Triple fluorescent quantitative PCR detection kit for simultaneously detecting CHIKV, BFV and RRV

By designing specific primer-probe combinations and a real-time PCR detection method, the problem of distinguishing between CHIKV, BFV, and RRV infections has been solved, achieving a simple and efficient triple virus detection method suitable for rapid diagnosis of mosquito-borne viruses.

CN120924733AActive Publication Date: 2025-11-11SANYA INSTITUTE OF NANJING AGRICULTURAL UNIVERSITY
View PDF 6 Cites 0 Cited by

Patent Information

Application Number
CN202511467133.4
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-10-14
Publication Date
2025-11-11
Estimated Expiration
2045-10-14

AI Technical Summary

Technical Problem

Existing technologies are insufficient to effectively differentiate and rapidly detect infections of chikungunya virus (CHIKV), Bama forest virus (BFV), and Ross River virus (RRV) transmitted by mosquitoes, especially when clinical symptoms overlap, and there is a lack of simple, rapid, and efficient detection methods.

Method used

A specific primer-probe composition was designed, containing primer pairs and probes for detecting CHIKV, BFV, and RRV, and applied in quantitative real-time PCR detection. Fluorescence signals were collected using a quantitative real-time PCR instrument, and the presence of viral nucleic acid in the sample was determined by combining the Cq value. A triple TaqMan probe-based qPCR detection kit was established.

Benefits of technology

This technology enables the simultaneous identification and detection of CHIKV, BFV, and RRV in a single PCR reaction tube, exhibiting high sensitivity, specificity, and repeatability. It allows for rapid and efficient clinical testing and diagnosis, reducing workload and improving testing efficiency.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120924733A_ABST
    Figure CN120924733A_ABST
Patent Text Reader

Abstract

The invention discloses a triple fluorescent quantitative PCR detection kit for simultaneously detecting CHIKV, BFV and RRV, and the kit comprises a specific primer probe composition for simultaneously detecting chikungunya virus, Bama forest virus and Rosc river virus, three viruses which are transmitted through entomophilous and cause human acute fever with arthralgia symptoms can be simultaneously detected in one PCR reaction tube, the lowest detection concentration of CHIKV plasmid samples is 20 copies / microliter, the lowest detection concentration of RRV and BFV positive samples is 10 copies / microliter, and the kit has excellent specificity and repeatability, and can be used for detecting the acute fever with arthralgia symptoms of the human acute fever with the arthralgia symptoms of the human acute fever with the arthralgia symptoms of the human acute fever with the arthralgia symptoms. The kit is suitable for conventional laboratory diagnosis of suspected alphavirus infection samples, and a rapid and accurate detection method is provided for epidemiological research of CHIKV, BFV and RRV.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to a triple qPCR detection kit for the simultaneous detection of Chikungunya virus (CHIKV), Barmah Forest virus (BFV), and Ross River virus (RRV) and its application. Background Technology

[0002] Mosquito-borne viral diseases caused by Chikungunya virus (CHIKV), Bama Forest virus (BFV), and Ross River virus (RRV) pose a significant challenge to public health security in my country. Currently, acute fever accompanied by joint pain caused by CHIKV infection is the most common clinically, especially CHIKV strains carrying E1 protein gene mutations (such as A226V), which have been widespread globally since the 21st century and are often accompanied by mixed infections with various alphaviruses, such as BFV or RRV. These alphaviruses are highly contagious (mainly transmitted by mosquitoes such as Aedes and Culex), have high pathogenicity, and can cause acute fever, joint swelling and pain, and rashes in humans. In some patients, joint pain can last for months to years, posing a significant health risk. In addition, BFV and RRV can maintain the ecological cycle in nature through wild animals such as kangaroos and opossums. Related antibodies can also be detected in livestock such as cattle, sheep and horses, but clinical symptoms are not obvious. These animals are more of a potential reservoir host than the main pathogen.

[0003] However, clinical symptoms alone are insufficient to effectively differentiate between different viral infections. For example, both CHIKV and RRV infections present with joint pain, and the early symptoms of CHIKV and BFV infections overlap in animals. The complexity of their etiologies poses a significant challenge to related detection, diagnosis, and prevention efforts. Therefore, establishing a simple, rapid, efficient, and economical detection method for these common alphaviruses is an urgent problem to be solved in the prevention and control of human infectious diseases.

[0004] Multiplex qPCR technology can simultaneously detect multiple pathogens in a single reaction, enabling rapid differentiation of complex and varied mosquito-borne viral pathogens causing acute fever and joint pain in humans. Compared to conventional PCR, this technology offers higher sensitivity and direct analysis of results without the need for electrophoresis and sequencing, significantly reducing material and personnel costs. It is particularly suitable for large-scale sample testing or the differential diagnosis of mixed infections. However, because multiplex qPCR uses multiple primer and probe pairs in a single reaction system, high specificity between primer pairs and probes is crucial to ensure effective execution and avoid non-specific amplification products. Furthermore, the complex nucleic acid environment in clinical samples and the differences in annealing temperatures among different primer pairs are major factors limiting the development of multiplex qPCR methods. Although establishing a multiplex TaqMan probe-based qPCR method presents numerous challenges, it holds immense clinical value for the rapid detection and identification of the aforementioned mosquito-borne viral pathogens. Summary of the Invention

[0005] To address the technical problem of the lack of a triple detection method in the existing technology for identifying and detecting CHIKV, BFV, and RRV, which are transmitted by insect vectors and cause acute fever and joint pain symptoms in humans, this invention provides a triple fluorescence quantitative PCR detection kit for the simultaneous detection of CHIKV, BFV, and RRV.

[0006] The objective of this invention can be achieved through the following technical solutions:

[0007] In a first aspect, the present invention claims protection for a specific primer and probe composition for detecting CHIKV, BFV, and RRV, the specific primer and probe composition comprising primer pairs and probes for detecting CHIKV, primer pairs and probes for detecting BFV, and primer pairs and probes for detecting RRV.

[0008] Primer pairs and probes used for detecting CHIKV:

[0009] Forward primer CHIKV-F: as shown in SEQ ID NO: 1;

[0010] Reverse primer CHIKV-R: as shown in SEQ ID NO: 2;

[0011] The CHIKV-Probe is as shown in SEQ ID NO: 3, with a CY5 fluorescent group labeled at the 5' end and a BHQ3 quencher group labeled at the 3' end.

[0012] Primer pairs and probes used for detecting BFV:

[0013] Forward primer BFV-F: as shown in SEQ ID NO: 4;

[0014] Reverse primer BFV-R: as shown in SEQ ID NO: 5;

[0015] The BFV-Probe is as shown in SEQ ID NO: 6, with a VIC fluorescent group labeled at the 5' end and a BHQ1 quencher group labeled at the 3' end.

[0016] Primer pairs and probes used for detecting RRV:

[0017] Forward primer RRV-F: as shown in SEQ ID NO: 7;

[0018] Reverse primer RRV-R: as shown in SEQ ID NO: 8;

[0019] The probe RRV-Probe, as shown in SEQ ID NO: 9, has a FAM fluorescent group labeled at the 5' end and an MGB quencher group labeled at the 3' end.

[0020] Secondly, the present invention seeks protection for the use of the above-described specific primer-probe composition in the preparation of a triple TaqMan probe-based real-time PCR detection reaction solution for detecting CHIKV, BFV, and RRV.

[0021] Thirdly, the present invention seeks protection for the use of the above-described specific primer-probe composition in the preparation of a triple TaqMan probe-based quantitative PCR detection kit for detecting CHIKV, BFV, and RRV.

[0022] Fourthly, this invention claims protection for a triple TaqMan probe-based real-time PCR detection reaction solution for detecting CHIKV, BFV, and RRV, the reaction solution comprising the aforementioned specific primer-probe composition and Mg 2+ Ions, dNTPs mixture, hot-start Taq DNA polymerase, and PCR buffer.

[0023] Fifthly, this invention claims protection for a triple TaqMan probe real-time PCR detection kit for detecting CHIKV, BFV, and RRV, the kit comprising the aforementioned reaction solution and controls; the controls include positive controls and negative controls; the positive controls are standard templates containing the NSP gene of CHIKV and RRV and the CAP gene of BFV, and the negative controls are nuclease-free water.

[0024] Furthermore, the standard templates containing the NSP genes of CHIKV and RRV, and the CAP gene of BFV, are recombinant plasmids containing the NSP genes of CHIKV and RRV, and the CAP gene of BFV. In a specific embodiment of the present invention, the method for constructing the recombinant plasmid is as follows: the NSP gene fragments of CHIKV, the CAP gene fragments of BFV, and the NSP gene fragments of RRV are cloned into the pMD18-T vector, respectively.

[0025] This kit should be stored at -20°C, and the number of freeze-thaw cycles should be minimized.

[0026] Sixthly, the present invention claims a method for simultaneously detecting CHIKV, BFV, and RRV nucleic acids in an in vitro sample for non-diagnostic purposes, the method comprising the following steps:

[0027] Step 1: Extract RNA from the sample and reverse transcribe it into cDNA;

[0028] Step 2: Using the aforementioned specific primer and probe composition, and with the cDNA obtained in Step 1 as a template, prepare a qPCR reaction system, perform PCR amplification, and collect fluorescence signals in the FAM, VIC, and CY5 channels, respectively.

[0029] Step 3: Determine whether the sample contains CHIKV (CY5), BFV (VIC), or RRV (FAM) nucleic acids based on the fluorescence signal and Cq value measured by the machine.

[0030] Furthermore, in step 2, the PCR amplification reaction program is set as follows: the fluorescence channels are set as follows: CY5 for CHIKV, VIC for BFV, and FAM for RRV; the reaction program is as follows: 95 ℃ pre-denaturation for 10 min; 40 cycles, each cycle including: 95 ℃ denaturation for 10 s, 62 ℃ annealing for 30 s, while fluorescence signals are collected using a real-time PCR instrument.

[0031] Furthermore, in step 2, the qPCR reaction system, in 20 µL increments, comprises: 10 µL Probe MasterMix (probe premix) (containing Mg... 2+ The following components were added: ions, dNTPs mixture, hot-start Taq DNA polymerase and PCR buffer; 0.3 µL each of the three pairs of forward and reverse primers in the aforementioned specific primer and probe composition; 0.3 µL each of the three probes; 0.5 µL of cDNA template; and nuclease-free water to a final volume of 20 µL.

[0032] Furthermore, in step 3, the criteria for determining whether there is CHIKV, BFV, or RRV nucleic acid in the sample based on the fluorescence signal and Cq value calculated by the machine are as follows: if the Cq value of a certain channel is ≤35, it is determined to be positive for CHIKV, BFV, or RRV nucleic acid; if the Cq value is ≥38, it is determined to be negative; if 35 < Cq value < 38, it is determined to be suspicious and needs to be retested.

[0033] In a specific embodiment of the present invention, in step 1, reverse transcription is performed using the HiScript® II 1st StrandcDNA Synthesis Kit, with a total reaction volume of 20 µL, comprising: 1 µL Random hexamers, 1 µL Oligo (dT)23VN, 5 µL nuclease-free water, and 5 µL total RNA. After mixing, the mixture is heated at 65 °C for 5 min, then placed on ice for 3 min. Next, 4 µL of 4×gDNA wiper Mix (4× genomic DNA removal premix) is added. After mixing, the mixture is heated at 42 °C for 2 min. Then, 2 µL of 10×RT Mix and 2 µL of HiScript® II Enzyme Mix (HiScript® II enzyme premix) are added.

[0034] The reverse transcription reaction procedure was as follows: heat at 25℃ for 5 min, heat at 50℃ for 45 min, and heat at 85℃ for 2 min. After the reaction, cDNA template was obtained.

[0035] As a further explanation of the present invention, a positive control and a negative control should be set up for each test. The positive control uses the constructed standard quality plasmid as a template, and the template for the negative control is nuclease-free water. All water used is nuclease-free water; sterile double-distilled water can also be used.

[0036] As a further illustration of the present invention, the primer concentration used in the qPCR reaction system is 30 μM, and the probe concentration is 30 μM.

[0037] As a further explanation of the present invention, the CHIKV, BFV, and RRV triple fluorescence quantitative PCR detection kit should have 3-4 parallel wells for each test sample. For samples with questionable results, at least three replicate experiments should be performed.

[0038] The kit of this invention includes specific primers and fluorescent probes for the NSP gene of CHIKV and RRV, and the CAP gene of BFV. Experimental verification shows that it does not cross-react with alphaviruses and other important pathogens, including ONNV (O'nyong-nyong virus), SFV (Semliki Forest Virus), SINV (Sindbis virus), and VEEV (Venezuelan Equine Encephalomyelitis Virus).

[0039] Compared with the prior art, the triple qPCR detection kit of the present invention has the following technical advantages:

[0040] 1. The ability to simultaneously identify and detect CHIKV, BFV, and RRV in a single PCR reaction tube provides a simple, efficient, and low-cost method for detecting these three pathogens;

[0041] 2. The triple TaqMan probe qPCR detection kit of this invention showed consistent detection results with single qPCR detection in detecting positive samples of various target viruses, further proving the feasibility of the method of this invention. Furthermore, verification showed that this invention can detect plasmid samples with a minimum concentration of 20 copies / μL for CHIKV and positive samples with a minimum concentration of 10 copies / μL for BFV and RRV. It has copies / μL and excellent specificity and repeatability.

[0042] 3. The detection kit in this invention provides reliable technical support for the prevention and control of this type of disease, and greatly reduces the workload of single detection methods, thus significantly improving work efficiency.

[0043] 4. The detection kit in this invention has excellent repeatability and sensitivity, and can perform rapid and efficient clinical detection of three viruses that are transmitted by insect vectors and cause acute fever and joint pain symptoms in humans, thereby simultaneously diagnosing and monitoring these three pathogens. Attached Figure Description

[0044] Figure 1 This document describes the preparation of standards and standard curves for the triplet TaqMan qPCR detection method in Example 1. Specifically, plasmid standards A and C for CHIKV, BFV, and RRV were prepared using 1×10⁻⁶ plasmids. 7 copies / μL - 1×10 1 Fluorescence amplification curves at 7 concentration gradients (copies / μL); DF represents the standard curves for CHIKV, BFV, and RRV, respectively.

[0045] Figure 2 This is a graph showing the results of a co-infection simulation experiment involving any two of the three pathogens at the lower limit of detection concentration. Where A: BFV (1×10⁻⁶) 1 copies / μL) and CHIKV (2×10) 1 Fluorescence amplification curves for plasmid-simulated co-infected samples (copies / μL); B: BFV (1×10⁻⁶ copies / μL); 1 copies / μL) and RRV (1×10 1 Fluorescence amplification curves of plasmid-simulated co-infected samples (copies / μL); C: RRV (1×10⁻⁶ copies / μL); 1 copies / μL) and CHIKV (2×10) 1 Fluorescence amplification curves were detected in samples co-infected with plasmids (copies / μL).

[0046] Figure 3 The figure shows the results of a simulation experiment of co-infection with three pathogens at the lower limit of detection concentration. Among them, BFV (1×10⁻⁶) 1 copies / μL), RRV (1×10 1 copies / μL) and CHIKV (2×10) 1 (copies / μL).

[0047] Figure 4 The fluorescence amplification curves for detecting positive clinical samples of ONNV, SFV, SINV, VEEV, GETV, and CHIKV plasmids, as well as BFV and RRV, using the triple qPCR detection method established in this invention are shown. Detailed Implementation

[0048] The following embodiments further illustrate the content of the present invention, but should not be construed as limiting the present invention. Any modifications or substitutions made to the methods, steps, or conditions of the present invention without departing from the spirit and essence of the invention are within the scope of the present invention. Experimental methods and reagents not specifically described in the embodiments are performed according to conventional conditions in the art.

[0049] Example 1

[0050] In this embodiment, a CHIKV, BFV, and RRV real-time PCR detection kit with excellent specificity, sensitivity, and stability is provided, and the steps are as follows:

[0051] 1. Construction and validation of the detection method

[0052] (1) Synthesize qPCR primer pairs and TaqMan probes for detecting CHIKV, BFV, and RRV. The specific sequences of the primers and probes are as follows:

[0053] Primer pair sequences and TaqMan probe sequences used for detecting Chikungunya virus (CHIKV):

[0054] CHIKV-F: 5'-TCCAGGCGGTGTACACTGCC-3' (SEQ ID NO: 1)

[0055] CHIKV-R: 5'-TAGTCAATTTGCAGTTGTTTAACCC-3' (SEQ ID NO: 2)

[0056] chikv-tz2: 5'-CY5- CATTACGAAGGCAAAATGCGCAC-BHQ3-3' (SEQ ID NO: 3).

[0057] Primer pair sequences and TaqMan probe sequences used for detecting Barmah Forest virus (BFV):

[0058] BFV-F: 5'-CCAGAACTAGCCAAATTGACA-3' (SEQ ID NO: 4)

[0059] BFV-R: 5'-GGTGCCAGTTGTARTGTCCT-3' (SEQ ID NO: 5)

[0060] BFV-Probe: 5'-VIC-TGAAATCAGACGCATCCAAGTTCACC-BHQ1-3' (SEQ ID NO: 6).

[0061] Primer pair sequences and TaqMan probe sequences used for detecting Ross River virus (RRV):

[0062] RRV-F: 5'-TTGTTCGATATGTCGGCAGAAG-3' (SEQ ID NO: 7)

[0063] RRV-R: 5'-AAATTCCGGACTTCATCATGG-3' (SEQ ID NO: 8)

[0064] RRV-NSP4-Probe: 5'-FAM-CTGCCAACAGGTACGCGGTTCAAG-MGB-3' (SEQ ID NO: 9).

[0065] (2) Constructing standard template plasmids

[0066] The plasmid standards for CHIKV, BFV, and RRV are standard template plasmids containing the NSP gene of CHIKV and RRV, and the CAP gene of BFV. The NSP gene fragments of CHIKV and RRV, and the CAP gene fragment of BFV are amplified separately, ligated into the pMD18-T vector, and recombinant plasmids are constructed to serve as standard templates. The detailed construction process of the recombinant plasmids is as follows:

[0067] a. Obtaining the target gene amplification template from the sample to be tested: BFV and RRV virus samples preserved in the laboratory were inoculated into BHK-21 cells. After the cells showed obvious cytopathic effects, cellular RNA was extracted and reverse transcribed into a cDNA template. The target gene amplification template for the CHIKV sample was synthesized by the company. The synthetic sequence of the target gene amplification template for the CHIKV sample is as follows:

[0068] TTGAATGGATGTAACAGACCAGTCGACGTGTTGTACGTAGACGAGGCGTTTGCGTGCCACTCTGGAACGTTACTTGCATTGATCGCCTTGGTGAGACCAAGACAGAAAGTTGTACTTTGTGGTGACCCGAAGCAGTGCGGCTTCTTCAATATGATGCAGATGAAAGTCAACTATAATCACAACATCTGCACCCAAGTGTACCACAAAAGTATCTCCAGGCGGTGTACACTGCCTGTGACTGCCATTG TGTCATCGTTGCATTACGAAGGCAAAATGCGCACTACGAATGAGTACAACAAGCCGATTGTAGTGGACACTACAGGCTCAACAAAACCTGACCCTGGAGATCTCGTGTTAACGTGCTTCAGAGGATGGGTTAAACAACTGCAAATTGACTATCGTGGACACGAGGTCATGACAGCAGCCGCATCCCAAGGGTTAACCAGAAAAGGAGTTTACGCAGTTAGGCAAAAAGTTAACGAAAACCCGCT (SEQ ID NO: 10).

[0069] The reverse transcription was performed using the HiScript® II 1st Strand cDNA Synthesis Kit. The total reaction volume was 20 µL, comprising: 1 µL Random hexamers, 1 µL Oligo (dT)23VN, 5 µL nuclease-free water, and 5 µL total RNA. After mixing, the mixture was heated at 65 °C for 5 min, then incubated on ice for 3 min. Next, 4 µL of 4×gDNA wiper Mix was added, and the mixture was heated at 42 °C for 2 min. Then, 2 µL of 10×RT Mix and 2 µL of HiScript® II Enzyme Mix were added. The reverse transcription reaction program was: heating at 25 °C for 5 min, at 50 °C for 45 min, and at 85 °C for 2 min, yielding a cDNA template.

[0070] b. Preparation of positive standards: The three target genes were amplified and ligated into the pMD18-T vector to construct recombinant plasmids for use as standard templates.

[0071] The specific sequences of the primer pairs for amplifying the target gene are as follows:

[0072] CHIKV-F: 5'-TCCAGGCGGTGTACACTGCC-3' (SEQ ID NO: 1)

[0073] CHIKV-R: 5'-TAGTCAATTTGCAGTTGTTTAACCC-3' (SEQ ID NO: 2)

[0074] BFV-F: 5'-CCAGAACTAGCCAAATTGACA-3' (SEQ ID NO: 4)

[0075] BFV-R: 5'-GGTGCCAGTTGTARTGTCCT-3' (SEQ ID NO: 5)

[0076] RRV-F: 5'-TTGTTCGATATGTCGGCAGAAG-3' (SEQ ID NO: 7)

[0077] RRV-R: 5'-AAATTCCGGACTTCATCATGG-3' (SEQ ID NO: 8)

[0078] 2. Establishment of the standard curve

[0079] (1) Prepare a solution with a dilution factor of 10 times and a concentration of 1×10⁻⁶. 7 copies / μL - 1×101 plasmid standards of CHIKV, BFV, and RRV in copies / μL;

[0080] (2) Place the above plasmid standards into the qPCR reaction system, use the above primers and probes to perform PCR amplification, and collect the fluorescence signal;

[0081] (3) The qPCR reaction system is: 10µL Probe Master Mix (containing Mg) 2+ Add 0.3 µL each of CHIKV-F, CHIKV-R, BFV-F, BFV-R, RRV-F and RRV-R, 0.3 µL each of CHIKV-Probe, BFV-Probe and RRV-Probe, 0.3 µL each of CHIKV-Probe and BFV-Probe and RRV-Probe, 0.5 µL of cDNA template, and nuclease-free water to a total volume of 20 μL.

[0082] (4) qPCR reaction program: The fluorescence channels were set as follows: CY5 for CHIKV, VIC for BFV, and FAM for RRV; The temperature control program was set as follows: 95 ℃ pre-denaturation for 10 min; 40 cycles, including 95 ℃ denaturation for 10 s and 62 ℃ annealing for 30 s, and the fluorescence signal was collected by a real-time PCR instrument.

[0083] (5) Plasmid standards for CHIKV, BFV, and RRV were obtained from 1×10 7 copies / μL - 1×10 1 Fluorescence amplification curves at 7 concentration gradients (copies / μL) and standard curves for dilutions of CHIKV, BFV, and RRV standards.

[0084] like Figure 1 As shown, Figure 1 The plasmid standards for CHIKV, BFV, and RRV, with AC values ​​of 1×10⁻⁶, are respectively. 7 copies / μL - 1×10 1 Fluorescence amplification curves at 7 concentration gradients (copies / μL) Figure 1 The DF values ​​in the figures represent standard curves for dilutions of CHIKV, BFV, and RRV standards, respectively. This demonstrates that the plasmid standards used to test the detection method of this invention have been successfully established, thus illustrating the reliability of the data from the detection method of this invention.

[0085] 3. Best suited for exploring reaction systems

[0086] (1) Use a concentration of 1×10 4CHIKV, BFV, and RRV plasmid standards (copies / μL) were added to the qPCR reaction system. Different concentrations of primers were used in each system for PCR amplification, and fluorescence signals were collected.

[0087] (2) The optimal primer concentration for the qPCR reaction system is: 10 µL Probe Master Mix (containing Mg) 2+ Add 0.1 µL each of CHIKV-Probe, BFV-Probe, and RRV-Probe, 0.5 µL of cDNA template, and nuclease-free water to a total volume of 20 μL. Add 0.1 µL, 0.2 µL, 0.3 µL, 0.4 µL, 0.5 µL, 0.6 µL, 0.7 µL, and 0.8 µL of CHIKV-F, CHIKV-R, BFV-F, BFV-R, RRV-F, and RRV-R, respectively.

[0088] (3) The optimal probe concentration qPCR reaction system is: 10µL Probe Master Mix (containing Mg) 2+ Add 0.1 µL each of CHIKV-F, CHIKV-R, BFV-F, BFV-R, RRV-F, and RRV-R, 0.5 µL of cDNA template, and nuclease-free water to a total volume of 20 µL. Add 0.1 µL, 0.2 µL, 0.3 µL, 0.4 µL, 0.5 µL, 0.6 µL, 0.7 µL, and 0.8 µL of CHIKV-Probe, BFV-Probe, and RRV-Probe, respectively.

[0089] (4) qPCR reaction program: The fluorescence channels were set as follows: CY5 for CHIKV, VIC for BFV, and FAM for RRV; The temperature control program was set as follows: 95 ℃ pre-denaturation for 10 min; [95 ℃ denaturation for 10 s, 62 ℃ annealing for 30 s, 40 cycles, and fluorescence signals were collected using a real-time PCR instrument;

[0090] Table 1. Results of the optimal reaction system for the triple TaqMan qPCR detection method.

[0091]

[0092] As shown in Table 1, when different combinations of primer concentrations were used in the experiment, the fluorescence intensity of the multiplex qPCR reaction was the highest and the Cq value was the lowest when the amount of probe added was 0.3 μL and the amount of primer added was 0.3 μL.

[0093] 4. Sensitivity test

[0094] (1) Prepare a solution with a dilution factor of 10 times and a concentration of 1×10⁻⁶. 7 copies / μL - 1×10 1 plasmid standards of CHIKV, BFV, and RRV in copies / μL;

[0095] (2) Place the above plasmid standards into the optimal qPCR reaction system, use the above primers and probes to perform PCR amplification, and collect fluorescence signals;

[0096] (3) The qPCR reaction system is: 10µL Probe Master Mix (containing Mg 2+ Add 0.3 µL each of CHIKV-F, CHIKV-R, BFV-F, BFV-R, RRV-F and RRV-R, 0.3 µL each of CHIKV-Probe, BFV-Probe and RRV-Probe, 0.5 µL of cDNA template, and nuclease-free water to a total volume of 20 μL.

[0097] (4) qPCR reaction program: The fluorescence channel for CHIKV is CY5, the fluorescence channel for BFV is VIC, and the fluorescence channel for RRV is FAM; the temperature control program is set as follows: 95 ℃ pre-denaturation for 10 min; [95 ℃ denaturation for 10 s, 62 ℃ annealing for 30 s] for 40 cycles, and the fluorescence signal is collected by a real-time PCR instrument;

[0098] (5) Plasmid standards for CHIKV, BFV, and RRV were obtained from 1×10 7 copies / μL - 1×10 1 Fluorescence amplification curves at seven concentration gradients (copies / μL) were obtained for detecting 1×10⁻⁶ cells / μL. 1 For pathogens with a Cq value greater than 35 when using plasmids at a concentration of copies / μL, then use 2×10 1 copies / μL - 9×10 1 The fluorescence amplification curves were obtained by detecting eight concentration gradient standard plasmids at copies / μL, and the lowest plasmid concentration with a Cq value close to 35 was obtained.

[0099] (6) Using the lowest concentration plasmid standard from the previous step as a template, 23 repeated tests were performed to determine that the detection Cq value for this concentration was consistently less than 35, thereby determining the sensitivity of the detection method for the three pathogens.

[0100] Table 2 Results of the lowest concentration plasmid repeat assay for the triple TaqMan qPCR detection method

[0101]

[0102] Table 2 shows the Cq values ​​of 23 repeated tests using the detection method of the present invention on the estimated minimum concentration plasmid standards of three pathogens.

[0103] Table 3. Results of the repeatability test for the triple TaqMan qPCR detection method (II)

[0104]

[0105] Table 3 shows the statistical results of 23 repeated tests using the detection method of the present invention on plasmid standards of the estimated minimum concentration and low dilution factor concentrations of three pathogens, and the positive detection rate is compared with the 95% positive detection rate.

[0106] As shown in Tables 2 and 3, the detection sensitivity of the triple qPCR detection method of the present invention for CHIKV plasmid samples is 2 × 10⁻⁶. 1 copies / μL; capable of detecting BFV and RRV positive samples with a detection sensitivity of 1×10⁻⁶. 1 copies / μL.

[0107] 5. Simulation test for co-infection sample detection

[0108] (1) Prepare CHIKV, BFV and RRV plasmid standards with the same detection limit concentration. Place two or three different pathogen plasmid standards in the qPCR system at the same time, and perform PCR amplification using the above primers and probes, and collect fluorescence signals.

[0109] (3) The qPCR reaction system is: 10µL Probe Master Mix (containing Mg 2+ Add 0.3 µL each of CHIKV-F, CHIKV-R, BFV-F, BFV-R, RRV-F and RRV-R, 0.3 µL each of CHIKV-Probe, BFV-Probe and RRV-Probe, 0.5 µL of cDNA template, and nuclease-free water to a total volume of 20 μL.

[0110] (4) qPCR reaction program: The fluorescence channels were set as follows: CY5 for CHIKV, VIC for BFV, and FAM for RRV; The temperature control program was set as follows: 95 ℃ pre-denaturation for 10 min; [95 ℃ denaturation for 10 s, 62 ℃ annealing for 30 s] for 40 cycles, and the fluorescence signal was collected by a real-time PCR instrument.

[0111] Figure 2 The graph shows the results of a co-infection simulation experiment with any two of the three pathogens at the lower limit of detection concentration. Figure 2 A: BFV (1×10 1 copies / μL) and CHIKV (2×10) 1 Fluorescence amplification curves were detected in plasmid-simulated co-infected samples (copies / μL). Figure 2 B in: BFV (1×10 1 copies / μL) and RRV (1×10 1 Fluorescence amplification curves were detected in plasmid-simulated co-infected samples (copies / μL). Figure 2 C: RRV (1×10 1 copies / μL) and CHIKV (2×10) 1 Fluorescence amplification curves were detected in samples co-infected with plasmids (copies / μL).

[0112] Figure 3 This figure shows the results of a simulation experiment of co-infection with three pathogens at the lower limit of detection concentration. Among them, BFV (1×10⁻⁶) 1 copies / μL), RRV (1×10 1 copies / μL) and CHIKV (2×10) 1 Fluorescence amplification curves were detected in samples co-infected with plasmids (copies / μL).

[0113] Depend on Figure 2 and Figure 3 It can be seen that when the triple detection method of the present invention is used to detect multiple infections of plasmid standards at the lowest concentration, the detection results are all normal, indicating that the method of the present invention is suitable for the detection of co-infected samples.

[0114] 6. Specificity test

[0115] (1) Place the clinical samples positive for ONNV, SFV, SINV, and VEEV, as well as the samples positive for CHIKV, BFV, and RRV, into a triple qPCR system, and use the above primers and probes to perform PCR amplification and collect fluorescence signals.

[0116] (2) The qPCR reaction system was: 10 µL Probe Master Mix (containing Mg) 2+ Add 0.3 µL each of CHIKV-F, CHIKV-R, BFV-F, BFV-R, RRV-F and RRV-R, 0.3 µL each of CHIKV-Probe, BFV-Probe and RRV-Probe, 0.3 µL of cDNA template, and nuclease-free water to a total volume of 20 μL.

[0117] (3) qPCR reaction program: the fluorescence channel for CHIKV is CY5, the fluorescence channel for BFV is VIC, and the fluorescence channel for RRV is FAM; the temperature control program is set as follows: 95 ℃ pre-denaturation for 10 min; [95 ℃ denaturation for 10 s, 62 ℃ annealing for 30 s] for 40 cycles, and the fluorescence signal is collected by a real-time PCR instrument;

[0118] Figure 4 The fluorescence amplification curves for detecting positive clinical samples of ONNV, SFV, SINV, VEEV, CHIKV, BFV, and RRV using the triple qPCR detection method established in this invention are shown.

[0119] 7. Stability test

[0120] (1) Prepare a solution with a dilution factor of 10 times and a concentration of 1×10⁻⁶. 7 plasmid standards of CHIKV, BFV, and RRV at concentrations up to the lower limit of detection;

[0121] (2) Place the same concentration of plasmid standard into the triple qPCR reaction system, use the above primers and probes to perform PCR amplification, collect fluorescence signals, set up 3 identical systems as replicates each time, and perform three replicate experiments in total.

[0122] (3) The qPCR reaction system is: 10µL Probe Master Mix (containing Mg 2+ Add 0.1 µL each of CHIKV-F, CHIKV-R, BFV-F, BFV-R, RRV-F and RRV-R, 0.1 µL each of CHIKV-Probe, BFV-Probe and RRV-Probe, 0.5 µL of cDNA template, and nuclease-free water to a total volume of 20 μL.

[0123] (4) qPCR reaction program: The fluorescence channels were set as follows: CY5 for CHIKV, VIC for BFV, and FAM for RRV; The temperature control program was set as follows: 95 ℃ pre-denaturation for 10 min; [95 ℃ denaturation for 10 s, 62 ℃ annealing for 30 s] for 40 cycles, and the fluorescence signal was collected by a real-time PCR instrument.

[0124] (5) Calculate the value of 1×10 in three repeated experiments. 7 The stability of the detection method is determined by the coefficient of variation of the Cq values ​​amplified from CHIKV, BFV, and RRV plasmid standards at concentration gradients from copies / μL to the lower limit of detection.

[0125] Table 4. Repeatability Tests of the Triple TaqMan qPCR Detection Method

[0126]

[0127] As shown in the table above, the coefficient of variation (CV value) for each concentration gradient is less than 3%, indicating that the detection method of the present invention has high stability.

[0128] Example 2: Rapid and efficient clinical detection of three viruses: CHIKV, BFV, and RRV.

[0129] Step 1: Extract RNA from the sample and reverse transcribe it into cDNA;

[0130] Reverse transcription was performed using the HiScript® II 1st Strand cDNA Synthesis Kit. The total reaction volume was 20 µL, comprising: 1 µL Random hexamers, 1 µL Oligo (dT)23VN, 5 µL nuclease-free water, and 5 µL total RNA. After mixing, the mixture was heated at 65 °C for 5 min, then incubated on ice for 3 min. Next, 4 µL of 4×gDNA wiper Mix (4× genomic DNA removal premix) was added, and the mixture was heated at 42 °C for 2 min. Then, 2 µL of 10×RT Mix and 2 µL of HiScript® II Enzyme Mix (HiScript® II enzyme premix) were added. The reverse transcription reaction program was: 25 °C for 5 min, 50 °C for 45 min, and 85 °C for 2 min, yielding the cDNA template.

[0131] Step 2: Using the specific primer and probe composition designed in Example 1, and the cDNA obtained in Step 1 as a template, prepare a qPCR reaction system, perform PCR amplification, and collect fluorescence signals in the FAM, VIC and CY5 channels respectively.

[0132] The PCR amplification reaction program was set as follows: the fluorescence channels were set as follows: CY5 for CHIKV, VIC for BFV, and FAM for RRV; the reaction program was as follows: 95 °C pre-denaturation for 10 min; 40 cycles, each cycle including: 95 °C denaturation for 10 s, 62 °C annealing for 30 s, while fluorescence signals were collected using a real-time PCR instrument.

[0133] The qPCR reaction system, in 20 µL increments, contains: 10 µL Probe Master Mix (containing Mg2+). 2+ The mixture of ions, dNTPs, hot-start Taq DNA polymerase, and PCR buffer contains 0.3 µL each of the three pairs of forward and reverse primers, 0.3 µL each of the three probes, and 0.5 µL of cDNA template. The total volume is brought up to 20 µL with nuclease-free water.

[0134] Step 3: Determine whether the sample contains CHIKV (CY5), BFV (VIC), or RRV (FAM) nucleic acids based on the fluorescence signal and Cq value measured by the machine. The result determination criteria are as follows: if the Cq value of a certain channel is ≤35, it is determined to be positive for the viral nucleic acid; if the Cq value is ≥38, it is determined to be negative; if 35 < Cq value < 38, it is determined to be suspicious and needs to be retested.

[0135] Clinical samples positive for ONNV, SFV, SINV, and VEEV, as well as samples positive for CHIKV, BFV, and RRV, were placed in a triple qPCR system. Using the aforementioned primers and probes, PCR amplification was performed, and fluorescence signals were collected. Figure 4 It can be seen that the average Cq values ​​of CHIKV, BFV, and RRV are 27.23, 15.05, and 10.62, respectively, while other alphaviruses cannot be detected, indicating that the detection method of the present invention has good specificity.

Claims

1. A specific primer-probe composition for detecting CHIKV, BFV, and RRV, characterized in that, This specific primer-probe composition contains primer pairs and probes for detecting CHIKV, primer pairs and probes for detecting BFV, and primer pairs and probes for detecting RRV. Primer pairs and probes used for detecting CHIKV: Forward primer CHIKV-F: as shown in SEQ ID NO: 1; Reverse primer CHIKV-R: as shown in SEQ ID NO: 2; The CHIKV-Probe is as shown in SEQ ID NO: 3, with a CY5 fluorescent group labeled at the 5' end and a BHQ3 quencher group labeled at the 3' end. Primer pairs and probes used for detecting BFV: Forward primer BFV-F: as shown in SEQ ID NO: 4; Reverse primer BFV-R: as shown in SEQ ID NO: 5; The BFV-Probe is as shown in SEQ ID NO: 6, with a VIC fluorescent group labeled at the 5' end and a BHQ1 quencher group labeled at the 3' end. Primer pairs and probes used for detecting RRV: Forward primer RRV-F: as shown in SEQ ID NO: 7; Reverse primer RRV-R: as shown in SEQ ID NO: 8; The probe RRV-Probe, as shown in SEQ ID NO: 9, has a FAM fluorescent group labeled at the 5' end and an MGB quencher group labeled at the 3' end.

2. The use of the specific primer-probe composition of claim 1 in the preparation of a triple TaqMan probe-based quantitative PCR reaction solution for detecting CHIKV, BFV, and RRV.

3. The use of the specific primer and probe composition according to claim 1 in the preparation of a triple TaqMan probe real-time PCR detection kit for detecting CHIKV, BFV, and RRV.

4. A triple TaqMan probe-based real-time PCR reaction solution for detecting CHIKV, BFV, and RRV, characterized in that, The reaction solution contains the specific primer and probe composition as described in claim 1, and Mg. 2+ Ions, dNTPs mixture, hot-start Taq DNA polymerase, and PCR buffer.

5. A triple TaqMan probe-based real-time PCR detection kit for detecting CHIKV, BFV, and RRV, characterized in that, The kit contains the reaction solution and control as described in claim 4; the control includes a positive control and a negative control, wherein the positive control is a standard template containing the NSP gene of CHIKV and RRV and the CAP gene of BFV, and the negative control is nuclease-free water.

6. The reagent kit according to claim 5, characterized in that, The NSP gene carrying CHIKV and RRV, The standard template for the BFV CAP gene is a recombinant plasmid containing the NSP gene of CHIKV and RRV and the CAP gene of BFV.

7. A method for simultaneously detecting CHIKV, BFV, and RRV nucleic acids in an isolated sample for non-diagnostic purposes, characterized in that, The method includes the following steps: Step 1: Extract RNA from the sample and reverse transcribe it into cDNA; Step 2: Using the specific primer and probe composition described in claim 1, a qPCR reaction system is prepared with the cDNA obtained in step 1 as a template, and PCR amplification is performed. Fluorescence signals are collected in the FAM, VIC and CY5 channels, respectively. Step 3: Determine whether the sample contains CHIKV, BFV, or RRV nucleic acids based on the fluorescence signal and Cq value measured by the machine.

8. The method according to claim 7, characterized in that, In step 2, the PCR amplification reaction program is set as follows: the fluorescence channels are set as follows: CY5 for CHIKV, VIC for BFV, and FAM for RRV; the reaction program is: 95 °C pre-denaturation for 10 min. Forty cycles were performed, each cycle consisting of denaturation at 95 °C for 10 s and annealing at 62 °C for 30 s, while fluorescence signals were collected using a real-time PCR instrument.

9. The method according to claim 7, characterized in that, In step 2, the qPCR reaction system, in 20 µL, comprises: 10 µL of probe premix, 0.3 µL each of the three pairs of forward and reverse primers in the specific primer and probe composition of claim 1, 0.3 µL each of the three probes, 0.5 µL of cDNA template, and nuclease-free water to bring the total volume to 20 µL.

10. The method according to claim 7, characterized in that, In step 3, the criteria for determining whether there is CHIKV, BFV, or RRV nucleic acid in the sample based on the fluorescence signal and Cq value calculated by the machine are as follows: if the Cq value of a certain channel is ≤35, it is determined to be positive for CHIKV, BFV, or RRV nucleic acid; if the Cq value is ≥38, it is determined to be negative; if 35 < Cq value < 38, it is determined to be suspicious and needs to be retested.

Citation Information

Patent Citations

  • Capture of target DNA and RNA by probes comprising intercalator molecules

    CN103517991A

  • Real-time fluorescence RT-PCR kit and method for detecting BFV (Barmah forest virus)

    CN104357583A

  • RT-PCR detection method, primer and probe as well as kit of Zika virus, dengue virus and chikungunya virus

    CN106755573A

  • Methods and systems for diagnosis and treatment of viral infections

    CN109071610A

  • Primers and probes for detection of mosquito-borne virus, and method for detecting mosquito-borne virus using the same

    KR102332008B1