Kit for auxiliary diagnosis or screening of breast cancer

By detecting the methylation level of CpG sites in specific regions of breast cancer tissue, specific primer pairs and probes were designed to solve the problem of over-biopsy in breast cancer diagnosis, achieve accurate differentiation between breast cancer and benign lesions, reduce patient trauma and waste of medical resources, and improve diagnostic efficiency.

CN120924657APending Publication Date: 2025-11-11WUHAN AIMISEN LIFE TECH CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510874961.3
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-06-27
Publication Date
2025-11-11

AI Technical Summary

Technical Problem

The current diagnosis of breast cancer suffers from over-biopsy due to the wide range of malignancy risk assessments on imaging, especially the high rate of diagnostic uncertainty and unnecessary biopsies for BI-RADS 4 lesions.

Method used

By detecting the methylation level of CpG sites in the chr10:100659516-100659625 region of breast cancer tissue, specific primer pairs and Taqman probes were designed. Combined with methylation detection technology, molecular-level judgment criteria were provided for the accurate stratification of BI-RADS 4 lesions, reducing unnecessary biopsies.

Benefits of technology

It enables precise differentiation between breast cancer and benign lesions, reduces patient trauma and waste of medical resources, and improves diagnostic efficiency and accuracy, making it particularly suitable for large-scale screening and postoperative monitoring.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120924657A_ABST
    Figure CN120924657A_ABST
Patent Text Reader

Abstract

The present invention relates to the field of biological detection, and discloses a breast cancer auxiliary diagnosis or screening kit, which comprises a molecular marker for detecting the methylation level of a CpG site in a chr10: 100659516-100659625 region, a primer pair for detecting the methylation level of the molecular marker, and a probe for detecting the methylation level of the molecular marker, an upstream primer sequence and a downstream primer sequence of the primer pair are respectively 5 'GTATATGAAAATGTGTTCGC 3' and 5 'TTTCTAACAATAACGACG 3'. The methylation level of a CpG site in a chr10 specific region in breast cancer tissues is obviously higher than that of a benign nodule and a healthy sample, and the kit containing the specific primer pair and a Taqman probe is designed by taking the CpG site as a core marker, so that the samples such as tissues, blood and urine are detected.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biological detection technology, specifically a kit for the auxiliary diagnosis or screening of breast cancer. Background Technology

[0002] Breast cancer (BC) is the most common cancer among women worldwide, ranking first in incidence globally in 2020. Mammography and ultrasound are routine methods for detecting early-stage breast cancer in asymptomatic women, but they are prone to underestimation or overdiagnosis. The Breast Imaging Reporting and Data System (BI-RADS) categorizes mammogram and ultrasound findings to standardize risk assessment of breast lesions. However, the malignancy risk of BI-RADS category 4 lesions varies from 3% to 94%, and according to current clinical guidelines, this large statistical variability leads to unnecessary biopsies.

[0003] Mutation-based circulating tumor DNA (ctDNA) analysis has been used to detect early recurrence, analyze acquired drug resistance, and guide adjuvant therapy for various cancers. However, the lack of many common mutations in breast cancer (BC) limits the sensitivity of mutation-based ctDNA detection. On the other hand, DNA methylation-based markers are effective for the early detection of many cancer types. Therefore, this invention proposes a kit for the adjuvant diagnosis or screening of breast cancer, providing molecular-level diagnostic evidence for BI-RADS 4 lesions and reducing unnecessary biopsies. Summary of the Invention

[0004] To address the shortcomings of existing technologies, this invention provides a kit for the auxiliary diagnosis or screening of breast cancer, solving the problem of over-biopsy caused by the wide range of malignancy risk assessments in current breast cancer diagnosis.

[0005] To achieve the above objectives, the present invention provides the following technical solution: a kit for auxiliary diagnosis or screening of breast cancer, comprising a molecular marker for detecting the methylation level of CpG sites located in the chr10:100659516-100659625 region, a primer pair for detecting the methylation level of the molecular marker, and a probe for detecting the methylation level of the molecular marker. The CpG sites include at least one or more of chr10:100659534, chr10:100659536, chr10:100659588, chr10:100659607, and chr10:100659610. The upstream and downstream primer sequences of the primer pair are 5'GTATATGAAAAATGTGTTCGC 3' and 5'TTTCTCAACAATAACGACG 3', respectively.

[0006] By employing the aforementioned technical solutions, specific genomic regions with significant hypermethylation in breast cancer tissue are used as core markers. Through matching specific primer pairs and probes, combined with methylation detection technology, molecular-level criteria are provided for differentiating benign from malignant breast lesions. Furthermore, by detecting the methylation status of target regions in blood, urine, and other samples, clinical practice can be aided in the precise stratification of suspicious lesions such as BI-RADS 4, reducing unnecessary invasive biopsies. This leverages the stability and specificity of DNA methylation markers, overcoming the limitations of traditional imaging assessments based solely on morphological characteristics. Simultaneously, non-invasive or minimally invasive sample testing reduces patient trauma, providing a new solution for the early detection and personalized treatment of breast cancer. This helps improve diagnostic efficiency and optimize the allocation of medical resources, addressing the problem of excessive biopsies caused by the wide range of malignancy risk assessments in current breast cancer diagnosis.

[0007] Preferably, the probe includes a Taqman probe with the sequence 5'CCATCTACAAAAATTACCGC 3'.

[0008] Preferably, the method for detecting the methylation level includes at least one of methylation-specific PCR, sequencing, methylation-specific high-performance liquid chromatography, digital PCR, methylation-specific high-resolution melting curve method, methylation-specific microarray method, and methylation-sensitive restriction endonuclease method.

[0009] Preferably, the test samples of the kit include tissue samples, blood samples, or urine samples, wherein the urine sample is urine sediment, supernatant after removing sediment, or a mixture thereof.

[0010] Preferably, it also includes a sulfite conversion reagent for converting unmethylated cytosine in the DNA of the test sample into uracil.

[0011] Preferably, the assay also includes an internal reference gene detection reagent, wherein the internal reference gene of the internal reference gene detection reagent is the β-actin gene, and the upstream and downstream primer sequences are AAGGTAAAGAATATGGT and ACACAATAAATCTAAACA, respectively, and the probe sequence is AGTGTGTTGGGGTTTTGGGAT.

[0012] A detection method for a kit used for the auxiliary diagnosis or screening of breast cancer, applied to the aforementioned kit for the auxiliary diagnosis or screening of breast cancer, includes the following steps:

[0013] DNA was extracted from the test sample and treated with a sulfite conversion reagent to convert unmethylated cytosine into uracil, thus obtaining the converted DNA template.

[0014] PCR amplification was performed using a primer pair for detecting the methylation level of the molecular marker and a probe for detecting the methylation level of the molecular marker, with DNA template as the amplification target.

[0015] The ΔCT value is used to determine the methylation level of molecular markers in the DNA template after PCR amplification, thus completing the detection.

[0016] The application of a kit for breast cancer auxiliary diagnosis or screening in the preparation of breast cancer auxiliary diagnosis or screening products includes one or more of the following: kit, chip, computer system, and sequencing library.

[0017] This invention provides a kit for the auxiliary diagnosis or screening of breast cancer. It has the following beneficial effects:

[0018] 1. This invention utilizes the fact that the methylation level of CpG sites in a specific region of chr10 in breast cancer tissue is significantly higher than that in benign nodules and healthy samples. Based on this, a kit containing specific primer pairs and Taqman probes was designed to detect methylation in tissue, blood, urine and other samples. The methylation level is quantified by ΔCT value. The molecular-level methylation analysis narrows the scope of malignancy risk assessment, avoiding the high biopsy rate caused by traditional imaging based solely on morphological characteristics. This reduces invasive procedures for patients with benign lesions, improving diagnostic accuracy while reducing patient trauma and waste of medical resources.

[0019] 2. This invention effectively distinguishes breast cancer from benign nodules by detecting the methylation level of CpG sites in a specific region of chr10. Compared with traditional imaging assessment methods that rely on morphological features, this kit provides quantitative judgment at the molecular level, avoiding the diagnostic uncertainty caused by the large range of malignancy risk in BI-RADS 4 lesions, and providing a more accurate reference for clinical decision-making.

[0020] 3. This invention can complete methylation analysis by extracting plasma cfDNA or urine sediment DNA without the need for tissue biopsy, reducing the physiological and psychological burden on patients. It is especially suitable for large-scale screening and postoperative monitoring scenarios. At the same time, reducing unnecessary invasive procedures can reduce the risk of biopsy-related complications, save medical resources such as pathological examination, and improve diagnostic and treatment efficiency. Attached Figure Description

[0021] Figure 1 This is a schematic diagram of the ROC curve for distinguishing between breast cancer samples and benign breast nodules using the methylation level (ΔCT) method of the present invention.

[0022] Figure 2 This is a flowchart of a detection method for a reagent kit used for the auxiliary diagnosis or screening of breast cancer, as proposed in this invention. Detailed Implementation

[0023] The technical solution of the present invention will now be clearly and completely described with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0024] This invention provides a kit for the auxiliary diagnosis or screening of breast cancer, comprising a molecular marker for detecting the methylation level of CpG sites located in the chr10:100659516-100659625 region, a primer pair for detecting the methylation level of the molecular marker, and a probe for detecting the methylation level of the molecular marker. The CpG sites include at least one or more of chr10:100659534, chr10:100659536, chr10:100659588, chr10:100659607, and chr10:100659610. The upstream and downstream primer sequences of the primer pair are 5'GTATATGAAAAATGTGTTCGC 3' (Seq ID 1) and 5'TTTCTCAACAATAACGACG 3' (Seq ID 2), respectively.

[0025] The probes include Taqman probes with the sequence 5'CCATCTACAAAAATTACCGC 3' (Seq ID 3).

[0026] Methods for detecting methylation levels include at least one of the following: methylation-specific PCR, sequencing, methylation-specific high-performance liquid chromatography, digital PCR, methylation-specific high-resolution melting curve method, methylation-specific microarray method, and methylation-sensitive restriction endonuclease method.

[0027] The test samples for the kit include tissue samples, blood samples, or urine samples. Urine samples are urine sediment, supernatant after removing sediment, or a mixture thereof.

[0028] It also includes a sulfite conversion reagent, used to convert unmethylated cytosine in the DNA of the test sample into uracil.

[0029] It also includes an internal reference gene detection reagent, the internal reference gene of which is the β-actin gene, and its upstream and downstream primer sequences are AAGGTAAAGAATATGGT (SEQ ID 5) and ACACAATAAATCTAAACA (SEQ ID 6), respectively, and the probe sequence is AGTGTGTTGGGGTTTTGGGAT (SEQ ID 7).

[0030] Specifically, the detection principle of the molecular markers is based on DNA methylation characteristics: the cytosine methylation frequency at CpG sites within the chr10:100659516-100659625 region is significantly higher in breast cancer tissue than in benign lesions. Quantitative analysis of methylation levels can be achieved through sulfite conversion combined with specific primers and probes. The sulfite conversion step utilizes ZYMO RESEARCH's EZ DNA Methylation-Gold. TM Kit, the specific operation is as follows: Take 10 μL of extracted sample DNA, add 130 μL of transformation reaction solution (containing sulfite and protectant), incubate at 55℃ in the dark for 16 hours, gently mix once every 2 hours during the period, after transformation, remove unreacted reagents by column purification to obtain methylation sensitive DNA template.

[0031] The primer pairs (Seq ID 1 / 2) and probe (Seq ID 3) were designed according to the principles of methylation-specific PCR (MSP). The upstream primer (Seq ID 1) contains the thymine recognition sequence after the conversion of unmethylated cytosine at the 5' end of the target region. The upstream primer (Seq ID 1: 5'GTATATGAAAAATGTGTTCGC3') strictly follows the logic of methylation-specific recognition: after sulfite treatment, unmethylated cytosine (C) is converted to uracil (U), while methylated cytosine remains C. The upstream primer also mainly relies on the CG site in the 3' segment to recognize methylated and unmethylated templates. In the "GTATATG" sequence at the 5' end of the primer, part of the "T" corresponds to the U of unmethylated C after sulfite conversion (U corresponds to T in the primer during PCR amplification). However, since the target region is in a high-methylated state in breast cancer, the C at this position is not converted. Therefore, the T in the primer is only complementary to the C of the methylated DNA strand, thus excluding the possibility of binding to unmethylated DNA. The “TGTGTTCGC” sequence at the 3' end of the primer specifically recognizes the 5'-GTGTTCGC-3' sequence of methylated DNA through base pairing, ensuring that the upstream primer can only bind to the methylated DNA template.

[0032] The downstream primer (Seq ID 2) matches the 3' methylation-specific sequence, ensuring that only methylated DNA fragments are amplified. The core of the downstream primer (Seq ID 2: 5'TTTCTCAACAATAACGACG3') lies in the 3' methylation-specific base "GACG": if the target region is not methylated, this sequence becomes "GATG" after sulfite conversion, which does not match the "GACG" at the 3' end of the primer (CvsT at the 3rd base), causing PCR to fail to extend. However, the "GACG" sequence of methylated DNA is completely complementary to the primer, ensuring that the downstream primer can only initiate the amplification of methylated DNA. In addition, the overall GC content of the primer is about 50%, and the annealing temperature is optimized to 60℃, which can ensure stable binding to methylated DNA and avoid non-specific amplification. The upstream and downstream primers utilize a dual mechanism of 5' end inclusive design and 3' end strict base matching to achieve specific enrichment of methylated DNA in the chr10:100659516-100659625 region, providing a pure template for subsequent quantification of Taqman probes.

[0033] The Taqman probe (Seq ID 3) spans the key CpG site chr10:100659588 within the target region. It is labeled with a FAM fluorescent group at the 5' end and a BHQ1 quenching group at the 3' end. When the probe hybridizes with methylated DNA and is degraded by PCR polymerase, it releases a fluorescent signal. The signal intensity is monitored by a real-time quantitative PCR instrument to quantify the Ct value of the methylation level.

[0034] A detection method for a kit used for the auxiliary diagnosis or screening of breast cancer, applied to the aforementioned kit for the auxiliary diagnosis or screening of breast cancer, includes the following steps:

[0035] DNA was extracted from the test sample and treated with a sulfite conversion reagent to convert unmethylated cytosine into uracil, thus obtaining the converted DNA template.

[0036] PCR amplification was performed using a primer pair and a probe for detecting the methylation level of molecular markers, with DNA template as the amplification target.

[0037] The ΔCT value is used to determine the methylation level of molecular markers in the DNA template after PCR amplification, thus completing the detection.

[0038] Specifically, the DNA extraction steps vary depending on the sample type: For tissue samples, take 5-10 mg of fresh or frozen tissue, cut it into small pieces with scissors, add 200 μL of lysis buffer (containing 10 mM Tris-HCl pH 8.0, 100 mM NaCl, 25 mM EDTA, 0.5% SDS, and 200 μg / mL proteinase K), incubate overnight at 55°C until complete digestion, extract with phenol-chloroform and precipitate with ethanol, then dissolve the DNA in 50 μL of TEL buffer. For blood samples, use the Magnetic Bead Method Serum / Plasma Cell-Free DNA Extraction Kit (DP709) from Tiangen Biotech (Beijing) Co., Ltd. Take plasma samples, and follow the kit's operating procedures: sample lysis, magnetic bead adsorption of cell-free DNA, washing to remove impurities, and finally elution to obtain cfDNA. Refer to the kit instructions for specific steps. For urine samples, take 50 mL of midstream urine, centrifuge at 3000 g for 15 minutes to collect the sediment, add 300 μL of lysis buffer (containing 50 mM Tris-HCl pH 8.0, 100 mM EDTA, 1% SDS, and 200 μg / mL proteinase K), incubate at 56 °C for 2 hours, and then proceed according to the tissue sample extraction procedure.

[0039] The sulfite conversion process uses EZ DNAMethylation-Gold TM Kit: Take 10 μL of extracted DNA (concentration ≥10 ng / μL), add 130 μL of CT Conversion Reagent (containing sulfite and hydroquinone), gently mix, and aliquot into 0.2 mL PCR tubes. Incubate in a thermal cycler according to the following program: 98℃ for 10 minutes → 64℃ for 2.5 hours → store at 4℃. Purify the transformed DNA by centrifugation, washing sequentially with 100 μL M-Binding Buffer, 200 μL M-Wash Buffer, and 150 μL M-Desulphonation Buffer (incubate at room temperature for 15 minutes). Finally, elute with 20 μL preheated M-Elution Buffer. Use immediately for PCR or store at -20℃ (for no more than 1 week).

[0040] The PCR amplification system (20 μL) was prepared as follows:

[0041] β-actin was used as an internal reference gene, and the PCR reaction system is shown in Table 1. The upstream primer for β-actin was: AAGTGTAAAGAATATGGT (SEQ ID 5); the downstream primer for β-actin was: ACACAATAAATCTAAACA (SEQ ID 6); and the probe for β-actin was: AGTGTGTTGGGGTTTTGGGAT (SEQ ID 7).

[0042] The reporter group at the 5' end of the probe used to detect the target region is FAM, and the quencher group at the 3' end is MGB. The reporter group at the 5' end of the β-actin probe is VIC, and the quencher group at the 3' end is BHQ1.

[0043] When detecting the methylation status of any region in a sample, simply add the corresponding primer probe, β-actin primer probe, buffer, dNTP, DNase, and sample DNA to the reaction system according to the volumes in the table.

[0044] Ct value reading: After PCR is completed, adjust the baseline. Set the fluorescence value 1-2 cycles in advance of the minimum Ct value of the sample in one PCR as the baseline value. Set the threshold at the inflection point of the S-shaped amplification curve to obtain the Ct value of each gene in the sample.

[0045] Quality Control: Negative and positive controls are tested simultaneously with each assay. The negative control is purified water, and the positive control is a synthetic plasmid containing the β-actin gene and the target gene sequence at a concentration of 10³ copies / µL. The negative control should show no amplification, and the positive control should exhibit a clear exponential growth phase, with a Ct value between 26 and 30. If the negative control, positive control, and internal reference gene all meet the above requirements, the experiment is considered valid, and the next step of sample result determination can proceed. Otherwise, the experiment is invalid and must be repeated. For example, methylation detection methods are highly efficient. The methylation level is represented by ΔCT, where ΔCT = CT. 目标区域 -CT 内参基因 .

[0046] Based on the significantly higher methylation levels of CpG sites (e.g., chr10:100659534, 536, etc.) in specific regions of chr10 in breast cancer tissue compared to benign nodules and healthy samples, a kit containing specific primer pairs (Seq ID1 / 2) and Taqman probes (Seq ID3) was designed using this as the core marker. This kit supports multiple detection methods, including methylation-specific PCR and sequencing, and can detect methylation levels in tissue, blood, and urine samples. The methylation level is quantified using the ΔCT value (AUC up to 0.875, sensitivity 76.5%-84%, specificity 90%-94.5%). In clinical applications, for BI-RADS 4 lesions, this kit narrows the scope of malignancy risk assessment through molecular-level methylation analysis, avoiding the high biopsy rates caused by traditional imaging relying solely on morphological characteristics. This reduces invasive procedures for patients with benign lesions, improving diagnostic accuracy while reducing patient trauma and waste of medical resources.

[0047] The application of a kit for breast cancer auxiliary diagnosis or screening in the preparation of breast cancer auxiliary diagnosis or screening products includes one or more of the following: kit, chip, computer system, and sequencing library.

[0048] The term "methylation level" is understood in the same way as in general, referring to whether methylation exists on the 5' carbon atom of cytosine in one or more CpG dinucleotides in a DNA sequence, and the frequency / proportion / percentage of methylation. It represents both a qualitative and quantitative concept.

[0049] The term "auxiliary diagnosis" refers to the use of tests, examinations, or other methods to provide reference information for distinguishing patients from those suspected of having a disease but who are actually healthy. Clinically, auxiliary diagnostic tests and examinations alone are usually not used as the basis for a definitive diagnosis, but only to provide a reference for clinical diagnosis.

[0050] The term "screening" refers to the process of quickly testing, examining, or otherwise distinguishing people who may be sick but appear healthy from those who may not be sick. Screening is different from diagnosis; it is only a preliminary examination. Those who test positive or are suspected of being positive need to undergo further diagnostic tests.

[0051] This invention discovers that the methylation level of cytosine residues at CpG dinucleotide sites within the chr10:100659516-100659625 region in breast cancer tissue is significantly higher than that in benign breast nodule tissue. Detecting the methylation level in this region in tissue and plasma samples can differentiate between breast cancer and benign breast nodules, as well as between breast cancer and healthy samples, demonstrating high sensitivity and specificity.

[0052] Those skilled in the art will recognize that there are various methods for detecting methylation levels, including methylation-specific PCR, sequencing, methylation-specific high-performance liquid chromatography, digital PCR, methylation-specific high-resolution melting curve analysis, methylation-specific microarray analysis, and methylation-sensitive restriction endonuclease analysis. Using any of these methods to detect the detection region disclosed in this invention is within the scope of protection of this invention.

[0053] The following is a further description with reference to specific embodiments:

[0054] Example 1

[0055] This embodiment provides a kit for breast cancer diagnosis or auxiliary screening, comprising nucleotide combination 1, which includes the nucleotides shown in SEQ ID NO. 1-3. This nucleotide combination 1 can detect positive-strand methylation of the chr10:100659516-100659625 region;

[0056] The positive-strand base sequence in this region is as follows (Seq ID 4):

[0057] GTACATGAAAAATGTGTCCGCGTGCGGCCCCGACTGCAGACGCAGA TGAAATTCTGTGCCGAGCCTGATGCGCGGTAACCTTTGCAGATGGCGCC GCTATTGCTGAGAAA.

[0058] The nucleotides shown in SEQ ID NO.1-3 can detect methylation of cytosine at the positions chr10:100659534, chr10:100659536, Chr10:100659588, chr10:100659607 and chr10:100659610 on the positive strand of this region.

[0059] Example 2

[0060] This embodiment provides a method for diagnosis using any one of the kits from Examples 1-2, which includes the following steps:

[0061] 1. DNA template extraction:

[0062] The samples used were blood samples. Plasma cfDNA was extracted using the magnetic bead method serum / plasma cell-free DNA extraction kit (DP709) from Tiangen Biotech (Beijing) Co., Ltd. For specific operation instructions, please refer to the kit manual.

[0063] 2. Conversion of sulfites

[0064] The nucleic acid conversion kit used was the ZYMO RESEARCH EZ DNAMethylation-Gold™ Kit. For specific experimental procedures, please refer to the kit instructions.

[0065] 3. PCR reaction

[0066] β-actin was used as an internal reference gene, and the PCR reaction system is shown in Table 1. The upstream primer for β-actin was: AAGTGTAAAGAATATGGT (SEQ ID 5); the downstream primer for β-actin was: ACACAATAAATCTAAACA (SEQ ID 6); and the probe for β-actin was: AGTGTGTTGGGGTTTTGGGAT (SEQ ID 7).

[0067] The reporter group at the 5' end of the probe used to detect the target region is FAM, and the quenching group at the 3' end is B of MGdefrost. The reporter group at the 5' end of the β-actin probe is VIC, and the quenching group at the 3' end is BHQ1.

[0068] Table 1

[0069] Components Specification Volume (μL) buffer solution 5× 5 dNTPs 2.5mM each 2 upstream primer of target region 10μM 1 downstream primers of the target region 10μM 1 Target region probe 10μM 1 β-actin upstream primer 10μM 1 β-actin downstream primer 10μM 1 β-actin probe 10μM 1 DNA enzymes 5U / μL 0.5 DNA of the sample to be tested / 5 Purified water / Add to 25

[0070] As shown in Table 1, when detecting the methylation status of the target region chr10:100659516-100659625, simply add the corresponding primer probe (SEQ ID 5-7), β-actin primer probe, buffer, dNTP, DNase, and sample DNA to the reaction system according to the volumes in the table.

[0071] The PCR reaction conditions are shown in Table 2 below.

[0072] Table 2

[0073]

[0074]

[0075] Ct value reading: After PCR is completed, adjust the baseline. Set the fluorescence value 1-2 cycles in advance of the minimum Ct value of the sample in one PCR as the baseline value. Set the threshold at the inflection point of the S-shaped amplification curve to obtain the Ct value of each gene in the sample.

[0076] Quality control: Negative and positive controls were tested simultaneously with each test. The negative control was purified water, and the positive control was a synthetic plasmid containing the β-actin gene and the target gene sequence at a concentration of 10. 3 The copy number / µL should be [number] copies / µL. The negative control should show no amplification, and the positive control should exhibit a clear exponential growth phase. The Ct value of the positive control should be between 26 and 30. If the negative control, positive control, and internal reference gene all meet these requirements, the experiment is considered valid, and the next step of sample result determination can proceed. Otherwise, the experiment is invalid and must be repeated.

[0077] Methylation level: The methylation level of a sample is represented by ΔCT, where ΔCT = CT 目标区域 -CT 内参基因 .

[0078] Experimental Example 1

[0079] Please see the appendix Figure 1Blood samples were collected from 51 cases of pathologically confirmed breast cancer and 56 cases of benign nodules. DNA extraction, bisulfite conversion, and PCR detection were performed according to the method provided in Example 2. The ROC curves for distinguishing breast cancer samples from benign nodule samples based on methylation levels are shown below. Figure 1 As shown. In Figure 1 In the study, the area under the curve (AUC) was 0.875. When ΔCT = 16.00, the Youden index was the largest. At this point, the sensitivity of methylation detection in 51 breast cancer samples was 76.5%, and the specificity in 56 benign breast nodules was 94.5%.

[0080] Experiment Example 2

[0081] In addition, plasma samples were collected from 20 patients with breast cancer and 20 patients with benign breast nodules. Methylation was performed on each sample, and ΔCT = 16.00 (from Experiment 1) was used as the cutoff value. When ΔCT ≤ 16, the sample was predicted to be a breast cancer sample; when ΔCT > 16, the sample was predicted to be a benign breast nodule sample. Furthermore, the prediction results of methylation detection were compared with the gold standard of real pathology in the same samples to calculate the sensitivity and specificity of methylation detection. The results are shown in Table 3 below.

[0082] Table 3. Predictive accuracy of methylation detection in 20 breast cancer samples and 20 benign breast nodule samples.

[0083]

[0084]

[0085]

[0086] As shown in Table 3, among the 20 breast cancer samples, methylation detection predicted cancer in 16 cases, with a sensitivity of 84%; among the 20 benign breast nodule samples, methylation detection predicted benign nodules in 18 cases, with a specificity of 90%.

[0087] Seq ID 1:

[0088] 5'GTATATGAAAAATGTGTTCGC 3'

[0089] Seq ID 2:

[0090] 5'TTTCTCAACAATAACGACG 3'

[0091] Seq ID 3:

[0092] 5'CCATCTACAAAAATTACCGC 3'

[0093] Seq ID 4:

[0094] GTACATGAAAAATGTGTCCGCGTGCGGCCCCGACTGCAGACGCAGATGAAATTCTGTGCCGAGCCTGATGCGCGGTAACCTTTGCAGATGGCGCCGCTATTGCTGAGAAA

[0095] SEQ ID 5:

[0096] AAGTGTAAAGAATATGGT

[0097] SEQ ID 6:

[0098] ACACAATAAATCTAAACA

[0099] SEQ ID 7:

[0100] AGTGTGTTGGGGTTTTGGGAT

[0101] Although embodiments of the invention have been shown and described, it will be understood by those skilled in the art that various changes, modifications, substitutions and alterations can be made to these embodiments without departing from the principles and spirit of the invention, the scope of which is defined by the appended claims and their equivalents.

Claims

1. A kit for the auxiliary diagnosis or screening of breast cancer, comprising a molecular marker for detecting the methylation level of CpG sites located in the chr10:100659516-100659625 region, a primer pair for detecting the methylation level of the molecular marker, and a probe for detecting the methylation level of the molecular marker, characterized in that: The CpG sites include at least one or more of chr10:100659534, chr10:100659536, chr10:100659588, chr10:100659607, and chr10:100659610, and the upstream and downstream primer sequences of the primer pair are 5'GTATATGAAAAATGTGTTCGC 3' and 5'TTTCTCAACAATAACGACG 3', respectively.

2. The kit for auxiliary diagnosis or screening of breast cancer according to claim 1, characterized in that: The probe includes a Taqman probe with the sequence 5'CCATCTACAAAAATTACCGC 3'.

3. The kit for auxiliary diagnosis or screening of breast cancer according to claim 1, characterized in that: The method for detecting methylation levels includes at least one of the following: methylation-specific PCR, sequencing, methylation-specific high-performance liquid chromatography, digital PCR, methylation-specific high-resolution melting curve method, methylation-specific microarray method, and methylation-sensitive restriction endonuclease method.

4. A kit for auxiliary diagnosis or screening of breast cancer according to claim 1, characterized in that: The test samples for the kit include tissue samples, blood samples, or urine samples, wherein the urine sample is urine sediment, supernatant after removing sediment, or a mixture thereof.

5. A kit for auxiliary diagnosis or screening of breast cancer according to claim 1, characterized in that: It also includes a sulfite conversion reagent, used to convert unmethylated cytosine in the DNA of the test sample into uracil.

6. A kit for auxiliary diagnosis or screening of breast cancer according to claim 1, characterized in that: It also includes an internal reference gene detection reagent, wherein the internal reference gene of the internal reference gene detection reagent is the β-actin gene, and its upstream and downstream primer sequences are AAGGTAAAGAATATGGT and ACACAATAAATCTAAACA, respectively, and the probe sequence is AGTGTGTTGGGGTTTTGGGAT.

7. A detection method for a kit used for the auxiliary diagnosis or screening of breast cancer, characterized in that: A kit for auxiliary diagnosis or screening of breast cancer according to any one of claims 1-6, comprising the following steps: DNA was extracted from the test sample and treated with a sulfite conversion reagent to convert unmethylated cytosine into uracil, thus obtaining the converted DNA template. PCR amplification was performed using a primer pair for detecting the methylation level of the molecular marker and a probe for detecting the methylation level of the molecular marker, with DNA template as the amplification target. The ΔCT value is used to determine the methylation level of molecular markers in the DNA template after PCR amplification, thus completing the detection.

8. The application of a kit for breast cancer auxiliary diagnosis or screening according to any one of claims 1-6 in the preparation of breast cancer auxiliary diagnosis or screening products, comprising one or more of the following: kit, chip, computer system, and sequencing library.