Methylation primer probe composition for early diagnosis of endometrial cancer and application of methylation primer probe composition

Abstract

The invention discloses a methylation primer probe composition for early diagnosis of endometrial cancer and application of the methylation primer probe composition, target genes of the primer probe composition comprise a PCDHGB7 gene, a CELF4 gene, a BHLHE22 gene and a GAPDH reference gene, target regions of the PCDHGB7 are two sections of target sequences in a whole-genome sequence and are respectively marked as a PCDHGB7-1 gene and a PCDHGB7-2 gene; and the reference gene is selected from two segments of sequences in the GAPDH gene, namely a GAPDH-1 gene and a GAPDH-2 gene. The invention solves the problems of tedious operation and long time consumption in the prior art, and provides application of a primer probe combination in an endometrial cancer methylation detection kit.

Description

Technical Field

[0001] This invention relates to the field of disease detection, and more specifically to primer-probe compositions for the detection of endometrial cancer and their applications. Background Technology

[0002] Endometrial cancer is an epithelial malignant tumor that occurs in the endometrium, also known as uterine corpus cancer, accounting for approximately 20-30% of gynecological malignancies. In recent years, the incidence of this tumor has been gradually increasing and showing a significant trend towards affecting younger women. Because endometrial cancer presents with early symptoms such as irregular vaginal bleeding and vaginal discharge, about 70% of endometrial cancer patients are diagnosed with early lesions confined to the uterine corpus. However, due to the nonspecificity of these symptoms, a significant proportion of patients miss the opportunity for early diagnosis. Early diagnosis is crucial for endometrial cancer. On the one hand, early diagnosis and treatment can significantly improve patients' survival rate and quality of life; on the other hand, with the trend of this tumor affecting younger women, more endometrial cancer patients still have fertility needs, and early detection will provide possibilities for fertility-preserving treatments.

[0003] Currently, in clinical practice, doctors mainly rely on vaginal ultrasound and the detection of serum tumor marker CA125 levels for the auxiliary diagnosis of endometrial cancer. However, these commonly used diagnostic methods face significant limitations in practical application, primarily in their insufficient sensitivity and / or specificity. This means that they may miss or overdiagnose early-stage endometrial cancer cases. Therefore, these methods are not suitable as routine early screening methods for endometrial cancer in a broad population. In contrast, hysteroscopic-guided endometrial biopsy is widely recognized as the "gold standard" for diagnosing endometrial cancer, and its accuracy and reliability are widely accepted clinically. However, hysteroscopy is an invasive procedure, not only relatively expensive, but the increased intrauterine pressure during the procedure may also increase the risk of tumor cell extravasation. This potential risk makes hysteroscopy unsuitable for large-scale endometrial cancer screening.

[0004] Therefore, finding more efficient, economical, and safe early screening methods remains an important issue that urgently needs to be addressed in the field of endometrial cancer prevention and treatment. Summary of the Invention

[0005] This invention provides a methylated primer-probe composition for early diagnosis of endometrial cancer and its application. The target genes of the primer-probe composition include: PCDHGB7 gene, CELF4 gene and BHLHE22 gene. The target region of PCDHGB7 is two target sequences in the whole gene sequence, which are respectively denoted as PCDHGB7-1 gene and PCDHGB7-2 gene.

[0006] The primer-probe sequence is specifically represented as follows:

[0007] The upstream primer sequence for the PCDHGB7-1 gene is: GTTTGTGCTGGACCAGAACG.

[0008] The downstream primer sequence for the PCDHGB7-1 gene is: CACCTTGGTCACCAGGTAG.

[0009] Probe sequence for the PCDHGB7-1 gene: ATGCGCCCGAGATCCTGTAC;

[0010] The upstream primer sequence for the PCDHGB7-2 gene is: TGGAAAAGCGGGGACCCAG.

[0011] Downstream primer sequence for the PCDHGB7-2 gene: CAGCAAAGGAAATAGTACCTG

[0012] The probe sequence for the PCDHGB7-2 gene is: AGAACCCGAGCGAACGATGG;

[0013] The upstream primer sequence for the CELF4 gene is: CAGGAACGACTCAGCCTCG.

[0014] The downstream primer sequence for the CELF4 gene is: TGATCGCTATCTGGGTTGC.

[0015] Probe sequence for the CELF4 gene: ACCTCGGGAGCTGTAGGTGC;

[0016] The upstream primer sequence for the BHLHE22 gene is: CTGACATGATCGATCCTTCG.

[0017] Downstream primer sequence for the BHLHE22 gene: TTTGTGGGCTGCCACCTTC

[0018] The probe sequence for the BHLHE22 gene is: AAATGTCCACTTCGGGCCG.

[0019] Preferably, a fluorescent reporter group is labeled at the 5' end of the probe, and a fluorescent quencher group is labeled at the 3' end.

[0020] Preferably, the fluorescent reporter group is any one of FAM, VIC, and ROX; and the fluorescent quencher group is MGB.

[0021] The present invention also discloses the application of the above-described primer-probe composition in a kit for detecting methylation in endometrial cancer.

[0022] Preferably, it also includes dNTPs, hot-start Taq DNA polymerase, reaction buffer, and methylation-sensitive endonuclease.

[0023] Preferably, the methylation-sensitive endonuclease is a methylation-sensitive restriction endonuclease, specifically any combination of Acil, Hhal, Hinp1I, and HpaII.

[0024] Preferably, it also includes two sequences from a reference marker GAPDH gene: the GAPDH-1 gene and the GAPDH-2 gene; wherein the GAPDH-1 gene amplification fragment does not contain restriction enzyme sites, and the GAPDH-2 gene amplification fragment has methylation restriction endonuclease sites and is in a non-methylated state in the human genome, and its primer and probe sequences are specifically represented as follows;

[0025] The upstream primer sequence for the GAPDH-1 gene is: TTGACTCCCTAGTGTCCT.

[0026] The downstream primer sequence for the GAPDH-1 gene is: CAATCTCAGTCCCTTCCC.

[0027] The probe sequence for the GAPDH-1 gene is: TGCCCACAGTCCAGTCCT;

[0028] The upstream primer sequence for the GAPDH-2 gene is: GTCCCCAGAAACAGGAGG.

[0029] The downstream primer sequence for the GAPDH-2 gene is: TCACGTGTCGCAGAGGAG.

[0030] The probe sequence for the GAPDH-2 gene is: CCTACTCCCGCCCGAGAT.

[0031] This invention also discloses a method for interpreting methylation detection in endometrial cancer using the above-mentioned primer-probe composition, comprising the following steps: a) obtaining the ΔCt values ​​of PCDHGB7-1, PCDHGB7-2, CELF4, and BHLHE22 genes relative to the internal reference gene in the sample; b) inputting the ΔCt values ​​obtained in step a) into a calculation program based on a logistic regression model to calculate a P-value representing the probability of methylation positivity; c) interpreting the detection results based on the P-value.

[0032] If P > 0.5, it is interpreted as methylation positive;

[0033] If P < 0.5, it is interpreted as methylation negative;

[0034] If P = 0.5, then it is determined that a retest is required.

[0035] This invention provides a primer-probe combination for the detection of endometrial cancer, which has the following advantages: The upstream and downstream primers and probes in this primer-probe combination exhibit good specificity and sensitivity, ensuring more accurate detection results. The detection kit disclosed in this invention is easy to operate; the entire detection process does not require bisulfite conversion of DNA, avoiding contamination and template loss during the conversion process, shortening the detection time, reducing the workload of operators, and providing high accuracy, sensitivity, and specificity. Attached Figure Description

[0036] To more clearly illustrate the technical solutions in this invention or the prior art, the accompanying drawings used in the description of the prior art will be briefly introduced below.

[0037] Figure 1 This is the ROC plot of the present invention in the detection of endometrial cancer;

[0038] Figure 2 This is a distribution chart of the positive and negative probability values ​​of the samples in this invention;

[0039] Figure 3 This is a flowchart of the detection method steps of the present invention;

[0040] Figure 4 This is a negative sample amplification curve diagram of the present invention;

[0041] Figure 5 This is an amplification curve of a positive sample from the present invention. Detailed Implementation

[0042] To make the objectives, technical solutions, and advantages of this invention clearer, the technical solutions of this invention will be clearly and completely described below with reference to the accompanying drawings. Unless otherwise specified, all reagents or instruments used are commercially available conventional products.

[0043] like Figures 1 to 5 As shown in Example 1, this invention discloses a methylation primer-probe composition for early diagnosis of endometrial cancer. The target genes of the primer-probe composition include: PCDHGB7 gene, CELF4 gene and BHLHE22 gene. The target region of PCDHGB7 is two target sequences in the whole gene sequence, which are respectively denoted as PCDHGB7-1 gene and PCDHGB7-2 gene.

[0044] The primer and probe sequences are represented as follows:

[0045] The upstream primer sequence for the PCDHGB7-1 gene is: GTTTGTGCTGGACCAGAACG.

[0046] The downstream primer sequence for the PCDHGB7-1 gene is: CACCTTGGTCACCAGGTAG.

[0047] Probe sequence for the PCDHGB7-1 gene: ATGCGCCCGAGATCCTGTAC;

[0048] The upstream primer sequence for the PCDHGB7-2 gene is: TGGAAAAGCGGGGACCCAG.

[0049] Downstream primer sequence for the PCDHGB7-2 gene: CAGCAAAGGAAATAGTACCTG

[0050] The probe sequence for the PCDHGB7-2 gene is: AGAACCCGAGCGAACGATGG;

[0051] The upstream primer sequence for the CELF4 gene is: CAGGAACGACTCAGCCTCG.

[0052] The downstream primer sequence for the CELF4 gene is: TGATCGCTATCTGGGTTGC.

[0053] Probe sequence for the CELF4 gene: ACCTCGGGAGCTGTAGGTGC;

[0054] The upstream primer sequence for the BHLHE22 gene is: CTGACATGATCGATCCTTCG.

[0055] Downstream primer sequence for the BHLHE22 gene: TTTGTGGGCTGCCACCTTC

[0056] The probe sequence for the BHLHE22 gene is: AAATGTCCACTTCGGGCCG.

[0057] In this embodiment, fluorescent reporter groups are labeled at the 5' end of the probes for the PCDHGB7-1 gene, PCDHGB7-2 gene, CELF4 gene, and BHLHE22 gene, and fluorescent quencher groups are labeled at the 3' end. Specifically, the fluorescent reporter group is FAM, and the fluorescent quencher group is MGB. Thus, when the probe is in a single-stranded state, the fluorescent quencher group can effectively quench the signal of the fluorescent group. When the probe binds complementary to the target sequence, the 5'-3' exonuclease activity of Taq polymerase cleaves the probe, causing the fluorescent reporter group and the fluorescent quencher group to separate, thereby emitting fluorescence.

[0058] Example 2: This invention also discloses an endometrial cancer detection kit, comprising the primer and probe composition described above. It also includes a PCR reaction premix formed from PCR reaction buffer, dNTPs, hot-start Taq DNA polymerase, and methylation-sensitive restriction endonucleases, wherein the endonucleases are any combination of Acil, Hhal, Hinp1I, and HpaII.

[0059] In addition, GAPDH-1 and GAPDH-2 genes were selected as internal reference genes. The GAPDH-1 gene amplification fragment does not contain restriction enzyme sites, while the GAPDH-2 gene amplification fragment contains restriction enzyme sites and is usually in an unmethylated state in the human genome.

[0060] The upstream primer sequence for the GAPDH-1 gene is: TTGACTCCCTAGTGTCCT.

[0061] The downstream primer sequence for the GAPDH-1 gene is: CAATCTCAGTCCCTTCCC.

[0062] The probe sequence for the GAPDH-1 gene is: TGCCCACAGTCCAGTCCT;

[0063] The upstream primer sequence for the GAPDH-2 gene is: GTCCCCAGAAACAGGAGG.

[0064] The downstream primer sequence for the GAPDH-2 gene is: TCACGTGTCGCAGAGGAG.

[0065] The probe sequence for the GAPDH-2 gene is: CCTACTCCCGCCCGAGAT.

[0066] In this embodiment, both the 5' end of the GAPDH-1 gene probe and the GAPDH-2 gene probe are labeled with a fluorescent reporter group of the internal reference gene, and the 3' end is labeled with a fluorescent quencher group of the internal reference gene. Specifically, the fluorescent reporter group of the GAPDH-1 internal reference gene is VIC, and the fluorescent reporter group of the GAPDH-2 internal reference gene is ROX.

[0067] like Figure 3 As shown, the detection method is as follows:

[0068] 1. DNA extraction:

[0069] DNA was extracted from human endometrial cancer cells, non-endometrial cancer cells, and tissue sections / swab samples using a magnetic bead-based nucleic acid extraction kit and an automated nucleic acid extractor (AUto-pure-32A).

[0070] 2. Preparation of PCR reaction system:

[0071] Specific primers and probes were designed for the PCDHGB7-1, PCDHGB7-2, CELF4, and BHLHE22 genes, and PCR reaction systems were prepared accordingly; details are shown in Table 1 below.

[0072] Table 1

[0073]

[0074] 3. Amplification procedure:

[0075] The PCR reaction program settings are as follows:

[0076] The prepared PCR reaction system is then placed on the SLAN96P Real-Time PCR Instrument and the PCR reaction program is set (see Table 2) to amplify the target sequence.

[0077] Table 2 PCR reaction procedure

[0078]

[0079] 4. Interpretation of test results:

[0080] To determine the validity of the detection results of the same sample by four targets, the first step is to determine whether the enzyme digestion efficiency is greater than 90%.

[0081] The formula for calculating enzyme digestion efficiency is: 1-2^(-ΔCt), where ΔCt=Ct(GAPDH2) - Ct(GAPDH1), and Ct(GAPDH1) and Ct(GAPDH2) are the Ct values ​​of the GAPDH-1 gene detected by the VIC channel and the GAPDH-2 gene detected by the ROX channel.

[0082] Enzyme digestion efficiency is expressed as a percentage. If it is greater than or equal to 90%, the test is considered valid. Then, a predicted value (P-value) is calculated based on the ΔCt value of each gene to determine whether it is positive or negative. Specifically, the P-value for each sample can be calculated by substituting ΔCt into a specific mathematical model (such as Logistic Regression) to determine whether the target gene has undergone methylation. When P > 0.5, it is considered positive; when P < 0.5, it is considered negative; when P = 0.5, a retest is performed.

[0083] 5. Amplification curve of the results:

[0084] The samples were tested according to the above detection method. To visually demonstrate the application and interpretation principle of the primer-probe combination of the present invention in the detection of methylation in endometrial cancer, Figure 4 and Figure 5Amplification curves for simultaneous detection of three target genes in one negative sample and one positive sample are provided respectively.

[0085] like Figure 4 The image shows the amplification curves for the negative sample. The amplification curve for the internal reference gene GAPDH-1 (VIC channel, green curve) peaks early (Ct value approximately 22), indicating good sample DNA quality. The amplification curve for the internal reference gene GAPDH-2 (ROX channel, orange curve) peaks significantly later (Ct value approximately 28), and the calculated enzyme digestion efficiency is greater than 90%, proving that the methylation-sensitive restriction enzyme works completely effectively. The amplification signal for the target gene (FAM channel, blue curve) is weak, and the peak occurs very late, indicating that the target gene DNA template was effectively cleaved by the restriction enzyme because it was not methylated, resulting in extremely low PCR template quantity. The calculated P-value for this sample is much less than 0.5, indicating a negative result, consistent with the pathological findings.

[0086] like Figure 5 The image shows the amplification curves of positive samples, with the amplification performance of the internal reference genes GAPDH-1 (VIC channel, green curve) and GAPDH-2 (ROX channel, orange curve) being similar to... Figure 4 The results were completely consistent. The amplification curve of the target gene (FAM channel, blue curve) peaked very early (Ct value approximately 20), with strong signal and a steep curve, almost synchronous with the internal reference gene GAPDH-1. This indicates that the target gene is protected due to methylation and has not been cleaved by restriction enzymes, resulting in an intact template and highly efficient PCR amplification. The calculated P-value of this sample was greater than 0.5, indicating a positive result, consistent with the pathological findings.

[0087] pass Figure 4 and Figure 5 The side-by-side comparison clearly demonstrates that the primer-probe combination of the present invention can significantly distinguish between positive and negative samples of endometrial cancer in molecular endometrial cancer methylation detection. The huge contrast in the FAM channel amplification curves is a direct reflection of the high sensitivity and high specificity of the primer-probe combination methylation detection method of the present invention, and also verifies the scientific nature and accuracy of its interpretation logic (P-value calculation).

[0088] 6. Clinical Sample Validation: To verify the detection effect of this invention, a total of 293 clinical samples were collected for testing. The specific test data are shown in the table below:

[0089] Serial Number PCDHGB7-1 Δct value PCDHGB7-2Δct value CELF4Δct value BHLHE22Δct value p-value 0.5 interpretation Pathological results 1 2.58 6.03 5.61 0.72 0.02 Negative Negative 2 2.35 3.12 5.62 1.00 0.83 False positive Negative 3 1.52 2.28 5.90 0.86 0.99 False positive Negative 4 2.78 6.44 6.61 0.98 0.00 Negative Negative 5 3.40 5.52 5.32 0.65 0.03 Negative Negative 6 6.07 7.92 8.31 1.41 0.00 Negative Negative 7 5.31 3.94 8.21 1.75 0.00 Negative Negative 8 5.09 3.59 10.20 1.86 0.00 Negative Negative 9 4.59 3.64 6.34 1.17 0.04 Negative Negative 10 5.93 2.17 5.91 1.76 0.04 Negative Negative 11 5.41 1.96 4.41 2.07 0.11 Negative Negative 12 5.02 3.10 3.35 1.98 0.04 Negative Negative 13 3.43 2.99 5.99 2.52 0.02 Negative Negative 14 4.49 3.01 6.38 2.45 0.00 Negative Negative 15 5.01 3.20 6.38 2.56 0.00 Negative Negative 16 4.60 3.18 7.64 3.02 0.00 Negative Negative 17 4.93 2.82 6.82 2.62 0.00 Negative Negative 18 5.22 3.72 6.59 2.30 0.00 Negative Negative 19 3.31 3.16 5.73 1.94 0.08 Negative Negative 20 5.98 2.79 6.64 1.75 0.01 Negative Negative 21 5.09 4.22 7.14 2.61 0.00 Negative Negative 22 3.49 3.73 6.16 2.75 0.00 Negative Negative 23 3.48 2.46 3.21 1.22 0.91 False positive Negative 24 4.58 3.08 8.61 1.50 0.01 Negative Negative 25 5.18 3.90 8.87 2.48 0.00 Negative Negative 26 3.11 3.37 6.63 1.75 0.07 Negative Negative 27 1.86 4.50 4.85 1.69 0.10 Negative Negative 28 2.32 3.35 6.39 2.06 0.09 Negative Negative 29 3.19 3.75 6.21 1.87 0.03 Negative Negative 30 3.26 3.39 5.88 2.43 0.01 Negative Negative 31 3.23 1.72 4.36 1.70 0.89 False positive Negative 32 2.57 3.22 5.87 1.64 0.29 Negative Negative 33 2.19 3.77 5.73 1.64 0.19 Negative Negative 34 3.89 4.30 9.27 1.17 0.01 Negative Negative 35 3.45 3.54 5.94 2.12 0.02 Negative Negative 36 3.74 3.39 6.03 1.79 0.04 Negative Negative 37 3.55 4.01 6.06 1.89 0.01 Negative Negative 38 3.75 3.03 6.44 1.89 0.05 Negative Negative 39 3.24 3.51 5.79 2.01 0.04 Negative Negative 40 5.05 3.29 6.73 1.92 0.00 Negative Negative 41 3.74 2.15 5.77 1.48 0.60 False positive Negative 42 2.87 3.41 5.17 2.17 0.06 Negative Negative 43 4.10 2.90 5.94 2.56 0.01 Negative Negative 44 3.49 2.74 5.47 2.32 0.06 Negative Negative 45 4.59 2.07 6.28 2.49 0.02 Negative Negative 46 4.36 2.48 5.40 2.18 0.06 Negative Negative 47 15.12 3.34 7.15 2.47 0.00 Negative Negative 48 4.31 2.47 5.47 2.16 0.06 Negative Negative 49 5.47 3.12 5.33 2.05 0.01 Negative Negative 50 5.18 4.07 6.42 2.42 0.00 Negative Negative 51 5.46 3.54 6.82 2.46 0.00 Negative Negative 52 14.30 3.01 5.55 1.61 0.00 Negative Negative 53 14.40 3.51 6.11 2.03 0.00 Negative Negative 54 3.78 2.56 5.66 1.96 0.14 Negative Negative 55 5.03 3.46 6.67 2.50 0.00 Negative Negative 56 3.95 2.91 5.89 2.52 0.01 Negative Negative 57 3.81 2.70 5.55 2.19 0.06 Negative Negative 58 3.40 2.81 5.69 2.15 0.08 Negative Negative 59 8.06 4.29 6.26 2.64 0.00 Negative Negative 60 4.12 2.76 5.50 2.55 0.01 Negative Negative 61 2.95 2.65 5.06 2.35 0.15 Negative Negative 62 5.24 3.41 6.78 2.62 0.00 Negative Negative 63 2.59 2.38 4.56 2.24 0.45 Negative Negative 64 3.61 2.57 5.40 2.26 0.09 Negative Negative 65 3.39 2.45 5.37 2.29 0.13 Negative Negative 66 3.39 2.32 4.30 0.59 0.98 False positive Negative 67 5.28 3.88 6.23 2.69 0.00 Negative Negative 68 3.94 2.54 5.25 2.06 0.12 Negative Negative 69 3.44 2.48 5.62 2.09 0.17 Negative Negative 70 14.19 3.17 7.64 2.32 0.00 Negative Negative 71 4.82 2.50 4.77 1.56 0.22 Negative Negative 72 4.34 3.08 6.32 2.41 0.01 Negative Negative 73 4.80 2.48 5.45 2.51 0.01 Negative Negative 74 15.90 4.25 7.16 2.36 0.00 Negative Negative 75 5.23 3.61 6.50 2.53 0.00 Negative Negative 76 4.10 2.64 5.31 2.37 0.03 Negative Negative 77 5.36 3.18 6.15 2.99 0.00 Negative Negative 78 15.15 2.89 6.32 2.46 0.00 Negative Negative 79 3.69 1.67 5.25 1.92 0.61 False positive Negative 80 2.62 2.69 7.09 2.29 0.08 Negative Negative 81 3.10 2.77 6.23 2.31 0.06 Negative Negative 82 3.12 3.00 5.67 1.98 0.12 Negative Negative 83 2.37 2.77 5.56 2.46 0.13 Negative Negative 84 1.73 2.84 5.39 2.51 0.21 Negative Negative 85 1.75 2.80 5.60 2.48 0.21 Negative Negative 86 1.60 3.51 4.97 2.15 0.22 Negative Negative 87 2.92 3.35 6.80 2.49 0.01 Negative Negative 88 2.63 3.47 6.51 2.75 0.01 Negative Negative 89 3.59 3.69 7.14 2.60 0.00 Negative Negative 90 3.52 3.63 7.46 2.64 0.00 Negative Negative 91 2.23 3.95 6.64 2.54 0.01 Negative Negative 92 2.04 3.52 6.39 1.43 0.37 Negative Negative 93 2.82 3.34 5.92 2.12 0.05 Negative Negative 94 2.33 3.69 6.59 2.52 0.01 Negative Negative 95 2.00 2.50 5.61 2.31 0.37 Negative Negative 96 2.75 3.43 6.57 2.69 0.01 Negative Negative 97 2.30 2.90 6.18 2.38 0.10 Negative Negative 98 2.15 2.95 6.72 2.39 0.08 Negative Negative 99 2.40 4.28 7.70 3.04 0.00 Negative Negative 100 1.55 3.21 6.09 2.77 0.05 Negative Negative 101 1.97 2.94 5.76 2.49 0.12 Negative Negative 102 2.12 3.87 6.33 2.47 0.01 Negative Negative 103 1.50 2.70 4.88 2.22 0.59 False positive Negative 104 2.11 3.06 5.56 1.81 0.42 Negative Negative 105 1.87 2.86 4.72 1.67 0.78 False positive Negative 106 3.64 3.07 6.64 2.36 0.01 Negative Negative 107 2.52 2.99 4.78 2.06 0.28 Negative Negative 108 2.92 3.84 5.83 2.15 0.02 Negative Negative 109 2.04 3.13 5.24 2.09 0.27 Negative Negative 110 1.59 3.16 5.38 2.11 0.34 Negative Negative 111 1.72 3.01 5.74 2.42 0.16 Negative Negative 112 0.29 0.78 5.07 1.06 1.00 Positive Positive 113 1.84 2.65 5.23 1.41 0.90 Positive Positive 114 1.94 0.89 2.42 0.54 1.00 Positive Positive 115 1.07 1.72 1.12 0.00 1.00 Positive Positive 116 -0.02 0.62 2.94 0.14 1.00 Positive Positive 117 -0.42 -0.36 0.41 -0.20 1.00 Positive Positive 118 1.32 2.42 4.58 1.14 0.99 Positive Positive 119 0.03 0.80 1.54 -0.02 1.00 Positive Positive 120 1.70 2.70 3.81 0.77 0.99 Positive Positive 121 1.63 2.53 2.73 0.54 1.00 Positive Positive 122 2.51 3.25 4.28 1.42 0.67 Positive Positive 123 1.99 3.27 4.87 1.18 0.84 Positive Positive 124 -0.36 0.94 2.00 0.37 1.00 Positive Positive 125 -0.08 0.53 0.54 -1.00 1.00 Positive Positive 126 2.81 2.78 4.98 1.38 0.73 Positive Positive 127 2.36 2.94 5.26 1.38 0.74 Positive Positive 128 0.18 0.49 1.26 -0.22 1.00 Positive Positive 129 1.05 1.03 2.00 0.93 1.00 Positive Positive 130 0.93 2.11 4.51 0.99 1.00 Positive Positive 131 1.28 2.77 4.31 0.81 0.99 Positive Positive 132 -0.46 0.56 6.59 2.36 1.00 Positive Positive 133 -0.41 1.22 4.11 0.63 1.00 Positive Positive 134 0.80 2.35 2.81 0.60 1.00 Positive Positive 135 0.45 0.29 1.46 1.07 1.00 Positive Positive 136 1.73 2.67 5.19 1.10 0.96 Positive Positive 137 1.97 2.87 4.36 1.14 0.95 Positive Positive 138 0.55 0.45 1.37 0.17 1.00 Positive Positive 139 2.33 2.22 4.48 1.26 0.97 Positive Positive 140 0.84 0.65 2.10 0.52 1.00 Positive Positive 141 0.92 1.07 2.52 0.82 1.00 Positive Positive 142 0.98 1.71 3.15 0.43 1.00 Positive Positive 143 0.02 1.29 1.96 0.23 1.00 Positive Positive 144 1.06 1.92 3.12 1.20 1.00 Positive Positive 145 1.12 2.88 4.88 1.75 0.86 Positive Positive 146 0.29 2.67 4.23 1.23 0.99 Positive Positive 147 0.33 1.40 2.29 0.92 1.00 Positive Positive 148 -0.04 0.53 1.63 0.34 1.00 Positive Positive 149 0.95 2.33 3.65 1.45 0.99 Positive Positive 150 0.50 1.30 2.61 0.72 1.00 Positive Positive 151 1.55 2.09 2.85 1.07 1.00 Positive Positive 152 0.08 2.26 4.60 1.22 1.00 Positive Positive 153 0.89 1.80 2.69 1.00 1.00 Positive Positive 154 2.76 2.79 5.46 1.44 0.64 Positive Positive 155 2.12 2.95 4.05 1.44 0.86 Positive Positive 156 0.42 0.93 2.60 0.83 1.00 Positive Positive 157 0.00 1.10 2.59 1.10 1.00 Positive Positive 158 -0.62 0.31 1.59 0.03 1.00 Positive Positive 159 1.53 1.16 4.08 0.20 1.00 Positive Positive 160 0.79 2.10 4.34 1.11 1.00 Positive Positive 161 1.18 2.45 3.21 1.21 0.99 Positive Positive 162 2.79 2.49 3.38 1.26 0.95 Positive Positive 163 0.83 2.20 3.28 1.16 1.00 Positive Positive 164 0.56 1.03 2.38 0.33 1.00 Positive Positive 165 -0.26 1.03 2.71 0.62 1.00 Positive Positive 166 0.71 1.66 2.51 0.77 1.00 Positive Positive 167 0.57 0.67 5.99 2.29 0.99 Positive Positive 168 0.21 0.86 1.88 0.61 1.00 Positive Positive 169 -0.45 0.76 1.85 0.05 1.00 Positive Positive 170 0.81 1.11 1.86 0.54 1.00 Positive Positive 171 0.18 1.05 1.76 -0.02 1.00 Positive Positive 172 -0.54 0.13 4.95 0.86 1.00 Positive Positive 173 -0.21 -0.16 1.72 1.31 1.00 Positive Positive 174 -0.19 1.10 2.00 0.41 1.00 Positive Positive 175 0.85 2.38 3.14 0.93 1.00 Positive Positive 176 1.50 2.73 4.16 1.42 0.95 Positive Positive 177 1.61 1.66 2.54 0.92 1.00 Positive Positive 178 1.27 2.73 3.28 1.51 0.97 Positive Positive 179 1.11 2.85 4.32 1.36 0.97 Positive Positive 180 1.15 1.92 3.47 0.94 1.00 Positive Positive 181 1.62 1.62 2.71 0.81 1.00 Positive Positive 182 0.82 0.92 2.21 1.02 1.00 Positive Positive 183 0.81 1.66 5.92 2.04 0.96 Positive Positive 184 -0.31 0.29 4.46 0.73 1.00 Positive Positive 185 0.80 2.06 3.23 1.15 1.00 Positive Positive 186 0.87 2.31 3.54 1.39 0.99 Positive Positive 187 0.86 1.32 2.26 1.12 1.00 Positive Positive 188 0.81 1.48 2.93 1.87 1.00 Positive Positive 189 0.28 0.98 2.19 0.48 1.00 Positive Positive 190 1.33 2.82 4.17 1.14 0.98 Positive Positive 191 0.37 2.32 10.97 1.14 0.89 Positive Positive 192 0.23 1.22 3.38 2.56 0.99 Positive Positive 193 0.01 2.78 6.09 1.05 0.99 Positive Positive 194 1.07 2.75 8.92 1.43 0.67 Positive Positive 195 1.32 2.59 3.96 1.99 0.88 Positive Positive 196 0.73 1.06 1.15 1.85 1.00 Positive Positive 197 1.27 2.44 3.59 1.39 0.99 Positive Positive 198 0.63 3.10 3.04 1.28 0.99 Positive Positive 199 0.01 1.03 5.14 1.24 1.00 Positive Positive 200 0.80 1.79 4.31 1.89 0.99 Positive Positive 201 1.01 2.73 6.67 1.49 0.88 Positive Positive 202 1.47 2.71 3.63 1.95 0.87 Positive Positive 203 0.71 2.36 3.51 1.11 1.00 Positive Positive 204 0.34 2.17 5.15 1.16 1.00 Positive Positive 205 0.94 2.86 4.37 1.50 0.96 Positive Positive 206 0.74 1.60 8.38 1.09 0.99 Positive Positive 207 -0.29 0.47 3.66 0.33 1.00 Positive Positive 208 0.31 2.17 10.08 1.01 0.97 Positive Positive 209 1.63 1.80 -3.32 1.56 1.00 Positive Positive 210 -0.31 1.76 5.57 1.24 1.00 Positive Positive 211 1.17 2.84 -0.81 1.63 1.00 Positive Positive 212 -1.38 0.09 7.02 -0.04 1.00 Positive Positive 213 0.47 2.84 3.72 1.27 0.99 Positive Positive 214 -0.07 2.40 4.39 1.13 1.00 Positive Positive 215 0.48 2.26 4.49 0.96 1.00 Positive Positive 216 -0.20 1.31 2.42 1.75 1.00 Positive Positive 217 -0.35 0.97 5.61 0.10 1.00 Positive Positive 218 -0.36 0.50 4.12 1.39 1.00 Positive Positive 219 0.30 2.05 2.98 1.06 1.00 Positive Positive 220 0.60 1.38 -0.18 1.03 1.00 Positive Positive 221 -0.27 1.11 3.07 0.78 1.00 Positive Positive 222 -1.27 -0.02 5.32 0.43 1.00 Positive Positive 223 0.09 1.95 4.23 0.88 1.00 Positive Positive 224 0.13 2.54 2.32 1.22 1.00 Positive Positive 225 -0.19 1.32 3.50 0.47 1.00 Positive Positive 226 0.14 0.53 6.92 0.81 1.00 Positive Positive 227 2.03 3.40 -0.41 1.44 0.97 Positive Positive 228 -1.27 0.74 4.83 0.86 1.00 Positive Positive 229 -0.02 0.68 1.44 0.71 1.00 Positive Positive 230 -0.42 1.77 0.82 0.66 1.00 Positive Positive 231 -0.81 1.67 4.16 0.44 1.00 Positive Positive 232 -0.13 2.26 5.90 0.83 1.00 Positive Positive 233 0.33 1.21 2.64 0.95 1.00 Positive Positive 234 0.30 1.35 1.02 1.28 1.00 Positive Positive 235 0.27 2.29 3.82 1.13 1.00 Positive Positive 236 3.03 1.18 7.59 2.21 0.51 Positive Positive 237 2.98 1.06 4.45 2.11 0.92 Positive Positive 238 3.44 1.52 4.06 2.31 0.65 Positive Positive 239 3.10 1.17 4.37 2.07 0.91 Positive Positive 240 3.12 1.45 4.34 2.23 0.77 Positive Positive 241 3.30 1.84 2.46 1.53 0.97 Positive Positive 242 3.05 1.35 1.97 1.25 1.00 Positive Positive 243 3.86 3.14 5.79 1.39 0.18 False negative Positive 244 2.67 3.12 4.73 1.72 0.41 False negative Positive 245 2.24 3.39 4.89 1.61 0.46 False negative Positive 246 2.44 3.06 4.52 1.44 0.72 Positive Positive 247 2.54 1.60 1.85 2.13 0.97 Positive Positive 248 3.10 0.85 1.74 2.03 0.99 Positive Positive 249 1.94 2.13 6.08 2.17 0.60 Positive Positive 250 1.95 2.11 5.53 1.95 0.80 Positive Positive 251 2.27 2.81 6.00 1.92 0.36 False negative Positive 252 1.63 1.63 5.74 2.03 0.92 Positive Positive 253 2.01 2.95 6.09 1.91 0.36 False negative Positive 254 1.24 1.84 2.48 0.91 1.00 Positive Positive 255 1.20 1.95 2.34 1.12 1.00 Positive Positive 256 1.71 2.15 2.78 1.44 0.99 Positive Positive 257 2.64 3.54 5.88 1.93 0.08 False negative Positive 258 1.96 1.43 2.25 0.92 1.00 Positive Positive 259 2.12 1.30 2.71 0.45 1.00 Positive Positive 260 1.84 0.95 1.79 1.01 1.00 Positive Positive 261 2.50 1.56 2.85 1.45 0.99 Positive Positive 262 3.70 1.65 3.21 1.48 0.95 Positive Positive 263 1.85 3.02 5.33 1.54 0.73 Positive Positive 264 1.51 2.87 4.98 1.60 0.85 Positive Positive 265 3.47 1.68 5.60 0.32 0.99 Positive Positive 266 3.22 1.47 4.47 1.09 0.99 Positive Positive 267 1.87 0.10 3.20 -0.48 1.00 Positive Positive 268 3.78 1.93 5.03 1.96 0.46 False negative Positive 269 3.09 1.42 4.53 2.82 0.38 False negative Positive 270 1.94 0.91 1.89 1.29 1.00 Positive Positive 271 2.38 1.07 2.05 1.59 1.00 Positive Positive 272 1.96 0.81 2.04 1.47 1.00 Positive Positive 273 2.51 1.11 1.85 1.58 1.00 Positive Positive 274 2.81 1.62 2.32 2.21 0.92 Positive Positive 275 2.90 1.52 6.09 1.25 0.96 Positive Positive 276 2.99 1.59 6.04 1.02 0.97 Positive Positive 277 3.26 0.93 4.88 0.71 1.00 Positive Positive 278 3.75 3.19 4.42 1.17 0.49 False negative Positive 279 3.87 1.42 5.79 1.21 0.92 Positive Positive 280 3.67 2.40 2.49 1.27 0.92 Positive Positive 281 4.35 1.62 2.02 0.95 0.99 Positive Positive 282 3.38 3.06 4.12 1.15 0.71 Positive Positive 283 3.48 1.12 1.55 1.57 0.99 Positive Positive 284 5.28 1.80 2.05 0.99 0.95 Positive Positive 285 3.70 0.86 2.15 0.69 1.00 Positive Positive 286 3.70 2.91 3.89 1.61 0.41 False negative Positive 287 3.67 1.90 2.96 0.50 1.00 Positive Positive 288 3.47 3.44 5.46 1.30 0.24 False negative Positive 289 3.58 1.97 3.07 0.74 0.99 Positive Positive 290 4.88 1.51 5.47 0.63 0.95 Positive Positive 291 4.93 1.48 1.74 -0.12 1.00 Positive Positive 292 2.98 1.92 4.23 1.25 0.97 Positive Positive 293 3.69 2.84 3.35 1.41 0.66 Positive Positive

[0090] The specific statistical results are as follows:

[0091]

[0092] The results above demonstrate that the primer-probe combination of this invention exhibits high accuracy in the detection of endometrial cancer. Specifically, the combined detection of the PCDHGB7-1, PCDHGB7-2, CELF4, and BHLHE22 genes maintains a high specificity of 91.89% while achieving an overall sensitivity of 93.96%, showcasing the powerful ability of this combination to differentiate between endometrial cancer patients and non-cancer patients. (See attached...) Figure 1 The figure shows the in-depth analysis results of the ROC curve for endometrial cancer detection. The ROC curve analysis clearly shows an AUC (area under the curve) value of 0.983, close to 1, further demonstrating the excellent discriminative ability of the primer-probe combination of this invention in endometrial cancer detection. Each point in the ROC curve represents the balance between sensitivity and specificity at different thresholds. It is clearly observed from the figure that sensitivity and specificity exhibit a complementary relationship as the threshold changes. While maintaining high specificity, the primer-probe combination of this invention also demonstrates high sensitivity, which is of great significance for clinical diagnosis and screening. (See attached figure.) Figure 2 The diagram shows the probability distribution of positive and negative results for 293 samples. The maximum and minimum values ​​for negative and positive results show no overlap. Furthermore, the entire detection process does not require bisulfite conversion of DNA, shortening the detection time, avoiding contamination and template loss during conversion, resulting in higher detection accuracy, and reducing the workload of laboratory personnel.

[0093] In summary, the primer-probe combination of this invention exhibits high accuracy and reliability, providing a novel and effective tool for the clinical diagnosis and screening of endometrial cancer. By jointly detecting the expression levels of the PCDHGB7-1, PCDHGB7-2, CELF4, and BHLHE22 genes, it achieves high sensitivity and specificity in distinguishing between endometrial cancer patients and non-patients. This method not only simplifies the detection process and shortens the detection time but also improves the accuracy and reliability of the detection, providing strong support for the early diagnosis and treatment of endometrial cancer.

[0094] The above embodiments are only used to illustrate the technical solutions of the present invention, and are not intended to limit it. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features. Such modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. A methylated primer-probe composition for early diagnosis of endometrial cancer, characterized in that: The target genes of the primer-probe composition include: PCDHGB7 gene, CELF4 gene and BHLHE22 gene. The target region of PCDHGB7 is two target sequences in the whole gene sequence, which are denoted as PCDHGB7-1 gene and PCDHGB7-2 gene, respectively. The primer-probe sequence is specifically represented as follows: The upstream primer sequence for the PCDHGB7-1 gene is: GTTTGTGCTGGACCAGAACG. Downstream primer sequence of PCDHGB7-1 gene: CACCTTGGTCACCAGGTAG, Probe sequence for the PCDHGB7-1 gene: ATGCGCCCGAGATCCTGTAC; The upstream primer sequence for the PCDHGB7-2 gene is: TGGAAAAGCGGGGACCCAG. Downstream primer sequence for the PCDHGB7-2 gene: CAGCAAAGGAAATAGTACCTG The probe sequence for the PCDHGB7-2 gene is: AGAACCCGAGCGAACGATGG; The upstream primer sequence for the CELF4 gene is: CAGGAACGACTCAGCCTCG. The downstream primer sequence for the CELF4 gene is: TGATCGCTATCTGGGTTGC. Probe sequence for the CELF4 gene: ACCTCGGGAGCTGTAGGTGC; The upstream primer sequence for the BHLHE22 gene is: CTGACATGATCGATCCTTCG. Downstream primer sequence for the BHLHE22 gene: TTTGTGGGCTGCCACCTTC The probe sequence for the BHLHE22 gene is: AAATGTCCACTTCGGGCCG.

2. The methylation primer-probe composition for early diagnosis of endometrial cancer according to claim 1, characterized in that: The probe is labeled with a fluorescent reporter group at its 5' end and a fluorescent quencher group at its 3' end.

3. The methylation primer-probe composition for early diagnosis of endometrial cancer according to claim 2, characterized in that: The fluorescent reporter group is any one of FAM, VIC, and ROX; the fluorescent quencher group is MGB.

4. The use of the primer-probe composition according to any one of claims 1-3 in an endometrial cancer methylation detection kit.

5. The application according to claim 4, characterized in that: It also includes dNTPs, hot-start Taq DNA polymerase, reaction buffer, and methylation-sensitive endonuclease.

6. The application according to claim 5, characterized in that: The methylation-sensitive endonuclease is a methylation-sensitive restriction endonuclease, specifically any combination of Acil, Hhal, Hinp1I, and HpaII.

7. The application according to claim 4, characterized in that: It also includes two sequences from a reference marker GAPDH gene: the GAPDH-1 gene and the GAPDH-2 gene; wherein, the GAPDH-1 gene amplification fragment does not contain restriction enzyme sites, and the GAPDH-2 gene amplification fragment has methylation restriction endonuclease sites and is in a non-methylated state in the human genome, and its primer and probe sequences are specifically represented as follows; The upstream primer sequence for the GAPDH-1 gene is: TTGACTCCCTAGTGTCCT. The downstream primer sequence for the GAPDH-1 gene is: CAATCTCAGTCCCTTCCC. The probe sequence for the GAPDH-1 gene is: TGCCCACAGTCCAGTCCT; The upstream primer sequence for the GAPDH-2 gene is: GTCCCCAGAAACAGGAGG. The downstream primer sequence for the GAPDH-2 gene is: TCACGTGTCGCAGAGGAG. The probe sequence for the GAPDH-2 gene is: CCTACTCCCGCCCGAGAT.

8. A method for interpreting the primer-probe composition according to any one of claims 1-7 for detecting methylation in endometrial cancer, characterized in that, Includes the following steps: a) Obtain the ΔCt values ​​of PCDHGB7-1, PCDHGB7-2, CELF4, and BHLHE22 genes relative to the internal reference gene in the sample; b) Input the ΔCt values ​​obtained in step a) into the calculation program built based on the logistic regression model to calculate a P value representing the probability of methylation positivity; c) Interpret the detection results based on the P-value: If P > 0.5, it is interpreted as methylation positive; If P < 0.5, it is interpreted as methylation negative; If P = 0.5, then it is determined that a retest is required.

Images