Wheat amino acid transporter TaLHT7 and application thereof
By identifying the key role of the wheat amino acid transporter TaLHT7, and using CRISPR/Cas9 gene editing technology to knock out the TaLHT7 gene, the activity of wheat amino acid transporters was regulated, solving the problem of wheat disease resistance breeding, achieving stable disease resistance enhancement and reducing pesticide use, and ensuring food production security.
Patent Information
- Application Number
- CN202511160056.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-08-19
- Publication Date
- 2025-11-14
- Estimated Expiration
- 2045-08-19
AI Technical Summary
Existing technologies cannot effectively utilize the interaction mechanism of wheat amino acid transporters in regulating the nutrient absorption process of stripe rust, which makes it difficult to cultivate stable disease-resistant varieties and because stripe rust exhibits rapid genetic variation, making it difficult to achieve long-lasting disease control.
By identifying the key role of the wheat amino acid transporter TaLHT7, the TaLHT7 gene was knocked out using CRISPR/Cas9 gene editing technology, thereby regulating the activity of wheat amino acid transporters, reducing the transport of amino acids to stripe rust fungi, and enhancing the disease resistance of wheat.
It improved wheat's resistance to stripe rust, reduced yield loss caused by stripe rust, provided a stable theoretical basis for disease-resistant materials, reduced pesticide use, and ensured food production safety and the ecological environment.
Smart Images

Figure CN120943918A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of genetic engineering technology and relates to the breeding of plant disease-resistant materials in agricultural genetic engineering, specifically to a wheat amino acid transporter TaLHT7 and its applications. Background Technology
[0002] Wheat, one of the world's three staple foods, feeds approximately 40% of the global population. Wheat stripe rust, caused by *Puccinia striiformis* f.sp. Tritici (Pst), is a major fungal disease affecting wheat production. In years with widespread outbreaks, it can lead to yield losses of over 40%, and in severe cases, complete crop failure. Breeding resistant varieties is one of the most economical and effective measures for controlling wheat stripe rust. However, the discovery of resistance genes is time-consuming, breeding resistant varieties is difficult, and the rapid genetic variation of stripe rust fungi makes sustained control of the disease challenging. Therefore, creating broad-spectrum, long-lasting resistant materials is the fundamental approach to controlling wheat stripe rust.
[0003] Amino acid transporters (AATs) are an important class of proteins in wheat, responsible for the transmembrane transport of amino acids and participating in plant growth, development, and nutrient absorption. During wheat stripe rust infection, the fungus needs to obtain nutrients from wheat cells to support its growth and reproduction, with amino acids being a crucial nutrient source. Wheat amino acid transporters may directly affect the efficiency of amino acid absorption by stripe rust. If the distribution and supply of amino acids within wheat cells can be altered by regulating the activity or expression levels of wheat amino acid transporters, it may interfere with the nutrient absorption process of stripe rust, thereby inhibiting its growth and infection.
[0004] By elucidating the mechanism of action of wheat amino acid transporters in the nutrient absorption process of stripe rust fungi and identifying key sites of their interaction with stripe rust fungi, a theoretical foundation can be laid for creating disease-resistant wheat materials using amino acid transporters. For example, through gene editing or transgenic technology, wheat amino acid transporters can be precisely regulated to reduce the transport of amino acids to stripe rust fungi during infection, thereby enhancing wheat's disease resistance.
[0005] However, the mechanism of action of wheat amino acid transporters in the nutrient absorption process of stripe rust fungi is not yet fully understood, and there is a lack of relevant technologies for creating disease-resistant wheat materials using amino acid transporters. Therefore, it is necessary to deeply analyze the interaction mechanism between wheat amino acid transporters and stripe rust fungi, and to verify and regulate the function of related genes through molecular biology methods. This requires not only a large amount of basic research, but also verification of its disease resistance effect under field conditions. Summary of the Invention
[0006] By identifying the key roles of wheat amino acid transporters in the nutrient absorption process of stripe rust fungi and elucidating the molecular mechanism of their interaction, this invention not only provides theoretical support for genetic engineering breeding but also offers technical support for production practices. To this end, this invention screened and identified a lysine and histidine transporter (LHT), which belongs to the category of wheat amino acid transporters and is named TaLHT7. The amino acid sequence of wheat amino acid transporter TaLHT7 is shown in SEQ ID NO:1, and the CDS sequence of its encoding gene is shown in SEQ ID NO:2.
[0007] This invention demonstrates through experiments that the wheat amino acid transporter TaLHT7 plays a negative regulatory role in the interaction between wheat and stripe rust fungus. Knocking out the gene encoding the wheat amino acid transporter TaLHT7 increases the resistance of wheat to stripe rust fungus.
[0008] Based on the above characteristics, another aspect of the present invention provides the application of wheat amino acid transporter TaLHT7 in regulating wheat disease resistance: knocking out the coding gene for wheat amino acid transporter TaLHT7 in wheat materials increases wheat resistance to stripe rust. In this application, the CDS sequence of the coding gene for wheat amino acid transporter TaLHT7 is shown in SEQ ID NO:2.
[0009] To leverage the role of the wheat amino acid transporter TaLHT7 in production practices, a third aspect of this invention provides a method for breeding wheat varieties resistant to stripe rust. The method includes: using CRISPR / Cas9 gene editing technology to knock out the coding gene for the wheat amino acid transporter TaLHT7; the CDS sequence of the coding gene for TaLHT7 is shown in SEQ ID NO:2. This method can help improve the resistance of wheat plants to stripe rust fungus and reduce wheat yield loss caused by stripe rust.
[0010] To ensure a complete and unambiguous understanding of the technical solution of this invention, it should be noted that the wheat amino acid transporter TaLHT7 encoding gene is represented by italicized "TaLHT7", while the wheat amino acid transporter TaLHT7 is represented by non-italicized "TaLHT7". Of course, those skilled in the art can clearly and completely understand the meaning of the descriptions of the relevant genes and their encoded proteins based on the descriptions provided herein.
[0011] Compared with the prior art, the present invention "a wheat amino acid transporter TaLHT7 and its application" has the following beneficial effects or advantages.
[0012] This invention clarifies that the wheat amino acid transporter TaLHT7 plays a negative regulatory role in the interaction between wheat and stripe rust fungus, providing a theoretical basis for creating disease-resistant wheat materials using TaLHT7, and is of great significance for breeding stable genetically resistant wheat varieties.
[0013] This invention discloses a method for breeding wheat varieties resistant to stripe rust. This method utilizes CRISPR / Cas9 gene editing technology to obtain transgenic wheat varieties with the TaLHT7 gene knocked out. Verification has shown that the transgenic wheat obtained using the method described in this invention exhibits resistance to the stripe rust affinity race CYR32.
[0014] This invention is of great significance in improving wheat disease resistance. Using CRISPR / Cas9 gene editing technology, a CRISPR / Cas9 gene editing vector was successfully constructed, and the TaLHT7 gene was knocked out in wheat materials, providing a solution for breeding stripe rust-resistant wheat varieties from a molecular biology perspective.
[0015] This invention identifies the key role of wheat amino acid transporters in the nutrient absorption process of stripe rust fungi and elucidates the molecular mechanism of their interaction with stripe rust fungi. This provides a theoretical basis for creating disease-resistant wheat materials and is of great significance for breeding stable wheat varieties resistant to stripe rust. This will not only help improve the disease resistance of wheat, but also reduce the use of pesticides and ensure food production safety and the ecological environment. Attached Figure Description
[0016] Figure 1 Flowchart of the verification method for the application of wheat amino acid transporter TaLHT7 in the breeding and improvement of wheat varieties resistant to stripe rust.
[0017] Figure 2 The expression profiles of the TaLHT7 gene in the non-affinity response (left) and the affinity response (right). Figure 2 In the study, the non-affinity reaction was observed when inoculated with the non-toxic stripe rust race CYR23; the affinity reaction was observed when inoculated with the toxic stripe rust race CYR32.
[0018] Figure 3 This is a schematic diagram showing the location of the sgRNA fragment used for TaLHT7 gene editing within the TaLHT7 gene.
[0019] Figure 4This diagram illustrates the obtained TaLHT7 gene editing. "Target1" represents target sequence 1, and "Target2" represents target sequence 2; "Fielder" represents the TaLHT7 gene sequence of the wild-type Fielder wheat variety; "TaLHT7KO-L78-7A", "TaLHT7KO-L78-7B", and "TaLHT7KO-L78-7D" represent the gene sequences of the gene knockout mutant line L78 on chromosomes 7A, 7B, and 7D, respectively; "TaLHT7KO-L107-7A", "TaLHT7KO-L107-7B", and "TaLHT7KO-L107-7D" represent the gene sequences of the gene knockout mutant line L107 on chromosomes 7A, 7B, and 7D, respectively.
[0020] Figure 5 This is a PCR electrophoresis verification image of the transgenic wheat plants. "TaLHT7-KO-L78" and "TaLHT7-KO-L107" represent the gene knockout mutant lines L78 and L107, respectively; "Fielder" represents the wild-type Fielder wheat plant; "Plasmid" represents the recombinant vector plasmid; and "ddH2O" represents ddH2O as a control.
[0021] Figure 6 Phenotypic results of gene knockout mutant lines L78 and L107 (T2 generation) inoculated with stripe rust pathogen CYR32 (with wild-type Fielder wheat variety as control). Detailed Implementation
[0022] The technical solution of the present invention will be described below with reference to the embodiments. However, the present invention is not limited to the following embodiments.
[0023] Unless otherwise specified, the experimental and detection methods in the following embodiments are conventional methods; the reagents and materials mentioned are commercially available unless otherwise specified; and the index data are measured using conventional methods unless otherwise specified.
[0024] Figure 1 This invention provides a method for verifying the application of the wheat amino acid transporter TaLHT7 in breeding and improving wheat varieties resistant to stripe rust. The verification methods used for other host plants of stripe rust are similar. Figure 1 The methods may be identical or slightly different in technique. This invention provides a method for verifying the function of the wheat amino acid transporter TaLHT7, including:
[0025] S101, Obtain TaLHT7 gene-edited transgenic wheat, and perform high-throughput sequencing on TaLHT7 transgenic wheat;
[0026] S102, T2 generation TaLHT7 gene-edited transgenic wheat plants were inoculated with stripe rust race CYR32 to identify the resistance of TaLHT7 gene knockout transgenic wheat to stripe rust and determine the effect of TaLHT7 gene on wheat disease resistance.
[0027] Example 1
[0028] This embodiment provides the amino acid sequence of wheat amino acid transporter TaLHT7 and its encoding gene sequence.
[0029] 1) RNA extraction
[0030] RNA was extracted from the leaves of wild-type Fielder wheat using the TransZol UP Plus RNA Kit. The specific method is as follows:
[0031] (1) Quickly transfer the wheat leaf samples that have undergone cryogenic freezing to a grinder pre-cooled with liquid nitrogen for crushing.
[0032] (2) Add 1 mL TansZol UP and 200 μL RNAExtractionAgent to each sample tube and vortex at room temperature for 5 min to ensure that the sample and reagent are thoroughly mixed.
[0033] (3) Centrifuge the mixed sample at 10000×g at 4℃ for 15min.
[0034] (4) Transfer the colorless aqueous phase after centrifugation to a new centrifuge tube and add an equal volume of anhydrous ethanol. At this point, a precipitate will appear in the solution. Gently invert the centrifuge tube to mix thoroughly.
[0035] (5) Add the obtained solution and precipitate together into the centrifuge column, centrifuge at 12000×g for 30s at room temperature, and then discard the effluent. If the solution volume exceeds the capacity of the centrifuge column, the operation can be performed in multiple steps.
[0036] (6) Add 500 μL of CB9 to the centrifuge column, centrifuge at 12000 × g for 30 s at room temperature, and then discard the effluent.
[0037] (7) Repeat step (6) once to ensure that impurities are fully removed.
[0038] (8) Add 500 μL of WB9 to the centrifuge column (check before use to ensure that anhydrous ethanol has been added), centrifuge at 12000×g for 30s at room temperature, and discard the effluent.
[0039] (9) Place the centrifuge column into the RNase-free Tube provided in the kit, add 50 μL of RNase-free Water to the center of the centrifuge column, and let it stand at room temperature for 1 min to allow the RNA to dissolve completely.
[0040] (10) Centrifuge at 12000×g for 2 minutes at room temperature. The liquid at the bottom of the tube is the extracted RNA. Store it at -80℃ for later use.
[0041] 2) cDNA Acquisition
[0042] cDNA was synthesized using a reverse transcription kit (RevertAid MM, Thermo Scientific). The specific steps are as follows:
[0043] The reverse transcription reaction system was added to the RNase-free PCR tube, as shown in Table 1.
[0044] Table 1. Reverse transcription reaction system
[0045] Components volume 2×RTBuffer 10μL EnzymeMix 1μL RNA 5μg <![CDATA[RNAsefreeddH2O]]> Up to 20μL
[0046] The reaction system in Table 1 was thoroughly mixed using a vortex mixer and then placed in a PCR instrument. The reaction program was set to 42℃ for 1 h and 72℃ for 5 min for reverse transcription. After the program was completed, the cDNA sequence of the genome was obtained. The cDNA was diluted 10 times and stored at -20℃.
[0047] 3) Gene fragment amplification
[0048] cDNA obtained through reverse transcription was used as a template to amplify the TaLHT7 gene CDS sequence. The forward primer TaLHT7-cDNA-F is shown in SEQ ID NO:3, and the reverse primer TaLHT7-cDNA-R is shown in SEQ ID NO:4. The specific procedures are as follows:
[0049] Add the amplification reaction system shown in Table 2 to the PCR tube, mix thoroughly with a vortex mixer, and then place it in the PCR instrument. Set the reaction program to 95℃ for 5 min; 95℃ for 30 s; (58℃, 30 s, 72℃, 2 min, for a total of 35 cycles); 72℃ for 10 min; 4℃ for forever to amplify the gene fragment.
[0050] Table 2. Amplification Reaction System
[0051] Components volume 2×PCRMix (Thermoscientific) 10μL TaLHT7-cDNA-F 1μL TaLHT7-cDNA-R 1μL cDNA template 3μL <![CDATA[ddH2O]]> Up to 20μL
[0052] After the reaction procedure is completed, the amplified product is sequenced. The CDS sequence of the TaLHT7 gene is shown in SEQ ID NO:2. The TaLHT7 gene encodes the wheat amino acid transporter TaLHT7, and its amino acid sequence is shown in SEQ ID NO:1.
[0053] Example 2
[0054] This embodiment provides an analysis of the expression of wheat in the affinity and incompatibility processes between wheat and stripe rust fungus.
[0055] Wild-type Fielder wheat was inoculated with the virulent race CYR32 (affinity interaction) and the non-virulent race CYR23 (incompatibility interaction) of stripe rust fungus, with uninoculated wild-type Fielder wheat serving as a control. Wheat leaves were collected at 0, 6, 12, 24, 48, 72, 96, and 120 hours post-infection. RNA was extracted using a plant RNA extraction kit (TransGen Biotech Ltd.) and reverse transcribed using a reverse transcription kit (Thermo Fisher Scientific Ltd.). TaEF-α was used as an internal control gene, and the expression of the TaLHT7 gene was analyzed using qRT-PCR.
[0056] TaEF-α internal reference gene primers:
[0057] TaEF-α-F: TGGTGTCATCAAGCCTGGTATGGT (SEQ ID NO: 5);
[0058] TaEF-α-R: ACTCATGGTGCATCTCAACGGACT (SEQ ID NO: 6).
[0059] TaaLHT7 gene primers:
[0060] TaLHT7-qRT-F: CACGCCGCCCAAGGAT (SEQ ID NO:7);
[0061] TaLHT7-qRT-R: CGCTTCCCAGGGACTATCTCA (SEQ ID NO:8).
[0062] The expression profile of the TaLHT7 gene after infection is as follows: Figure 2 As shown. By Figure 2 It can be seen that the TaLHT7 gene is upregulated in both the affinity and incompatibility responses between wheat and stripe rust fungus, indicating that the TaLHT7 gene may play a regulatory role in the interaction between wheat and stripe rust fungus.
[0063] Example 3
[0064] This embodiment provides the application of wheat amino acid transporter TaLHT7 in the improvement of wheat varieties resistant to stripe rust.
[0065] TaLHT7 gene knockout wheat plants were obtained using CRISPR / Cas9 gene editing technology, and high-throughput sequencing was performed to verify the successful knockout. T2 generation seedlings from two knockout lines, L78 and L107, were then inoculated with the stripe rust pathogen CYR32, and wheat leaf phenotypes were observed and recorded after inoculation.
[0066] Primers used to construct gene editing vectors:
[0067] TaLHT7-KO-F1:ACTCGCGCAGGGGTCCTGGCATCG (SEQ ID NO:9);
[0068] TaLHT7-KO-R1: AAACCGATGCCAGGACCCCTGCAC (SEQ ID NO: 10). TaLHT7-KO-F2: ACTCCGTGTGGCACCACGATCCAG (SEQ ID NO: 11);
[0069] TaLHT7-KO-R2: AAACCTGGATCGTGGTGCCACAGC (SEQ ID NO: 12).
[0070] The sgRNA fragment used for TaLHT7 gene editing has the following location of action in the TaLHT7 gene: Figure 3 As shown; the obtained TaLHT7 gene editing status is as follows. Figure 4 As shown. The results of PCR electrophoresis verification of the genes in the transgenic wheat plants are as follows. Figure 5 As shown. By Figure 5 It can be seen that the gene knockout wheat lines L78 and L107 were successfully constructed.
[0071] T2 generation seedlings of L78 and L107 strains at the "two-leaf-one-heart" stage were selected and inoculated with the stripe rust-compatible race CYR32. After inoculation, the seedlings were placed in a humidity chamber in darkness for 24 hours, followed by cultivation in a photoperiod growth incubator at 16°C for 16 hours of light and 11°C for 8 hours of darkness. Spore accumulation in the leaves was observed after 14 days to assess disease resistance. Wild-type Fielder wheat plants were used as a control.
[0072] Figure 6 Phenotypic results after inoculation with the stripe rust pathogenic race CYR32. Figure 6As can be seen, the accumulation of stripe rust spores on wheat leaves of L78 and L107 strains was significantly less than that of Fielder wheat plants, indicating that the TaLHT7 gene plays a negative regulatory role in the interaction between wheat and stripe rust. Therefore, wheat plants with this gene knocked out showed higher resistance to stripe rust.
[0073] The above embodiments can well illustrate the technical solution of the present invention, but they are only describing preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Without departing from the spirit of the present invention, all kinds of changes and improvements made by those skilled in the art to the technical solution of the present invention should fall within the protection scope defined by the present invention.
Claims
1. A wheat amino acid transporter TaLHT7, characterized in that, The amino acid sequence of the wheat amino acid transporter TaLHT7 is shown in SEQ ID NO:
1.
2. The wheat amino acid transporter TaLHT7 according to claim 1, characterized in that, The CDS sequence of its encoding gene is shown in SEQ ID NO:
2.
3. The wheat amino acid transporter TaLHT7 according to claim 1, characterized in that, The wheat amino acid transporter TaLHT7 plays a negative regulatory role in the interaction between wheat and stripe rust. Knocking out the gene encoding the wheat amino acid transporter TaLHT7 increases wheat resistance to stripe rust.
4. The application of wheat amino acid transporter TaLHT7 in regulating wheat disease resistance, characterized in that, Knocking out the gene encoding the wheat amino acid transporter TaLHT7 in wheat materials increases wheat resistance to stripe rust.
5. The application according to claim 4, characterized in that, The CDS sequence of the gene encoding the wheat amino acid transporter TaLHT7 is shown in SEQ ID NO:
2.
6. A method for breeding wheat varieties resistant to stripe rust, characterized in that, The method includes: using CRISPR / Cas9 gene editing technology to knock out the coding gene of wheat amino acid transporter TaLHT7; the CDS sequence of the coding gene of wheat amino acid transporter TaLHT7 is shown in SEQ ID NO:2.
Citation Information
Patent Citations
Ginseng amino acid transport protein gene PgLHT and encoding protein and application thereof
CN102952812A
Wheat stem rust resistance genes and methods of use
CN108026150A
Toxic effect protein and application thereof in wheat disease resistance breeding
CN116375839A
Wheat sugar transporter, gene and application thereof
CN116478260A
Puccinia caerulea resistance gene
CN116634861A