A triple fluorescent quantitative PCR detection kit for simultaneously detecting CHIKV, BFV and RRV

Abstract

The application discloses a triple fluorescent quantitative PCR detection kit for simultaneously detecting CHIKV, BFV and RRV, which contains a specific primer probe composition for simultaneously detecting chikungunya virus, Barmah Forest virus and Ross River virus, can simultaneously detect three viruses which are transmitted by insect vectors and cause acute fever with arthralgia symptoms in human beings in one PCR reaction tube, and has excellent specificity and repeatability, and is suitable for routine laboratory diagnosis of suspected samples of alphavirus infection, and provides a rapid and accurate detection method for the epidemiological study of CHIKV, BFV and RRV.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of biotechnology, and particularly relates to a triple qPCR detection kit for simultaneously detecting Chikungunya virus (CHIKV), Barmah Forest virus (BFV) and Ross River virus (RRV) and application thereof. BACKGROUND

[0002] The mosquito-borne viral diseases caused by Chikungunya virus (CHIKV), Barmah Forest virus (BFV) and Ross River virus (RRV) are important challenges to public health safety in China. At present, the acute febrile arthralgia disease caused by CHIKV infection is most common in the clinic, especially the CHIKV strain carrying E1 protein gene mutation (such as A226V) has been widely prevalent in many places around the world since the 21st century, and is often accompanied by mixed infection of various alphaviruses, such as BFV or RRV. These alphaviruses have strong infectivity (mainly transmitted by mosquitoes such as Aedes and Culex) and high pathogenicity, and can cause acute fever, joint swelling and pain, rash and other symptoms in humans, and the joint pain of some patients can last for several months to several years, which is very harmful. In addition, BFV and RRV can maintain ecological circulation through wild animals such as kangaroos and marsupials, and related antibodies can also be detected in livestock such as cattle, sheep and horses, but the clinical symptoms are not obvious. These animals are more as potential reservoir hosts rather than the main pathogenic objects.

[0003] However, it is difficult to effectively distinguish different viral infections by clinical symptoms alone, for example, both CHIKV and RRV infections can cause joint pain, and the early symptoms of CHIKV and BFV infections on animals also overlap, and the complexity of the causes has brought great challenges to related detection, diagnosis and prevention and control work. Therefore, for the several common alphaviruses in the clinic, it is an urgent problem to be solved in the prevention and control of human infectious diseases to establish a simple, rapid, efficient and economical detection method.

[0004] The multiplex qPCR detection technology can simultaneously detect multiple pathogens in one reaction, can quickly identify and distinguish the samples with complex and variable symptoms of acute fever with arthralgia caused by insect vector transmission, has better sensitivity than ordinary PCR, can directly analyze the results without electrophoresis and sequencing analysis, greatly shortens the material cost and time cost of the detection personnel in the detection process, and is especially suitable for large-scale sample detection or identification diagnosis of mixed infection samples. Since multiple pairs of primers and probes exist in one reaction system of the multiplex qPCR, in order to ensure effective performance, the primers and the probes need to be highly specific to avoid the generation of non-specific amplification products. In addition, the complex nucleic acid environment in the clinical sample and the difference in annealing temperature of different primer pairs are also the main factors restricting the establishment of the multiplex qPCR detection method. Although the multiplex TaqMan probe qPCR detection method faces many difficulties, it has high clinical application value for rapid clinical detection and clear infection pathogens of the above-mentioned mosquito-borne viruses. SUMMARY

[0005] In view of the technical problem in the prior art that there is no triple detection method for identifying and detecting CHIKV, BFV and RRV causing acute fever with arthralgia symptoms in humans transmitted by insect vectors, the application provides a triple fluorescence quantitative PCR detection kit for simultaneously detecting CHIKV, BFV and RRV.

[0006] The object of the application can be achieved by the following technical solutions.

[0007] In a first aspect, the application claims a specific primer probe composition for detecting CHIKV, BFV and RRV, which comprises a primer pair and a probe for detecting CHIKV, a primer pair and a probe for detecting BFV, and a primer pair and a probe for detecting RRV.

[0008] The primer pair and the probe for detecting CHIKV are as follows:

[0009] The forward primer CHIKV-F is as shown in SEQ ID NO: 1;

[0010] The reverse primer CHIKV-R is as shown in SEQ ID NO: 2;

[0011] The probe CHIKV-Probe is as shown in SEQ ID NO: 3, the 5' end is labeled with a CY5 fluorescent group, and the 3' end is labeled with a BHQ3 quenching group.

[0012] The primer pair and the probe for detecting BFV are as follows:

[0013] Forward primer BFV-F: as shown in SEQ ID NO: 4;

[0014] Reverse primer BFV-R: as shown in SEQ ID NO: 5;

[0015] Probe BFV-Probe: as shown in SEQ ID NO: 6, 5' end labeled with VIC fluorescent group, 3' end labeled with BHQ1 quenching group;

[0016] Primer pair and probe for detecting RRV:

[0017] Forward primer RRV-F: as shown in SEQ ID NO: 7;

[0018] Reverse primer RRV-R: as shown in SEQ ID NO: 8;

[0019] Probe RRV-Probe: as shown in SEQ ID NO: 9, 5' end labeled with FAM fluorescent group, 3' end labeled with MGB quenching group.

[0020] In a second aspect, the application claims the use of the specific primer probe composition described above in the preparation of a triple TaqMan probe fluorescent quantitative PCR detection reaction solution for detecting CHIKV, BFV and RRV.

[0021] In a third aspect, the application claims the use of the specific primer probe composition described above in the preparation of a triple TaqMan probe fluorescent quantitative PCR detection kit for detecting CHIKV, BFV and RRV.

[0022] In a fourth aspect, the application claims a triple TaqMan probe fluorescent quantitative PCR detection reaction solution for detecting CHIKV, BFV and RRV, which comprises the specific primer probe composition described above, Mg 2+ ions, dNTPs mixture, hot-start Taq DNA polymerase and PCR buffer.

[0023] In a fifth aspect, the application claims a triple TaqMan probe fluorescent quantitative PCR detection kit for detecting CHIKV, BFV and RRV, which comprises the reaction solution described above and a control; the control comprises a positive control and a negative control; the positive control is a standard template with CHIKV and RRV NSP genes and BFV CAP gene, and the negative control is RNase-free water.

[0024] Further, the standard template of the NSP gene of CHIKV and RRV, the CAP gene of BFV is a recombinant plasmid containing the NSP gene of CHIKV and RRV, the CAP gene of BFV. In the specific embodiment of the present application, the construction method of the recombinant plasmid is: respectively cloning the NSP gene fragment of CHIKV, the CAP gene fragment of BFV and the NSP gene fragment of RRV into the pMD18-T vector.

[0025] The kit should be stored at -20°C, and the number of repeated freeze-thawing should be minimized.

[0026] In a sixth aspect, the present application claims to protect a method for simultaneously detecting the nucleic acids of CHIKV, BFV and RRV in an ex vivo sample for non-diagnostic purposes, which comprises the following steps:

[0027] Step 1, extracting the RNA of the sample and reverse transcribing it into cDNA;

[0028] Step 2, using the specific primer probe composition described above, using the cDNA obtained in step 1 as a template to prepare a qPCR reaction system, performing PCR amplification, and collecting fluorescence signals in the FAM, VIC and CY5 channels, respectively;

[0029] Step 3, determining whether there is CHIKV (CY5), BFV (VIC), RRV (FAM) nucleic acid in the sample according to the fluorescence signals and Cq values calculated by the machine.

[0030] Further, in step 2, the reaction program of the PCR amplification is set as follows: the fluorescence channel is set as follows: the fluorescence channel for CHIKV is CY5, the fluorescence channel for BFV is VIC, and the fluorescence channel for RRV is FAM; the reaction program is: 95°C pre-denaturation for 10 min; 40 cycles, each cycle including: 95°C denaturation for 10 s, 62°C annealing for 30 s, and simultaneously collecting fluorescence signals with a fluorescence quantitative PCR instrument.

[0031] Further, in step 2, the qPCR reaction system is 20 μL, which contains: 10 μL Probe MasterMix (probe method premix) (containing Mg 2+ ions, dNTPs mixture, hot-start Taq DNA polymerase and PCR buffer), 0.3 μL of each of the three pairs of forward primers and reverse primers in the specific primer probe composition described above, 0.3 μL of each of the three probes, 0.5 μL of the cDNA template, and the balance to 20 μL with an RNase-free water.

[0032] Further, in step 3, the determination criteria for determining whether the sample contains CHIKV, BFV, and RRV nucleic acid according to the machine-calculated fluorescence signal and Cq value are as follows: if the Cq value of a channel is less than or equal to 35, it is determined that the sample contains CHIKV, BFV, and RRV nucleic acid; if the Cq value is greater than or equal to 38, it is determined that the sample does not contain CHIKV, BFV, and RRV nucleic acid; and if the Cq value is between 35 and 38, it is determined that the sample is suspicious and needs to be retested.

[0033] In the specific embodiment of the present application, in step 1, the reverse transcription is performed using a HiScript II 1st Strand cDNA Synthesis Kit, and the total reaction system is 20 μL, which includes 1 μL Random hexamers, 1 μL Oligo (dT)23VN, 5 μL nuclease-free Water, and 5 μL total RNA. After mixing, the mixture is heated at 65 ℃ for 5 min and then subjected to ice bath for 3 min. Then, 4 μL 4×gDNA wiper Mix is added, and the mixture is mixed and then heated at 42 ℃ for 2 min. Then, 2 μL 10×RT Mix and 2 μL HiScript II Enzyme Mix are added.

[0034] The reaction procedure of the reverse transcription is as follows: heating at 25 ℃ for 5 min, heating at 50 ℃ for 45 min, and heating at 85 ℃ for 2 min. After the reaction, a cDNA template is obtained.

[0035] As a further illustration of the present application, a positive control and a negative control should be set up for each detection. The positive control uses the constructed standard quality plasmid as a template, and the negative control uses nuclease-free water as a template. The water used is nuclease-free water, and sterilized double-distilled water can also be used.

[0036] As a further illustration of the present application, the concentration of the primers used in the qPCR reaction system is 30 μM, and the concentration of the probe is 30 μM.

[0037] As a further illustration of the present application, the CHIKV, BFV, and RRV triplex fluorescence quantitative PCR detection kit should set 3-4 parallel holes for each detection sample. For samples with doubts, at least three repeated experiments should be performed.

[0038] The kit of this invention includes specific primers and fluorescent probes for the NSP gene of CHIKV and RRV, and the CAP gene of BFV. Experimental verification shows that it does not cross-react with alphaviruses and other important pathogens, including ONNV (O'nyong-nyong virus), SFV (Semliki Forest Virus), SINV (Sindbis virus), and VEEV (Venezuelan Equine Encephalomyelitis Virus).

[0039] Compared with the prior art, the triple qPCR detection kit of the present invention has the following technical advantages:

[0040] 1. The ability to simultaneously identify and detect CHIKV, BFV, and RRV in a single PCR reaction tube provides a simple, efficient, and low-cost method for detecting these three pathogens;

[0041] 2. The triple TaqMan probe qPCR detection kit of this invention showed consistent detection results with single qPCR detection in detecting positive samples of various target viruses, further proving the feasibility of the method of this invention. Furthermore, verification showed that this invention can detect plasmid samples with a minimum concentration of 20 copies / μL for CHIKV and positive samples with a minimum concentration of 10 copies / μL for BFV and RRV. It has copies / μL and excellent specificity and repeatability.

[0042] 3. The detection kit in this invention provides reliable technical support for the prevention and control of this type of disease, and greatly reduces the workload of single detection methods, thus significantly improving work efficiency.

[0043] 4. The detection kit in this invention has excellent repeatability and sensitivity, and can perform rapid and efficient clinical detection of three viruses that are transmitted by insect vectors and cause acute fever and joint pain symptoms in humans, thereby simultaneously diagnosing and monitoring these three pathogens. Attached Figure Description

[0044] Figure 1 This document describes the preparation of standards and standard curves for the triplet TaqMan qPCR detection method in Example 1. Specifically, plasmid standards A and C for CHIKV, BFV, and RRV were prepared using 1×10⁻⁶ plasmids. 7 copies / μL - 1×10 1 Fluorescence amplification curves at 7 concentration gradients (copies / μL); DF represents the standard curves for CHIKV, BFV, and RRV, respectively.

[0045] Figure 2 This is a graph showing the results of a co-infection simulation experiment involving any two of the three pathogens at the lower limit of detection concentration. Where A: BFV (1×10⁻⁶) 1 copies / μL) and CHIKV (2×10) 1 Fluorescence amplification curves for plasmid-simulated co-infected samples (copies / μL); B: BFV (1×10⁻⁶ copies / μL); 1 copies / μL) and RRV (1×10 1 Fluorescence amplification curves of plasmid-simulated co-infected samples (copies / μL); C: RRV (1×10⁻⁶ copies / μL); 1 copies / μL) and CHIKV (2×10) 1 Fluorescence amplification curves were detected in samples co-infected with plasmids (copies / μL).

[0046] Figure 3 The figure shows the results of a simulation experiment of co-infection with three pathogens at the lower limit of detection concentration. Among them, BFV (1×10⁻⁶) 1 copies / μL), RRV (1×10 1 copies / μL) and CHIKV (2×10) 1 (copies / μL).

[0047] Figure 4 The fluorescence amplification curves for detecting positive clinical samples of ONNV, SFV, SINV, VEEV, GETV, and CHIKV plasmids, as well as BFV and RRV, using the triple qPCR detection method established in this invention are shown. Detailed Implementation

[0048] The following embodiments further illustrate the content of the present invention, but should not be construed as limiting the present invention. Any modifications or substitutions made to the methods, steps, or conditions of the present invention without departing from the spirit and essence of the invention are within the scope of the present invention. Experimental methods and reagents not specifically described in the embodiments are performed according to conventional conditions in the art.

[0049] Example 1

[0050] In this embodiment, a CHIKV, BFV, and RRV real-time PCR detection kit with excellent specificity, sensitivity, and stability is provided, and the steps are as follows:

[0051] 1. Construction and validation of the detection method

[0052] (1) Synthesize qPCR primer pairs and TaqMan probes for detecting CHIKV, BFV, and RRV. The specific sequences of the primers and probes are as follows:

[0053] Primer pair sequences and TaqMan probe sequences used for detecting Chikungunya virus (CHIKV):

[0054] CHIKV-F: 5'-TCCAGGCGGTGTACACTGCC-3' (SEQ ID NO: 1)

[0055] CHIKV-R: 5'-TAGTCAATTTGCAGTTGTTTAACCC-3' (SEQ ID NO: 2)

[0056] chikv-tz2: 5'-CY5- CATTACGAAGGCAAAATGCGCAC-BHQ3-3' (SEQ ID NO: 3).

[0057] Primer pair sequences and TaqMan probe sequences used for detecting Barmah Forest virus (BFV):

[0058] BFV-F: 5'-CCAGAACTAGCCAAATTGACA-3' (SEQ ID NO: 4)

[0059] BFV-R: 5'-GGTGCCAGTTGTARTGTCCT-3' (SEQ ID NO: 5)

[0060] BFV-Probe: 5'-VIC-TGAAATCAGACGCATCCAAGTTCACC-BHQ1-3' (SEQ ID NO: 6).

[0061] Primer pair sequences and TaqMan probe sequences used for detecting Ross River virus (RRV):

[0062] RRV-F: 5'-TTGTTCGATATGTCGGCAGAAG-3' (SEQ ID NO: 7)

[0063] RRV-R: 5'-AAATTCCGGACTTCATCATGG-3' (SEQ ID NO: 8)

[0064] RRV-NSP4-Probe: 5'-FAM-CTGCCAACAGGTACGCGGTTCAAG-MGB-3' (SEQ ID NO: 9).

[0065] (2) Constructing standard template plasmids

[0066] The plasmid standards for CHIKV, BFV, and RRV are standard template plasmids containing the NSP gene of CHIKV and RRV, and the CAP gene of BFV. The NSP gene fragments of CHIKV and RRV, and the CAP gene fragment of BFV are amplified separately, ligated into the pMD18-T vector, and recombinant plasmids are constructed to serve as standard templates. The detailed construction process of the recombinant plasmids is as follows:

[0067] a. Obtaining the target gene amplification template from the sample to be tested: BFV and RRV virus samples preserved in the laboratory were inoculated into BHK-21 cells. After the cells showed obvious cytopathic effects, cellular RNA was extracted and reverse transcribed into a cDNA template. The target gene amplification template for the CHIKV sample was synthesized by the company. The synthetic sequence of the target gene amplification template for the CHIKV sample is as follows:

[0068] TTGAATGGATGTAACAGACCAGTCGACGTGTTGTACGTAGACGAGGCGTTTGCGTGCCACTCTGGAACGTTACTTGCATTGATCGCCTTGGTGAGACCAAGACAGAAAGTTGTACTTTGTGGTGACCCGAAGCAGTGCGGCTTCTTCAATATGATGCAGATGAAAGTCAACTATAATCACAACATCTGCACCCAAGTGTACCACAAAAGTATCTCCAGGCGGTGTACACTGCCTGTGACTGCCATTG TGTCATCGTTGCATTACGAAGGCAAAATGCGCACTACGAATGAGTACAACAAGCCGATTGTAGTGGACACTACAGGCTCAACAAAACCTGACCCTGGAGATCTCGTGTTAACGTGCTTCAGAGGATGGGTTAAACAACTGCAAATTGACTATCGTGGACACGAGGTCATGACAGCAGCCGCATCCCAAGGGTTAACCAGAAAAGGAGTTTACGCAGTTAGGCAAAAAGTTAACGAAAACCCGCT (SEQ ID NO: 10).

[0069] The reverse transcription was performed using the HiScript® II 1st Strand cDNA Synthesis Kit. The total reaction volume was 20 µL, comprising: 1 µL Random hexamers, 1 µL Oligo (dT)23VN, 5 µL nuclease-free water, and 5 µL total RNA. After mixing, the mixture was heated at 65 °C for 5 min, then incubated on ice for 3 min. Next, 4 µL of 4×gDNA wiper Mix was added, and the mixture was heated at 42 °C for 2 min. Then, 2 µL of 10×RT Mix and 2 µL of HiScript® II Enzyme Mix were added. The reverse transcription reaction program was: heating at 25 °C for 5 min, at 50 °C for 45 min, and at 85 °C for 2 min, yielding a cDNA template.

[0070] b. Preparation of positive standards: The three target genes were amplified and ligated into the pMD18-T vector to construct recombinant plasmids for use as standard templates.

[0071] The specific sequences of the primer pairs for amplifying the target gene are as follows:

[0072] CHIKV-F: 5'-TCCAGGCGGTGTACACTGCC-3' (SEQ ID NO: 1)

[0073] CHIKV-R: 5'-TAGTCAATTTGCAGTTGTTTAACCC-3' (SEQ ID NO: 2)

[0074] BFV-F: 5'-CCAGAACTAGCCAAATTGACA-3' (SEQ ID NO: 4)

[0075] BFV-R: 5'-GGTGCCAGTTGTARTGTCCT-3' (SEQ ID NO: 5)

[0076] RRV-F: 5'-TTGTTCGATATGTCGGCAGAAG-3' (SEQ ID NO: 7)

[0077] RRV-R: 5'-AAATTCCGGACTTCATCATGG-3' (SEQ ID NO: 8)

[0078] 2. Establishment of the standard curve

[0079] (1) Prepare a solution with a dilution factor of 10 times and a concentration of 1×10⁻⁶. 7 copies / μL - 1×101 plasmid standards of CHIKV, BFV, and RRV in copies / μL;

[0080] (2) Place the above plasmid standards into the qPCR reaction system, use the above primers and probes to perform PCR amplification, and collect the fluorescence signal;

[0081] (3) The qPCR reaction system is: 10µL Probe Master Mix (containing Mg) 2+ Add 0.3 µL each of CHIKV-F, CHIKV-R, BFV-F, BFV-R, RRV-F and RRV-R, 0.3 µL each of CHIKV-Probe, BFV-Probe and RRV-Probe, 0.3 µL each of CHIKV-Probe and BFV-Probe and RRV-Probe, 0.5 µL of cDNA template, and nuclease-free water to a total volume of 20 μL.

[0082] (4) qPCR reaction program: The fluorescence channels were set as follows: CY5 for CHIKV, VIC for BFV, and FAM for RRV; The temperature control program was set as follows: 95 ℃ pre-denaturation for 10 min; 40 cycles, including 95 ℃ denaturation for 10 s and 62 ℃ annealing for 30 s, and the fluorescence signal was collected by a real-time PCR instrument.

[0083] (5) Plasmid standards for CHIKV, BFV, and RRV were obtained from 1×10 7 copies / μL - 1×10 1 Fluorescence amplification curves at 7 concentration gradients (copies / μL) and standard curves for dilutions of CHIKV, BFV, and RRV standards.

[0084] like Figure 1 As shown, Figure 1 The plasmid standards for CHIKV, BFV, and RRV, with AC values ​​of 1×10⁻⁶, are respectively. 7 copies / μL - 1×10 1 Fluorescence amplification curves at 7 concentration gradients (copies / μL) Figure 1 The DF values ​​in the figures represent standard curves for dilutions of CHIKV, BFV, and RRV standards, respectively. This demonstrates that the plasmid standards used to test the detection method of this invention have been successfully established, thus illustrating the reliability of the data from the detection method of this invention.

[0085] 3. Best suited for exploring reaction systems

[0086] (1) Use a concentration of 1×10 4CHIKV, BFV, and RRV plasmid standards (copies / μL) were added to the qPCR reaction system. Different concentrations of primers were used in each system for PCR amplification, and fluorescence signals were collected.

[0087] (2) The optimal primer concentration for the qPCR reaction system is: 10 µL Probe Master Mix (containing Mg) 2+ Add 0.1 µL each of CHIKV-Probe, BFV-Probe, and RRV-Probe, 0.5 µL of cDNA template, and nuclease-free water to a total volume of 20 μL. Add 0.1 µL, 0.2 µL, 0.3 µL, 0.4 µL, 0.5 µL, 0.6 µL, 0.7 µL, and 0.8 µL of CHIKV-F, CHIKV-R, BFV-F, BFV-R, RRV-F, and RRV-R, respectively.

[0088] (3) The optimal probe concentration qPCR reaction system is: 10µL Probe Master Mix (containing Mg) 2+ Add 0.1 µL each of CHIKV-F, CHIKV-R, BFV-F, BFV-R, RRV-F, and RRV-R, 0.5 µL of cDNA template, and nuclease-free water to a total volume of 20 µL. Add 0.1 µL, 0.2 µL, 0.3 µL, 0.4 µL, 0.5 µL, 0.6 µL, 0.7 µL, and 0.8 µL of CHIKV-Probe, BFV-Probe, and RRV-Probe, respectively.

[0089] (4) qPCR reaction program: The fluorescence channels were set as follows: CY5 for CHIKV, VIC for BFV, and FAM for RRV; The temperature control program was set as follows: 95 ℃ pre-denaturation for 10 min; [95 ℃ denaturation for 10 s, 62 ℃ annealing for 30 s, 40 cycles, and fluorescence signals were collected using a real-time PCR instrument;

[0090] Table 1. Results of the optimal reaction system for the triple TaqMan qPCR detection method.

[0091]

[0092] As shown in Table 1, when different combinations of primer concentrations were used in the experiment, the fluorescence intensity of the multiplex qPCR reaction was the highest and the Cq value was the lowest when the amount of probe added was 0.3 μL and the amount of primer added was 0.3 μL.

[0093] 4. Sensitivity test

[0094] (1) Prepare a solution with a dilution factor of 10 times and a concentration of 1×10⁻⁶. 7 copies / μL - 1×10 1 plasmid standards of CHIKV, BFV, and RRV in copies / μL;

[0095] (2) Place the above plasmid standards into the optimal qPCR reaction system, use the above primers and probes to perform PCR amplification, and collect fluorescence signals;

[0096] (3) The qPCR reaction system is: 10µL Probe Master Mix (containing Mg 2+ Add 0.3 µL each of CHIKV-F, CHIKV-R, BFV-F, BFV-R, RRV-F and RRV-R, 0.3 µL each of CHIKV-Probe, BFV-Probe and RRV-Probe, 0.5 µL of cDNA template, and nuclease-free water to a total volume of 20 μL.

[0097] (4) qPCR reaction program: The fluorescence channel for CHIKV is CY5, the fluorescence channel for BFV is VIC, and the fluorescence channel for RRV is FAM; the temperature control program is set as follows: 95 ℃ pre-denaturation for 10 min; [95 ℃ denaturation for 10 s, 62 ℃ annealing for 30 s] for 40 cycles, and the fluorescence signal is collected by a real-time PCR instrument;

[0098] (5) Plasmid standards for CHIKV, BFV, and RRV were obtained from 1×10 7 copies / μL - 1×10 1 Fluorescence amplification curves at seven concentration gradients (copies / μL) were obtained for detecting 1×10⁻⁶ cells / μL. 1 For pathogens with a Cq value greater than 35 when using plasmids at a concentration of copies / μL, then use 2×10 1 copies / μL - 9×10 1 The fluorescence amplification curves were obtained by detecting eight concentration gradient standard plasmids at copies / μL, and the lowest plasmid concentration with a Cq value close to 35 was obtained.

[0099] (6) Using the lowest concentration plasmid standard from the previous step as a template, 23 repeated tests were performed to determine that the detection Cq value for this concentration was consistently less than 35, thereby determining the sensitivity of the detection method for the three pathogens.

[0100] Table 2 Results of the lowest concentration plasmid repeat assay for the triple TaqMan qPCR detection method

[0101]

[0102] Table 2 shows the Cq values ​​of 23 repeated tests using the detection method of the present invention on the estimated minimum concentration plasmid standards of three pathogens.

[0103] Table 3. Results of the repeatability test for the triple TaqMan qPCR detection method (II)

[0104]

[0105] Table 3 shows the statistical results of 23 repeated tests using the detection method of the present invention on plasmid standards of the estimated minimum concentration and low dilution factor concentrations of three pathogens, and the positive detection rate is compared with the 95% positive detection rate.

[0106] As shown in Tables 2 and 3, the detection sensitivity of the triple qPCR detection method of the present invention for CHIKV plasmid samples is 2 × 10⁻⁶. 1 copies / μL; capable of detecting BFV and RRV positive samples with a detection sensitivity of 1×10⁻⁶. 1 copies / μL.

[0107] 5. Simulation test for co-infection sample detection

[0108] (1) Prepare CHIKV, BFV and RRV plasmid standards with the same detection limit concentration. Place two or three different pathogen plasmid standards in the qPCR system at the same time, and perform PCR amplification using the above primers and probes, and collect fluorescence signals.

[0109] (3) The qPCR reaction system is: 10µL Probe Master Mix (containing Mg 2+ Add 0.3 µL each of CHIKV-F, CHIKV-R, BFV-F, BFV-R, RRV-F and RRV-R, 0.3 µL each of CHIKV-Probe, BFV-Probe and RRV-Probe, 0.5 µL of cDNA template, and nuclease-free water to a total volume of 20 μL.

[0110] (4) qPCR reaction program: The fluorescence channels were set as follows: CY5 for CHIKV, VIC for BFV, and FAM for RRV; The temperature control program was set as follows: 95 ℃ pre-denaturation for 10 min; [95 ℃ denaturation for 10 s, 62 ℃ annealing for 30 s] for 40 cycles, and the fluorescence signal was collected by a real-time PCR instrument.

[0111] Figure 2 The graph shows the results of a co-infection simulation experiment with any two of the three pathogens at the lower limit of detection concentration. Figure 2 A: BFV (1×10 1 copies / μL) and CHIKV (2×10) 1 Fluorescence amplification curves were detected in plasmid-simulated co-infected samples (copies / μL). Figure 2 B in B: BFV (1×10 1 copies / μL) and RRV (1×10 1 Fluorescence amplification curves were detected in plasmid-simulated co-infected samples (copies / μL). Figure 2 C: RRV (1×10 1 copies / μL) and CHIKV (2×10) 1 Fluorescence amplification curves were detected in samples co-infected with plasmids (copies / μL).

[0112] Figure 3 This figure shows the results of a simulation experiment of co-infection with three pathogens at the lower limit of detection concentration. Among them, BFV (1×10⁻⁶) 1 copies / μL), RRV (1×10 1 copies / μL) and CHIKV (2×10) 1 Fluorescence amplification curves were detected in samples co-infected with plasmids (copies / μL).

[0113] Depend on Figure 2 and Figure 3 It can be seen that when the triple detection method of the present invention is used to detect multiple infections of plasmid standards at the lowest concentration, the detection results are all normal, indicating that the method of the present invention is suitable for the detection of co-infected samples.

[0114] 6. Specificity test

[0115] (1) Place the clinical samples positive for ONNV, SFV, SINV, and VEEV, as well as the samples positive for CHIKV, BFV, and RRV, into a triple qPCR system, and use the above primers and probes to perform PCR amplification and collect fluorescence signals.

[0116] (2) The qPCR reaction system was: 10 µL Probe Master Mix (containing Mg) 2+ Add 0.3 µL each of CHIKV-F, CHIKV-R, BFV-F, BFV-R, RRV-F and RRV-R, 0.3 µL each of CHIKV-Probe, BFV-Probe and RRV-Probe, 0.3 µL of cDNA template, and nuclease-free water to a total volume of 20 μL.

[0117] (3) qPCR reaction program: the fluorescence channel for CHIKV is CY5, the fluorescence channel for BFV is VIC, and the fluorescence channel for RRV is FAM; the temperature control program is set as follows: 95 ℃ pre-denaturation for 10 min; [95 ℃ denaturation for 10 s, 62 ℃ annealing for 30 s] for 40 cycles, and the fluorescence signal is collected by a real-time PCR instrument;

[0118] Figure 4 The fluorescence amplification curves for detecting positive clinical samples of ONNV, SFV, SINV, VEEV, CHIKV, BFV, and RRV using the triple qPCR detection method established in this invention are shown.

[0119] 7. Stability test

[0120] (1) Prepare a solution with a dilution factor of 10 times and a concentration of 1×10⁻⁶. 7 plasmid standards of CHIKV, BFV, and RRV at concentrations up to the lower limit of detection;

[0121] (2) Place the same concentration of plasmid standard into the triple qPCR reaction system, use the above primers and probes to perform PCR amplification, collect fluorescence signals, set up 3 identical systems as replicates each time, and perform three replicate experiments in total.

[0122] (3) The qPCR reaction system is: 10µL Probe Master Mix (containing Mg 2+ Add 0.1 µL each of CHIKV-F, CHIKV-R, BFV-F, BFV-R, RRV-F and RRV-R, 0.1 µL each of CHIKV-Probe, BFV-Probe and RRV-Probe, 0.5 µL of cDNA template, and nuclease-free water to a total volume of 20 μL.

[0123] (4) qPCR reaction program: The fluorescence channels were set as follows: CY5 for CHIKV, VIC for BFV, and FAM for RRV; The temperature control program was set as follows: 95 ℃ pre-denaturation for 10 min; [95 ℃ denaturation for 10 s, 62 ℃ annealing for 30 s] for 40 cycles, and the fluorescence signal was collected by a real-time PCR instrument.

[0124] (5) Calculate the value of 1×10 in three repeated experiments. 7 The stability of the detection method is determined by the coefficient of variation of the Cq values ​​amplified from CHIKV, BFV, and RRV plasmid standards at concentration gradients from copies / μL to the lower limit of detection.

[0125] Table 4. Repeatability Tests of the Triple TaqMan qPCR Detection Method

[0126]

[0127] As shown in the table above, the coefficient of variation (CV value) for each concentration gradient is less than 3%, indicating that the detection method of the present invention has high stability.

[0128] Example 2: Rapid and efficient clinical detection of three viruses: CHIKV, BFV, and RRV.

[0129] Step 1: Extract RNA from the sample and reverse transcribe it into cDNA;

[0130] Reverse transcription was performed using the HiScript® II 1st Strand cDNA Synthesis Kit. The total reaction volume was 20 µL, comprising: 1 µL Random hexamers, 1 µL Oligo (dT)23VN, 5 µL nuclease-free water, and 5 µL total RNA. After mixing, the mixture was heated at 65 °C for 5 min, then incubated on ice for 3 min. Next, 4 µL of 4×gDNA wiper Mix (4× genomic DNA removal premix) was added, and the mixture was heated at 42 °C for 2 min. Then, 2 µL of 10×RT Mix and 2 µL of HiScript® II Enzyme Mix (HiScript® II enzyme premix) were added. The reverse transcription reaction program was: 25 °C for 5 min, 50 °C for 45 min, and 85 °C for 2 min, yielding the cDNA template.

[0131] Step 2: Using the specific primer and probe composition designed in Example 1, and the cDNA obtained in Step 1 as a template, prepare a qPCR reaction system, perform PCR amplification, and collect fluorescence signals in the FAM, VIC and CY5 channels respectively.

[0132] The PCR amplification reaction program was set as follows: the fluorescence channels were set as follows: CY5 for CHIKV, VIC for BFV, and FAM for RRV; the reaction program was as follows: 95 °C pre-denaturation for 10 min; 40 cycles, each cycle including: 95 °C denaturation for 10 s, 62 °C annealing for 30 s, while fluorescence signals were collected using a real-time PCR instrument.

[0133] The qPCR reaction system, in 20 µL increments, contains: 10 µL Probe Master Mix (containing Mg2+). 2+ The mixture of ions, dNTPs, hot-start Taq DNA polymerase, and PCR buffer contains 0.3 µL each of the three pairs of forward and reverse primers, 0.3 µL each of the three probes, and 0.5 µL of cDNA template. The total volume is brought up to 20 µL with nuclease-free water.

[0134] Step 3: Determine whether the sample contains CHIKV (CY5), BFV (VIC), or RRV (FAM) nucleic acids based on the fluorescence signal and Cq value measured by the machine. The result determination criteria are as follows: if the Cq value of a certain channel is ≤35, it is determined to be positive for the viral nucleic acid; if the Cq value is ≥38, it is determined to be negative; if 35 < Cq value < 38, it is determined to be suspicious and needs to be retested.

[0135] Clinical samples positive for ONNV, SFV, SINV, and VEEV, as well as samples positive for CHIKV, BFV, and RRV, were placed in a triple qPCR system. Using the aforementioned primers and probes, PCR amplification was performed, and fluorescence signals were collected. Figure 4 It can be seen that the average Cq values ​​of CHIKV, BFV, and RRV are 27.23, 15.05, and 10.62, respectively, while other alphaviruses cannot be detected, indicating that the detection method of the present invention has good specificity.

Claims

1. A specific primer probe composition for detecting CHIKV, BFV, RRV, characterized in that, The specific primer probe composition comprises a primer pair and a probe for detecting CHIKV, a primer pair and a probe for detecting BFV, and a primer pair and a probe for detecting RRV; The primer pair and the probe for detecting CHIKV are as follows: Forward primer CHIKV-F: as shown in SEQ ID NO: 1; Reverse primer CHIKV-R: as shown in SEQ ID NO: 2; Probe CHIKV-Probe: as shown in SEQ ID NO: 3, 5' end labeled with a CY5 fluorescent group, and 3' end labeled with a BHQ3 quenching group; The primer pair and the probe for detecting BFV are as follows: Forward primer BFV-F: as shown in SEQ ID NO: 4; Reverse primer BFV-R: as shown in SEQ ID NO: 5; Probe BFV-Probe: as shown in SEQ ID NO: 6, 5' end labeled with a VIC fluorescent group, and 3' end labeled with a BHQ1 quenching group; The primer pair and the probe for detecting RRV are as follows: Forward primer RRV-F: as shown in SEQ ID NO: 7; Reverse primer RRV-R: as shown in SEQ ID NO: 8; Probe RRV-Probe: as shown in SEQ ID NO: 9, 5' end labeled with a FAM fluorescent group, and 3' end labeled with a MGB quenching group.

2. Use of the specific primer probe composition of claim 1 in the preparation of a triple TaqMan probe fluorescent quantitative PCR detection reaction solution for detecting CHIKV, BFV and RRV.

3. Use of the specific primer probe composition of claim 1 in the preparation of a triple TaqMan probe fluorescent quantitative PCR detection kit for detecting CHIKV, BFV and RRV.

4. A triple TaqMan probe fluorescent quantitative PCR detection reaction solution for detecting CHIKV, BFV and RRV, characterized in that, The reaction solution comprises the specific primer probe combination of claim 1, Mg 2+ ions, a mixture of dNTPs, a hot-start Taq DNA polymerase and a PCR buffer.

5. A triple TaqMan probe fluorescent quantitative PCR detection kit for detecting CHIKV, BFV, RRV, characterized in that, The kit comprises the reaction solution of claim 4 and a control; the control comprises a positive control and a negative control.

6. A method for simultaneous detection of CHIKV, BFV and RRV nucleic acids in a sample for non-diagnostic purposes, characterized in that, The method comprises the following steps: Step 1: Extract RNA from the sample and reverse transcribe it into cDNA; Step 2: Use the specific primer probe composition of claim 1 to prepare a qPCR reaction system with the cDNA obtained in step 1 as a template, perform PCR amplification, and collect fluorescent signals in FAM, VIC and CY5 channels, respectively; Step 3: Determine whether there is CHIKV, BFV or RRV nucleic acid in the sample according to the fluorescent signals and Cq values calculated by the machine.

7. The method of claim 6, wherein, In step 2, the reaction program of the PCR amplification is as follows: the fluorescence channel is set as follows: the fluorescence channel for CHIKV is CY5, the fluorescence channel for BFV is VIC, and the fluorescence channel for RRV is FAM; the reaction program is as follows: 95℃ pre-denaturation for 10 min; 40 cycles, each cycle comprising: 95℃ denaturation for 10 s, 62℃ annealing for 30 s, and simultaneously collecting fluorescent signals by a fluorescent quantitative PCR instrument.

8. The method of claim 6, wherein, In step 2, the qPCR reaction system is 20 μL, comprising: 10 μL of probe method premix, 0.3 μL of each of three pairs of specific primer probe compositions according to claim 1, 0.3 μL of each of three probes, 0.5 μL of cDNA template, and the balance with an RNase-free water to 20 μL.

9. The method of claim 6, wherein, In step 3, according to the machine calculated fluorescence signal and Cq value, the determination standard of whether the sample contains CHIKV, BFV and RRV nucleic acid is: if the Cq value of a channel is less than or equal to 35, it is determined that the CHIKV, BFV and RRV nucleic acid is positive; if the Cq value is greater than or equal to 38, it is determined that the CHIKV, BFV and RRV nucleic acid is negative; if the Cq value is between 35 and 38, it is determined to be suspicious and needs to be retested.

Images