Alternaria FW1 and application thereof in heavy oil degradation

Abstract

The invention discloses alternaria FW1 and application thereof in heavy oil degradation, and belongs to the technical field of microbial remediation. The strain is preserved in the China Center for Type Culture Collection on January 6, 2025, the preservation address is Wuhan University, Wuhan, China, and the preservation number is CCTCC NO: M 2025048. The alternaria alternata FW1 grows well on a thick oil flat plate, and the growth diameter reaches 68 mm. The strain has high heavy oil degradation capacity, the heavy oil degradation rate reaches 63.96%, and the content of saturated hydrocarbon, aromatic hydrocarbon, colloid and asphaltene in heavy oil is remarkably changed. The degradation rates of aromatic hydrocarbon, colloid and asphaltene in the thickened oil degraded by fungi are 84.30%, 55.00% and 42.98% respectively, while the saturated hydrocarbon is significantly increased by 112.62%. The technology provides a new scheme for heavy oil contaminated soil remediation with low cost, high efficiency and environmental friendliness.

Description

Technical Field

[0001] This invention relates to the field of microbial remediation technology, and in particular to a strain of Alternaria FW1 and its application in the degradation of heavy oil. Background Technology

[0002] Petroleum, hailed as the "lifeblood" of modern industry, occupies a central position in the global energy structure. Heavy oil, a type of crude oil with high viscosity and density, holds a place in the supply of energy and chemical feedstocks due to its unique physical properties. According to statistics from the International Energy Agency (IEA, 2023), global oil demand reached 97.8 million barrels per day in 2017 and is projected to grow to 104.7 million barrels per day in 2023, an increase of 6.9 million barrels per day compared to 2017. This indicates that robust economic growth requires more oil. Heavy oil extraction is an important way to expand the utilization of petroleum resources and is of great significance for ensuring energy security and meeting the demand for chemical feedstocks. Against the backdrop of global energy transition, the effective utilization of heavy oil is of strategic importance for balancing energy supply and demand and ensuring energy security. However, during the extraction, refining, and transportation of heavy oil, improper operation or pipeline ruptures can lead to leaks, causing serious environmental damage. How to remove heavy oil pollutants from the environment (especially soil) has become an urgent problem for humanity.

[0003] Traditional physical and chemical methods have many drawbacks in remediating petroleum-contaminated soil. Physical methods, such as thermal treatment, consume large amounts of energy and easily damage soil structure and organic matter. Chemical methods, such as chemical oxidation, while highly efficient, are expensive and may cause secondary pollution. In contrast, microbial remediation stands out due to its low cost, high efficiency, and environmental friendliness. Microbial remediation mainly utilizes native microorganisms in the natural environment or artificially introduced exogenous microorganisms to degrade pollutants in the environment into harmless small molecules such as CO2 and H2O. Microbial remediation not only effectively removes pollutants and improves soil quality but also avoids damage to the on-site ecological environment, preventing secondary pollution problems that may arise from physical and chemical methods and promoting ecosystem restoration. The key to microbial remediation technology is the microbial species. Research has found that there are many microorganisms in nature capable of degrading petroleum hydrocarbons, approximately 100 genera and over 200 species, belonging to bacteria, actinomycetes, molds, yeasts, and algae. Among them, bacteria and fungi are considered the main degraders of petroleum pollutants in soil due to their unique biological characteristics and degradation capabilities. Heavy oil has a high content of gum and asphaltenes, resulting in high viscosity and density. This characteristic directly leads to heavy oil generally solidifying at room temperature, limiting the contact area for microorganisms and making degradation difficult. Screening for dominant microbial species is an important means to improve the degradation efficiency of petroleum hydrocarbons. Fungi, due to their secreted extracellular enzymes capable of decomposing complex organic pollutants, show great potential in the remediation of petroleum-contaminated soils. Summary of the Invention

[0004] The purpose of this invention is to provide a strain of Alternaria FW1 and its application in heavy oil degradation, so as to solve the problems existing in the prior art.

[0005] To achieve the above objectives, the present invention provides the following solution:

[0006] One of the technical solutions of this invention is a strain of Alternaria sp. FW1, which was deposited at the China Center for Type Culture Collection on January 6, 2025, at Wuhan University, Wuhan, China, with accession number CCTCCNO: M 2025048.

[0007] The second technical solution of the present invention is a microbial inoculant, comprising Alternaria FW1.

[0008] The third technical solution of the present invention is the application of Alternaria FW1 or the microbial agent in the degradation of heavy oil.

[0009] The fourth technical solution of the present invention is a method for degrading heavy oil, which involves treating heavy oil with the Alternaria FW1 or the microbial agent to degrade it.

[0010] The fifth technical solution of the present invention is the application of Alternaria FW1 or the microbial agent in the preparation of products degraded from heavy oil.

[0011] The sixth technical solution of the present invention is the application of Alternaria FW1 or the microbial agent in the remediation of heavy oil contaminated soil.

[0012] The seventh technical solution of the present invention is a method for remediating soil contaminated by heavy oil, which uses the Alternaria FW1 or the microbial agent to remediate the soil contaminated by heavy oil.

[0013] Based on the above technical solution, the present invention has the following technical effects:

[0014] (1) The Alternaria FW1 of the present invention has a strong ability to degrade heavy oil. The fungus can grow well on petroleum plates and the heavy oil degradation rate reaches 63.97%.

[0015] (2) The Alternaria alternata FW1 of this invention can efficiently degrade and convert hydrocarbon compounds in heavy oil, including alkanes, cycloalkanes, aromatic hydrocarbons, gums, and asphaltenes. In this study, after degradation by Alternaria alternata FW1, saturated hydrocarbons increased by 112.62%, while aromatic hydrocarbons, gums, and asphaltenes decreased by 84.20%, 55.00%, and 42.98%, respectively.

[0016] (3) The Alternaria FW1 strain of the present invention can effectively degrade long-chain alkanes, with an average degradation rate of 64.91%, of which C 21 and C 26 The degradation rates reached 94.63% and 87.40% respectively, demonstrating their potential remediation capacity for heavy oil pollution.

[0017] The *Alternaria* FW1 strain provided by this invention is a newly discovered heavy oil-degrading fungus with unprecedented potential in heavy oil degradation and remediation of heavy oil-contaminated soil. This fungus can effectively degrade heavy oil and remove heavy oil pollutants from contaminated soil, demonstrating enormous application potential and profound implications for environmental protection and ecological restoration. Since there are no related reports in the literature prior to this application date, the discovery of *Alternaria* FW1 provides a new germplasm resource for the field of heavy oil pollution remediation and environmental protection. Attached Figure Description

[0018] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0019] Figure 1 The colony morphology (A), microscopic morphology (B), and phylogenetic tree (C) of Alternaria alternata FW1 are shown.

[0020] Figure 2 This image shows the growth of Alternaria alternata FW1 on a heavy oil agar plate. In the image, A represents the control group, and B shows the growth of Alternaria alternata FW1 on a petroleum agar plate. Detailed Implementation

[0021] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0022] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Every smaller range between any stated value or intermediate value within a stated range, and any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0023] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0024] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be obvious to those skilled in the art. This application specification and embodiments are merely exemplary.

[0025] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0026] Unless otherwise specified, the technical solutions described in this invention are all conventional solutions in the field, and the reagents or raw materials used are all purchased from commercial channels or are publicly available unless otherwise specified.

[0027] This invention provides a strain of Alternaria sp. FW1, which was deposited on January 6, 2025 at the China Center for Type Culture Collection (CCTCC), Wuhan University, Wuhan, China, with accession number CCTCCNO: M 2025048.

[0028] This invention also provides a microbial inoculant, including the Alternaria genus FW1.

[0029] The present invention also provides the application of the Alternaria FW1 or the microbial agent in the degradation of heavy oil.

[0030] This invention also provides a method for degrading heavy oil, which involves treating heavy oil with the Alternaria FW1 or the microbial agent to degrade it.

[0031] This invention also provides the application of the Alternaria FW1 or the microbial agent in the preparation of products degraded from heavy oil.

[0032] The present invention also provides the application of the Alternaria FW1 or the microbial agent in the remediation of heavy oil contaminated soil.

[0033] This invention also provides a method for remediating oil-contaminated soil, using the Alternaria spp. FW1 or the microbial agent to remediate the oil-contaminated soil.

[0034] Alternaria alternata FW1 grew well on heavy oil plates, reaching a diameter of 68 mm. This strain exhibited strong heavy oil degradation ability, achieving a degradation rate of 63.96%, and significantly altered the content of saturated hydrocarbons, aromatic hydrocarbons, gums, and asphaltenes in the heavy oil. After fungal degradation, the degradation rates of aromatic hydrocarbons, gums, and asphaltenes in the heavy oil were 84.30%, 55.00%, and 42.98%, respectively, while saturated hydrocarbons increased significantly by 112.62%. FT-IR analysis revealed that the heavy oil treated with Alternaria alternata FW1 at a depth of 1746 cm⁻¹... -1 The presence of new absorption peaks nearby indicates that Alternaria alternata FW1 can further convert long-chain alkanes into aldehydes and acids. This technology, with its low cost, high efficiency, and environmental friendliness, provides a new solution for the remediation of heavy oil-contaminated soils.

[0035] This invention is implemented using the following technical methods:

[0036] (I) Screening and identification of Alternaria alternata FW1

[0037] This bacterium was isolated from the heavy oil mud of the Karamay oilfield and is currently deposited at the China Center for Type Culture Collection, with accession number CCTCC M 2025048.

[0038] DNA was extracted from *Alternaria alstroemeriae* FW1 samples, amplified using universal ITS primers, and the amplified products were sequenced by Wuhan Bena Technology Co., Ltd. The sequencing results were compared with the ITS sequences of other strains in the NCBI database. The DNA sequence of this fungal strain showed 99.0% homology with *Alternaria alstroemeriae* NR163686, thus confirming that this strain is *Alternaria alstroemeriae*.

[0039] Alternaria alternata FW1 was cultured on PDA solid medium. Colonies of strain FW1 were circular, with white, radially arranged hyphae that adhered firmly to the medium. Spores were dark brown, relatively uniform in size, approximately 35–42 μm × 6–20 μm. Under an electron microscope, the conidia of Alternaria alternata were oval with tuberculate protuberances on the surface; the hyphae were slender and septate. The optimal growth temperature was 28–30℃.

[0040] (II) Application of Alternaria alternata FW1 in Heavy Oil Pollution Remediation

[0041] Furthermore, the Alternaria FW1 strain exhibits strong heavy oil degradation capabilities. This strain can grow and reproduce on petroleum plates, reaching a diameter of 68 mm, and grows well, demonstrating good heavy oil degradation potential.

[0042] Furthermore, the Alternaria FW1 strain exhibits a strong ability to remove heavy oil. Indoor remediation simulation experiments show that its removal rate reaches 63.96%, and it significantly alters the content of saturated hydrocarbons, aromatic hydrocarbons, gums, and asphaltenes in heavy oil.

[0043] Furthermore, the Alternaria FW1 fungus possesses a strong long-chain alkane (C) content. 20 -C 28 The degradation capacity reached an average degradation rate of 64.91%, of which C 21 and C 26 The degradation rates reached 94.63% and 87.40%, respectively.

[0044] Example 1

[0045] Strain screening

[0046] Several petroleum hydrocarbon-degrading bacteria were isolated and screened from heavy oil sludge in the Karamay oilfield using enrichment culture and dilution plate methods. The highly efficient fungal strain Alternaria FW1, which degrades heavy oil, was further screened using spot inoculation and oil draining ring methods.

[0047] The Alternaria sp. FW1 strain screened in this invention was deposited on January 6, 2025, at the China Center for Type Culture Collection (CCTCC), Wuhan University, Wuhan, China, with accession number CCTCC NO: M2025048.

[0048] Example 2

[0049] Identification of bacterial strains

[0050] (1) Morphological characteristics

[0051] Alternaria alternata FW1 was cultured on PDA solid medium. Colonies of strain FW1 were circular, with white, radially arranged hyphae that adhered firmly to the medium. Spores were dark brown, relatively uniform in size, approximately 35–42 μm × 6–20 μm. Under an electron microscope, the conidia of Alternaria alternata were oval with tuberculate protuberances on the surface; the hyphae were slender and septate. Specific morphology is as follows: Figure 1 As shown.

[0052] (2) Biochemical characteristics

[0053] The optimal growth temperature for Alternaria alternata FW1 is 20–30℃, and the optimal pH value for growth is 7–8. Furthermore, Alternaria alternata FW1 can utilize various carbon sources, including soluble starch, sucrose, and glucose, with sucrose being its preferred carbon source, providing ample energy and nutrients that promote its growth and reproduction.

[0054] (3) ITS sequence analysis

[0055] DNA was extracted from samples of *Alternaria alstroemeriae* FW1, amplified using universal ITS primers, and the amplified products were sequenced by Wuhan Bena Technology Co., Ltd. The sequencing results were compared with the ITS sequences of other strains in the NCBI database. The DNA sequence of this fungal strain showed 99.0% homology with *Alternaria alstroemeriae* NR163686, thus confirming that this strain is *Alternaria alstroemeriae*. The phylogenetic tree of *Alternaria alstroemeriae* FW1 is as follows: Figure 1 .

[0056] The ITS amplification and sequencing results are shown below:

[0057] SEQ ID NO.1: ATATGCTTAAGTTCAGCGGGTATCCCTACCTGATCCGAGGTCA AAAGTTGAAAAAAAGGCTTAATGGATGCTAGACCTTTGCTGATAGAGAGTGCGACTTGTGCTGCGCTCCGAAACCAGTAGGCCGGCTGCCAATTACTTTAAGGCGAGTCTCCAGCAAAGCTAGACAAGACGCCCAACACCAAGCAAAGCTTGAGGGTACAAATGACGCTCGAACAGGCATGCCCTTTGGAATACCAAAGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTC ACACTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCCAGAACCAAGAGATCCGTTGTTGAAAGTTGTAATTATTAATTTGTTACTGACGCTGATTGCAATTACAAAAGGTTTATGTTTGTCCTAGTGGTGGGCGAACCCACAAGAAACAAGAAGTACGCAAAAGACAAGGGTGAATAATTCAGCAAGGCTGTAACCCCGAGAGGTTCCAGCCCGCCTTCATATTTGTGTAATGATCCCTCCGCAG.

[0058] Example 3

[0059] Application of strains

[0060] (1) Heavy oil degradation ability of Alternaria FW1

[0061] Experimental Methods: In this study, *Alternaria alternata* strain FW1 was first activated and then inoculated onto a selection medium with heavy oil as the sole carbon source, and cultured at 30°C for 7 days. Simultaneously, a heavy oil medium without *Alternaria alternata* FW1 inoculation was set up as a blank control group to compare the growth of the experimental groups and thus evaluate the heavy oil degradation capacity of *Alternaria alternata* FW1.

[0062] Experimental results: From Figure 2 As can be seen, Alternaria alternata FW1 grew well on oil agar plates, reaching a diameter of 68 mm, demonstrating good degradation potential. This result indicates that Alternaria alternata FW1 has strong petroleum hydrocarbon degradation potential, suggesting its potential application value in remediating petroleum hydrocarbon-contaminated soils.

[0063] (2) Application in the remediation of heavy oil contaminated soil

[0064] Experimental Methods: First, a suitable amount of *Alternaria alternata* FW1 cells was picked from the culture slant using a sterile bamboo stick and transferred to a 250 mL Erlenmeyer flask containing 100 mL of PDA liquid medium. The flask was incubated at 30℃ and 100 rpm for 5 days to prepare a pure strain seed culture. Then, 10% of the seed culture was inoculated into a 600 mL tissue culture flask containing 50 g of heavy oil contamination remediation medium and incubated statically at 30℃ for 30 days. A blank control group was set up using heavy oil contamination remediation medium without *Alternaria alternata* FW1 inoculation. After the incubation period, the petroleum degradation rate was determined by gravimetric method.

[0065] Experimental Results: As shown in Table 1, Alternaria alternata FW1 exhibits a high degradation capacity for heavy oil, with a degradation rate reaching 63.97%, demonstrating excellent petroleum hydrocarbon removal capabilities. This result confirms the application prospects of Alternaria alternata FW1 in the field of environmental remediation.

[0066] Table 1. Removal efficiency of heavy oil by Alternaria alternata FW1

[0067]

[0068] (3) Analysis of heavy oil components degraded by Alternaria alternata FW1

[0069] Experimental Methods: After the petroleum-contaminated soil remediation experiment, the collected heavy oil samples were dissolved in n-hexane at a ratio of 1.000 g / 15 mL, and chromatographic analysis was performed by gas chromatography-mass spectrometry (GC-MS). The peak areas of alkane components in the heavy oil were measured, and their relative content changes were calculated to evaluate the degradation effect of Alternaria alternata FW1 on alkane components in heavy oil.

[0070] Experimental Results: As shown in Table 2, the crude oil group components after degradation by *Alternaria alternata* FW1 were significantly different from those before degradation. This phenomenon indicates that *Alternaria alternata* FW1 can metabolize a series of long-chain n-alkanes as carbon and energy sources, thereby altering the chemical composition of petroleum hydrocarbons. Specifically, the presence of *Alternaria alternata* FW1 leads to a decrease in C content in the oil sludge. 14-18 and C 23-28 The content of n-alkanes decreased to varying degrees, with average degradation rates reaching 53.84% and 59.96%, respectively. Among the various components, C... 21 The degradation rate of n-alkanes was the highest, reaching 94.63%, while C... 20 n-Alkanes showed the lowest degradation rate, at only 1.23%. It is worth noting that C... 13 n-Alkanes (42.95%), C 19 (64.17%) and C 22 The peak area of ​​(55.01%) increased, which may be related to the degradation and transformation of heavy components. Heavy components such as waxes, gums, and asphaltenes in heavy oil are transformed into light and medium-weight components during the degradation process. In summary, Alternaria alternata FW1 exhibits a strong ability to degrade macromolecular components, which is of great significance for improving the degradation rate of petroleum hydrocarbons and the remediation efficiency of oil sludge pollution.

[0071] Table 2. Relative content changes of gasifiable components before and after degradation by Alternaria alternata FW1.

[0072]

[0073] (4) FT-IR analysis of heavy oil degradation by Alternaria alternata FW1

[0074] Experimental method: After the sludge remediation experiment was completed, the collected heavy oil sample was dissolved in n-hexane at a ratio of 1.000 g / 15 mL, and the chemical bond and functional group changes of the sample were analyzed by Fourier transform infrared spectroscopy (FT-IR).

[0075] Experimental Results: The composition of heavy oil before and after treatment with Alternaria alternata FW1 was analyzed by FT-IR. The main functional groups in the heavy oil were located in the 3000-2800 cm⁻¹ region. -1 (Adipose tissue), 1707cm -1 (Carboxyl / Carbonyl), 1373-1460cm -1 (Aliphatic curvature), 1605cm -1 872–722cm -1 (Aromatic compounds) exhibit significant stretching vibrations. After treatment with Alternaria FW1, the functional groups in the heavy oil showed a significant stretching vibration at 1746 cm⁻¹. -1The presence of stretching vibrations in the vicinity suggests that *Alternaria alternata* FW1 may promote the conversion of long-chain alkanes in heavy oil into esters or carboxylic acids. This change indicates a significant alteration in the chemical composition of the heavy oil, which may affect its physical properties, such as viscosity and flowability. This is of great significance for understanding the mechanism of *Alternaria alternata* FW1 in sludge remediation and its potential applications.

[0076] (5) Degradation effect of Alternaria alternata FW1 on different components in heavy oil

[0077] Experimental method: Alumina column chromatography was used to analyze the changes in the content of saturated hydrocarbons, aromatic hydrocarbons, gums and asphaltenes in heavy oil before and after treatment with Alternaria alternata FW1.

[0078] Experimental Results: As shown in Table 3, *Alternaria alternata* FW1 significantly degraded aromatic hydrocarbons, gums, and asphaltenes in heavy oil, with degradation rates of 84.20%, 55.00%, and 42.98%, respectively. Simultaneously, the content of saturated hydrocarbons increased by 112.62%. Extracellular enzymes secreted by *Alternaria alternata* FW1 promoted the conversion of heavy components such as gums and asphaltenes in heavy oil into lighter components such as saturated hydrocarbons and aromatic hydrocarbons. Statistical analysis showed that the differences in the content of the four components between the treated samples and the control group were statistically significant (P < 0.05), indicating that *Alternaria alternata* FW1 plays an important role in the degradation of heavy oil.

[0079] Table 3 Effect of Alternaria alternata FW1 on heavy oil composition

[0080]

[0081] The results of the above examples demonstrate that *Alternaria alternata* FW1, as a highly efficient heavy oil-degrading fungus, possesses the potential to degrade heavy oil and remediate heavy oil-contaminated soil. Applying *Alternaria alternata* FW1 to the remediation of heavy oil-contaminated soil exhibits significant advantages such as non-toxicity, harmlessness, low cost, ease of operation, and high safety. These characteristics make it a potential environmentally friendly technology for solving heavy oil pollution problems in an economical and efficient manner.

[0082] Obviously, the above embodiments of the present invention are merely examples for clearly illustrating the present invention, and are not intended to limit the implementation of the present invention. For those skilled in the art, other variations or modifications can be made based on the above description. It is neither necessary nor possible to exhaustively describe all embodiments here. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the scope of protection of the claims of the present invention.

Claims

1. A strain of *Alternaria* sp. FW1, characterized in that, This strain was deposited at the China Center for Type Culture Collection (CCTCC) on January 6, 2025, at Wuhan University, Wuhan, China, with accession number CCTCC NO: M2025048.

2. A microbial inoculant, characterized in that, Includes Alternaria FW1 as described in claim 1.

3. The application of Alternaria FW1 as described in claim 1 or the microbial agent as described in claim 2 in the degradation of heavy oil.

4. A method for degrading heavy oil, characterized in that, Heavy oil is treated and degraded using Alternaria FW1 as described in claim 1 or the microbial agent as described in claim 2.

5. The application of Alternaria FW1 as described in claim 1 or the microbial agent as described in claim 2 in the preparation of products degraded from heavy oil.

6. The application of Alternaria FW1 as described in claim 1 or the microbial agent as described in claim 2 in the remediation of heavy oil contaminated soil.

7. A method for remediating oil-contaminated soil, characterized in that, Soil contaminated with heavy oil can be remediated using Alternaria FW1 as described in claim 1 or the microbial agent as described in claim 2.

Images