’- agctcggtacccggggatc CAAAATTGGGGTTGCAAATGTAAT-3’;

[0054] The proSdMIR.1.3 promoter PCR amplification primer pair was JT-Miraculin-s-3 F / JT-Miraculin-s-1 R:

[0055] JT-Miraculin-s-3 F (SEQ ID NO. 10):

[0056] 5'- AAGCTTATATCAAAAGCAATATCCCCTTTTGA -3'; agctcggtacccggggatc

[0057] JT-Miraculin-s-4 F (SEQ ID NO. 11):

[0058] 5'- AAGCTTAATAAGAGAAGAGAGGTGATTGGCA -3';

[0059] agctcggtacccggggatc

[0060] The downstream amplification primer of the promoters proSdMIR.1.2, proSdMIR.1.3, proSdMIR.1.4 is JT-Miraculin-s-1 R (SEQ ID NO. 8).

[0061] PCR products were detected and identified by agarose gel electrophoresis (as shown in Figure 3 , PCR products were purified and recovered, sequenced, and the sequencing results showed that the sequence of the amplified band was the corresponding promoter sequence (SEQ ID NO. 3 or SEQ ID NO. 4 or SEQ ID NO. 5 or SEQ ID NO. 6) plus the vector homologous arm sequence at both ends. BamHI and Nco ​​​I The plant binary expression vector pCAMBIA1303 (the selection gene is a hygromycin gene) was digested by endonuclease overnight, and the linearized vector was recovered and purified. The promoter and the linearized vector were connected using the homologous recombination enzyme ClonExpress II One Step Cloning Kit (Novozyme, China). The connection system was: 5*CE II Buffer 2 μL, linearized vector 200 ng, promoter fragment 50 ng, sterilized water to 10 μL, and the homologous recombination was performed at 37°C for 30 min. The recombination product was obtained. The recombination product was transferred into E. coli DH5α competent cells, and the bacterial liquid PCR was identified. Four GUS fusion expression vectors of the miraculin gene promoter of the miracle fruit were successfully obtained: pCAMBIA1303-proSdMIR.1::GUS expression vector, pCAMBIA1303-proSdMIR.1.2::GUS expression vector, pCAMBIA1303-proSdMIR.1.3::GUS expression vector, and pCAMBIA1303-proSdMIR.1.4::GUS expression vector.

[0062] Example 3 Genetic transformation of the miraculin gene promoter GUS fusion expression vector

[0063] The miraculin gene promoter GUS fusion expression vector obtained in Example 2 was transferred into GV3101 Agrobacterium competent cells. Wild-type Arabidopsis (col) was used as the receptor, and the pCAMBIA1303-proSdMIR.1::GUS expression vector, the pCAMBIA1303-proSdMIR.1.2::GUS expression vector, the pCAMBIA1303-proSdMIR.1.3::GUS expression vector, and the pCAMBIA1303-proSdMIR.1.4::GUS expression vector were respectively transferred into Arabidopsis through the Agrobacterium infection method.

[0064] The seeds of Arabidopsis thaliana into which the Miraculin gene promoter GUS fusion expression vector was introduced were collected, and after being treated with 75% alcohol and sodium hypochlorite, were sown on 1 / 2 MS solid medium containing 60 mg / L of hygromycin selection antibiotic for resistance screening. After the plants grew true leaves and roots, they were transplanted into soil for planting. Five plants were selected for each vector, and the transgenic Arabidopsis thaliana rosette leaf genomic DNA was extracted for positive plant PCR identification. The amplification primers of each promoter were the corresponding PCR amplification primers of each promoter in Example 2. 2x Taq Master Mix DNA polymerase was used for PCR, and the PCR reaction system was as follows: 1 μL of 10 μM upstream and downstream primers, 100-200 ng of transgenic Arabidopsis thaliana rosette leaf genomic DNA, 5 μL of 2x Taq Master Mix, and sterile water to 10 μL. The reaction program was 95°C for 3 min; 95°C for 30 s, 65°C for 30 s, 72°C for 1 min, 35 cycles; and 72°C for 5 min. Five positive seedlings were selected for each recombinant vector for detection, as shown in FIG. 1, which shows that the size of the amplified band of each promoter in the transgenic Arabidopsis thaliana plant of each recombinant vector is correct. Figure 4

[0065] Example 4 Function verification of endogenous promoters proSdMIR.1, proSdMIR.1.2, proSdMIR.1.3, and proSdMIR.1.4 of Miraculin

[0066] The seeds of transgenic Arabidopsis thaliana of the positive T1 generation of the Miraculin gene promoter GUS fusion expression vector in Example 3 were collected, and after being treated with 75% alcohol, were sown on 1 / 2 MS medium containing 60 mg / L of hygromycin selection antibiotic for resistance screening. The Arabidopsis thaliana seedlings that grew true leaves and roots were transplanted into soil for further culture. The T2 generation of transgenic Arabidopsis thaliana plants of the Miraculin gene promoter GUS fusion expression vector were obtained.

[0067] ​The obtained T2 generation transgenic Arabidopsis plants were subjected to GUS histochemical staining. The steps were as follows: wild type Arabidopsis plants were used as negative controls, and transgenic Arabidopsis plants into which the binary expression vector pCAMBIA1303 (containing CaMV 35S promoter) was transferred were used as positive controls to detect the expression pattern and relative activity of GUS gene. The rosette leaves, petioles, stems, pods and flowers of the transgenic plants and wild type plants were immersed in freshly prepared GUS staining solution (200Ml: 0.7444 g EDTA-2Na + 0.3292 g potassium ferricyanide + 0.4224 g potassium ferrocyanide + 190 mL sodium phosphate buffer (PH 7.0) + 1 mL 10 mM X-Gluc), and stained at 37°C for 48 h. The GUS staining solution was washed with ultrapure water, and the leaves were placed in 75% alcohol to remove chlorophyll until the green color faded. The surface of the leaves was dried with absorbent paper, and the leaves were observed and photographed under a body microscope.

[0068] The T2 generation transgenic Arabidopsis and wild type Arabidopsis leaf tissues were cut, frozen in liquid nitrogen and ground into powder. GUS protein was extracted using a GUS reporter gene quantitative detection kit (Shanghai Bolson, China) according to the kit instructions, and the protein content was determined using a Bradford protein concentration determination kit (Shanghai Bolson, China) according to the kit instructions and a protein standard curve was prepared. The 4-MUG standard curve was prepared and the 4-MUG fluorescence value was determined according to the GUS reporter gene quantitative detection kit instructions.

[0069] The results of GUS histochemical staining are shown in Figure 5 No blue change was observed in wild type Arabidopsis, but a significant difference in blue color was observed in the leaf veins and petioles of transgenic Arabidopsis plants with CaMV 35S, proSdMIR.1, proSdMIR.1.2, proSdMIR.1.3 and proSdMIR.1.4 promoters. The blue color was deeper in CaMV 35S and proSdMIR.1.2, and the blue color was shallower in proSdMIR.1, proSdMIR.1.3 and proSdMIR.1.4.

[0070] The results of GUS reporter gene quantification are shown in Figure 6As shown, the proSdMIR.1.2 promoter has the highest GUS activity of 17463 pmol / min / mg; followed by the proSdMIR.1.3 promoter, 15045 pmol / min / mg; the CaMV 35S, 14731 pmol / min / mg; the proSdMIR.1, 13382 pmol / min / mg; and the proSdMIR.1.4 has the lowest GUS activity of 13105 pmol / min / mg.

[0071] The results of GUS staining and quantitative detection of the GUS gene in the transgenic Arabidopsis thaliana leaves show that the three promoter truncations of the proSdMIR.1 promoter have strong transcriptional activity in Arabidopsis thaliana, and the proSdMIR.1 promoter truncated to the proSdMIR.1.2 promoter has the highest transcriptional activity.

[0072] The results of GUS histochemical staining of each tissue of the T2 generation of transgenic Arabidopsis thaliana are shown in Table 3. Figure 7 As shown, no blue color is observed in the rosette leaves, petiole leaves, stems, fruit pods and flowers of the wild-type Arabidopsis thaliana plants. GUS staining is detected in the rosette leaves, petiole leaves, stems, fruit pods and flowers of the CaMV 35S, proSdMIR.1 promoter, proSdMIR.1.2 promoter, proSdMIR.1.3 promoter and proSdMIR.1.4 promoter transgenic Arabidopsis thaliana plants, indicating that the proSdMIR.1 promoter, proSdMIR.1.2 promoter, proSdMIR.1.3 promoter and proSdMIR.1.4 promoter have transcriptional activity in the rosette leaves, petiole leaves, stems, fruit pods and flowers.

[0073] The nucleotide sequences of the four promoters and the amplified fragments of JT-Miraculin-s-F / JT-Miraculin-s-R in the application are as follows:

[0074] 1. The sequence of the proSdMIR.1 promoter (SEQ ID NO. 3) is as follows:

[0075]

[0076] 2. The sequence of the promoter proSdMIR.1.2 (SEQ ID NO. 4) is as follows:

[0077]

[0078] 3. The sequence of the promoter proSdMIR.1.3 (SEQ ID NO. 5) is as follows:

[0079] TATATCAAAAGCAATATCCCCTTTTGAATCGTAGGCGACCCAAACAATTAGGTCGGGATTTTTTTTAATTTTTTTATGTAAGCTATTGAAATATCATCAGTCAATTGCCGTGGAGATAAATTAGGTCGGGATTGCAACATTTTTTTTTTTAATACCATTAAAATGTCGGTCATTTGTTGTGGATATAGTTTAGGCCGGGTTTTATGGTTTTTATTATTATTTTTTTAATACCATTAGAATATTAATAAGAGAAGAGAGGTGATTGGCAAAAAAAACTTGGGTTAGTTTGGTTTGAAAAAAAAAAAAAAAAAACTTTAAAAAACTCTACAATTTTCTAAGACTTATCTCACTGTACGTATTACGAACTCTCACTTTTTCTCATTTTCTCTCGTTTCAAATACTACCAAAATCTTTACATGAGACTGTTAGGCCCGACATCAATTAACAAGTGACAAACTCGAAGCCCCTAATGAAAGCTTTAGGCTTAGTTTGGAATGAAAAAATAGTAATTTTTTAACAAATTATTAAAATATTTAAAAAAAAAAAAGTTAATTTTTGTCAATTTAACATTTGTACCATTTATAATGAAAAGAATTAAAATATAAGTGATTAAATTTGATGAATTGAGAAAAAGTTAAAAAAAATTGAAATTGCCTAAATCTTACTCTCCCAAACGAAGCCTTAGCTTTCAACTCAGTGCTACGTGGCATTCGTATCTCTTCGTATCTATAAATAATTGTGAAGTGCCCACGTTGGTGATCAACAGCCCTATAGTCTCTACAACA.

[0080] 4. The sequence of the promoter proSdMIR.1.4 (SEQ ID NO. 6) is as follows:

[0081] AATAAGAGAAGAGAGGTGATTGGCAAAAAAAACTTGGGTTAGTTTGGTTTGAAAAAAAAAAAAAAAAAACTTTAAAAAACTCTACAATTTTCTAAGACTTATCTCACTGTACGTATTACGAACTCTCACTTTTTCTCATTTTCTCTCGTTTCAAATACTACCAAAATCTTTACATGAGACTGTTAGGCCCGACATCAATTAACAAGTGACAAACTCGAAGCCCCTAATGAAAGCTTTAGGCTTAGTTTGGAATGAAAAAATAGTAATTTTTTAACAAATTATTAAAATATTTAAAAAAAAAAAAGTTAATTTTTGTCAATTTAACATTTGTACCATTTATAATGAAAAGAATTAAAATATAAGTGATTAAATTTGATGAATTGAGAAAAAGTTAAAAAAAATTGAAATTGCCTAAATCTTACTCTCCCAAACGAAGCCTTAGCTTTCAACTCAGTGCTACGTGGCATTCGTATCTCTTCGTATCTATAAATAATTGTGAAGTGCCCACGTTGGTGATCAACAGCCCTATAGTCTCTACAACA.

[0082] 5. The amplified fragment of JT-Miraculin-s-F / JT-Miraculin-s-R (SEQ ID NO. 12) has the following sequence:

[0083]

Claims

1. An endogenous promoter for a miracle fruit protein-encoding gene, characterized in that: The endogenous promoter of the miracle fruit protein encoding gene is proSdMIR.1.2, and the DNA nucleotide sequence of proSdMIR.1.2 is shown in SEQ ID NO.

4.

2. An expression box containing the promoter of claim 1.

3. A recombinant vector containing the promoter of claim 1 or the expression cassette of claim 2.

4. The recombinant vector according to claim 3, characterized in that: The recombinant vector is a recombinant expression vector or a recombinant cloning vector.

5. The recombinant vector according to claim 4, characterized in that: The backbone vector of the recombinant expression vector is the plant binary expression vector pCAMBIA1303, and the backbone vector of the recombinant cloning vector is pMD19-T.

6. A recombinant bacterium containing the promoter of claim 1, the expression cassette of claim 2, or the recombinant vector of claim 3.

7. The use of the endogenous promoter of the miracle fruit protein-encoding gene as described in claim 1 in any of the following: (1) Application in the construction of expression cassettes, recombinant vectors or recombinant bacteria; (2) Application in the construction of transgenic plants; (3) Application in initiating the expression of target genes in plants; The plant in question is either miracle fruit or Arabidopsis thaliana.

8. A method for expressing a target nucleic acid molecule in a plant, characterized in that: The method includes introducing a nucleic acid construct into a plant, the nucleic acid construct containing the promoter of claim 1 and a target nucleic acid molecule operatively linked to the promoter, wherein the plant is miracle fruit or Arabidopsis thaliana.

Citation Information

Patent Citations

  • Method for highly producing target gene product in recombinant plant

    JP2010104339A