Engineered Cas protein
By fusing the HNH domain into the type V CRISPR endonuclease, the problem of insufficient editing activity of type V CRISPR endonuclease was solved, expanding its application scope and enhancing its gene editing capabilities.
Patent Information
- Application Number
- CN202511106029.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-08-08
- Publication Date
- 2025-11-14
AI Technical Summary
Existing type V CRISPR endonucleases, such as Cas12a, lack the HNH domain, resulting in insufficient editing activity and limiting their application scope.
The HNH domain was fused into the V-type Cas enzyme to enhance its editing activity.
This expands the application scope of type V Cas enzymes and enhances their gene editing capabilities.
Smart Images

Figure CN120944852A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of gene editing, particularly to the field of regularly clustered short palindromic repeats (CRISPR) technology. Specifically, this invention relates to an engineered Cas protein, and more particularly to a V-type Cas protein fused with an HNH domain. Background Technology
[0002] CRISPR / Cas technology is a widely used gene editing technology that uses RNA to specifically bind to target sequences on the genome and cut DNA to create double-strand breaks, using biological non-homologous end joining or homologous recombination for site-specific gene editing.
[0003] Type II CRISPR endonucleases, such as Cas9, include two nuclease domains: the HNH domain and the RuvC domain. Unlike type II CRISPR endonucleases, type V CRISPR endonucleases, such as Cas12a (or cpf1), only have the RuvC domain and lack the HNH domain; as described in Chinese patent CN109207477B, Cpf1 lacks the HNH nuclease domain present in the Cas9 protein.
[0004] This application provides an engineered V-type Cas enzyme, which incorporates an HNH domain and improves the editing activity of the V-type Cas enzyme to a certain extent, thus having broad application prospects. Summary of the Invention
[0005] The inventors improved the editing activity and expanded the application range of the V-type Cas enzyme by fusing the HNH domain into it.
[0006] Engineered V-type Cas protein
[0007] On one hand, the present invention provides an engineered V-type Cas protein, the engineered V-type Cas protein comprising a parental V-type Cas protein and an HNH domain, wherein the HNH domain is located at the N-terminus of the parental V-type Cas protein.
[0008] In this invention, the HNH domain is a domain with nuclease cleavage activity; those skilled in the art can obtain HNH domains with nuclease cleavage activity through conventional techniques, such as obtaining HNH domains with nuclease cleavage activity through bioinformatics analysis.
[0009] In one embodiment, the HNH domain is selected from one or any of the following: an HNH domain derived from *Desulfococcus multivorans* DSM 2059, an HNH domain derived from *Delta proteobacterium NaphS2*, an HNH domain derived from *Candidatus Competibacter denitrificans* Run_A_D11, an HNH domain derived from *Rhodococcus sp.*, an HNH domain derived from *Tessaracoccus lapidicaptus*, an HNH domain derived from *Paraconexibacter algicola*, an HNH domain derived from *Euzebya pacifica*, an HNH domain derived from *Corynebacterium glutamicum*, an HNH domain derived from *Mycobacterium tuberculosis*, an HNH domain derived from *Eggerthia catenaformis*, an HNH domain derived from *Flavobacterium phage 11b*, and an HNH domain derived from *Haliscomenobacter*. HNH domains derived from *H. hydrossis*, *Amphibacillus xylanus*, *Rhodospirillum centenum*, *Amborella trichopoda*, *Glycine max*, *Klebsormidium nitens*, *Salpingoeca rosetta*, *Physcomitrium patens*, *Ophiophagus hannah*, *Symbiodinium microadriaticum*, *Bodo saltans*, *Agrococcus pavilionensis RW1*, *Actinobacteria bacterium IMCC26256*, and *Eubacterium*. The HNH domain of sp., the HNH domain derived from Zavarzinia aquatilis, and the HNH domain derived from Oxalobacter formigenes.
[0010] In one embodiment, the HNH domain is an HNH domain derived from Desulfococcus multivorans DSM 2059; in one embodiment, the amino acid sequence of the HNH domain derived from Desulfococcus multivorans DSM 2059 has at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, or at least 99.9% sequence identity with SEQ ID No. 1, and has the biological function of the HNH domain; in one embodiment, the amino acid sequence of the HNH domain derived from Desulfococcus multivorans DSM 2059 is identical to that of SEQ ID No. 1. Compared to No. 1, which has one or more amino acid substitutions, deletions, or additions, for example, substitutions, deletions, or additions of 1-20 amino acids, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 amino acid substitutions, deletions, or additions, and has the biological function of the HNH domain; preferably, the amino acid sequence of the HNH domain derived from Desulfococcus multivorans DSM 2059 is as shown in SEQ ID No. 1.
[0011] In one embodiment, the HNH domain is an HNH domain derived from Delta proteobacterium NaphS2; in one embodiment, the amino acid sequence of the HNH domain derived from Delta proteobacterium NaphS2 has at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, or at least 99.9% sequence identity with SEQ ID No. 2, and has the biological function of the HNH domain; in one embodiment, the amino acid sequence of the HNH domain derived from Delta proteobacterium NaphS2 is identical to that of SEQ ID No. 2. Compared to No. 2, which has one or more amino acid substitutions, deletions, or additions, for example, substitutions, deletions, or additions of 1-20 amino acids, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 amino acid substitutions, deletions, or additions, and has the biological function of the HNH domain; preferably, the amino acid sequence of the HNH domain derived from Delta proteobacterium NaphS2 is as shown in SEQ ID No. 2.
[0012] In one embodiment, the HNH domain is an HNH domain derived from Candidatus Competibacter denitrificans Run_A_D11; in one embodiment, the amino acid sequence of the HNH domain derived from Candidatus Competibacter denitrificans Run_A_D11 has at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, or at least 99.9% sequence identity with SEQ ID No. 3, and has the biological function of the HNH domain; in one embodiment, the HNH domain derived from Candidatus Competibacter denitrificans... The amino acid sequence of the HNH domain of Run_A_D11 has one or more amino acid substitutions, deletions, or additions compared to SEQ ID No. 3, for example, substitutions, deletions, or additions of 1-20 amino acids, or substitutions, deletions, or additions of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 amino acids, and has the biological function of the HNH domain; preferably, the amino acid sequence of the HNH domain of Candidatus Competibacter denitrificans Run_A_D11 is as shown in SEQ ID No. 3.
[0013] In one embodiment, the HNH domain is derived from the HNH domain of Rhodococcus sp.; in one embodiment, the amino acid sequence of the HNH domain derived from Rhodococcus sp. has at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, or at least 99.9% sequence identity with SEQ ID No. 4, and has the biological function of the HNH domain; in one embodiment, the amino acid sequence of the HNH domain derived from Rhodococcus sp. is identical to that of SEQ ID No. 4. Compared to No. 4, which has one or more amino acid substitutions, deletions, or additions, for example, substitutions, deletions, or additions of 1-20 amino acids, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 amino acid substitutions, deletions, or additions, and has the biological function of the HNH domain; preferably, the amino acid sequence of the HNH domain derived from Rhodococcus sp. is as shown in SEQ ID No. 4.
[0014] In one embodiment, the HNH domain is an HNH domain derived from *Tessaracoccus lapidicaptus*; in one embodiment, the amino acid sequence of the HNH domain derived from *Tessaracoccus lapidicaptus* has at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, or at least 99.9% sequence identity with SEQ ID No. 5, and has the biological function of the HNH domain; in one embodiment, the amino acid sequence of the HNH domain derived from *Tessaracoccus lapidicaptus* is identical to that of SEQ ID No. 5. Compared to No. 5, which has one or more amino acid substitutions, deletions, or additions, for example, substitutions, deletions, or additions of 1-20 amino acids, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 amino acid substitutions, deletions, or additions, and has the biological function of the HNH domain; preferably, the amino acid sequence of the HNH domain derived from Tessaracoccus lapidicaptus is as shown in SEQ ID No. 5.
[0015] In one embodiment, the HNH domain is an HNH domain derived from *Paraconexibacter algicola*; in one embodiment, the amino acid sequence of the HNH domain derived from *Paraconexibacter algicola* has at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, or at least 99.9% sequence identity with SEQ ID No. 6, and has the biological function of the HNH domain; in one embodiment, the amino acid sequence of the HNH domain derived from *Paraconexibacter algicola* is identical to that of SEQ ID No. 6. Compared to SEQ ID No. 6, this contains one or more amino acid substitutions, deletions, or additions, for example, substitutions, deletions, or additions of 1-20 amino acids, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 amino acid substitutions, deletions, or additions, and has the biological function of an HNH domain; preferably, the amino acid sequence of the HNH domain derived from Paraconexibacter algicola is as shown in SEQ ID No. 6.
[0016] In one embodiment, the HNH domain is an HNH domain derived from *Euzebya pacifica*; in one embodiment, the amino acid sequence of the HNH domain derived from *Euzebya pacifica* has at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, or at least 99.9% sequence identity with SEQ ID No. 7, and has the biological function of the HNH domain; in one embodiment, the amino acid sequence of the HNH domain derived from *Euzebya pacifica* is identical to that of SEQ ID No. 7. Compared to No. 7, which has one or more amino acid substitutions, deletions, or additions, for example, substitutions, deletions, or additions of 1-20 amino acids, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 amino acid substitutions, deletions, or additions, and has the biological function of the HNH domain; preferably, the amino acid sequence of the HNH domain derived from Euzebya pacifica is as shown in SEQ ID No. 7.
[0017] In one embodiment, the HNH domain is an HNH domain derived from Corynebacterium glutamicum; in one embodiment, the amino acid sequence of the HNH domain derived from Corynebacterium glutamicum has at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, or at least 99.9% sequence identity with SEQ ID No. 8, and has the biological function of the HNH domain; in one embodiment, the amino acid sequence of the HNH domain derived from Corynebacterium glutamicum is identical to that in SEQ ID No. 8. Compared to No. 8, which has one or more amino acid substitutions, deletions, or additions, for example, substitutions, deletions, or additions of 1-20 amino acids, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 amino acid substitutions, deletions, or additions, and has the biological function of the HNH domain; preferably, the amino acid sequence of the HNH domain derived from Corynebacterium glutamicum is as shown in SEQ ID No. 8.
[0018] In one embodiment, the HNH domain is an HNH domain derived from Mycobacterium tuberculosis; in one embodiment, the amino acid sequence of the HNH domain derived from Mycobacterium tuberculosis has at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, or at least 99.9% sequence identity with SEQ ID No. 9, and has the biological function of the HNH domain; in one embodiment, the amino acid sequence of the HNH domain derived from Mycobacterium tuberculosis is identical to that of SEQ ID No. 9. Compared to No. 9, which has one or more amino acid substitutions, deletions, or additions, for example, substitutions, deletions, or additions of 1-20 amino acids, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 amino acid substitutions, deletions, or additions, and has the biological function of the HNH domain; preferably, the amino acid sequence of the HNH domain derived from Mycobacterium tuberculosis is as shown in SEQ ID No. 9.
[0019] In one embodiment, the HNH domain is an HNH domain derived from *Eggerthia catenaformis*; in one embodiment, the amino acid sequence of the HNH domain derived from *Eggerthia catenaformis* has at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, or at least 99.9% sequence identity with SEQ ID No. 10, and has the biological function of the HNH domain; in one embodiment, the amino acid sequence of the HNH domain derived from *Eggerthia catenaformis* is identical to that of SEQ ID No. 10. Compared to No. 10, it has one or more amino acid substitutions, deletions, or additions, for example, substitutions, deletions, or additions of 1-20 amino acids, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 amino acid substitutions, deletions, or additions, and has the biological function of the HNH domain; preferably, the amino acid sequence of the HNH domain derived from Eggerthia catenaformis is as shown in SEQ ID No. 10.
[0020] In one embodiment, the HNH domain is an HNH domain derived from Flavobacterium phage 11b; in one embodiment, the amino acid sequence of the HNH domain derived from Flavobacterium phage 11b has at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, or at least 99.9% sequence identity with SEQ ID No. 11, and has the biological function of the HNH domain; in one embodiment, the amino acid sequence of the HNH domain derived from Flavobacterium phage 11b is identical to that of SEQ ID No. 11. Compared to No. 11, which has one or more amino acid substitutions, deletions, or additions, for example, substitutions, deletions, or additions of 1-20 amino acids, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 amino acid substitutions, deletions, or additions, and has the biological function of the HNH domain; preferably, the amino acid sequence of the HNH domain derived from Flavobacterium phage 11b is as shown in SEQ ID No. 11.
[0021] In one embodiment, the HNH domain is an HNH domain derived from Haliscomenobacter hydrossis; in one embodiment, the amino acid sequence of the HNH domain derived from Haliscomenobacter hydrossis has at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, or at least 99.9% sequence identity with SEQ ID No. 12, and has the biological function of the HNH domain; in one embodiment, the amino acid sequence of the HNH domain derived from Haliscomenobacter hydrossis is identical to that of SEQ ID No. 12. Compared to No. 12, it has one or more amino acid substitutions, deletions, or additions, for example, substitutions, deletions, or additions of 1-20 amino acids, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 amino acid substitutions, deletions, or additions, and has the biological function of the HNH domain; preferably, the amino acid sequence of the HNH domain derived from Haliscomenobacter hydrossis is as shown in SEQ ID No. 12.
[0022] In one embodiment, the amino acid sequence of the HNH domain has at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, or at least 99.9% sequence identity with SEQ ID No. 13, and has the biological function of the HNH domain; in one embodiment, the amino acid sequence of the HNH domain is similar to that of SEQ ID No. 13. Compared to No. 13, which has one or more amino acid substitutions, deletions, or additions, for example, substitutions, deletions, or additions of 1-20 amino acids, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 amino acid substitutions, deletions, or additions, and has the biological function of the HNH domain; preferably, the amino acid sequence of the HNH domain is as shown in SEQ ID No. 13.
[0023] In one embodiment, the HNH domain is an HNH domain derived from *Amphibacillus xylanus*; in one embodiment, the amino acid sequence of the HNH domain derived from *Amphibacillus xylanus* has at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, or at least 99.9% sequence identity with SEQ ID No. 14, and has the biological function of the HNH domain; in one embodiment, the amino acid sequence of the HNH domain derived from *Amphibacillus xylanus* is identical to that of SEQ ID No. 14. Compared to No. 14, which has one or more amino acid substitutions, deletions, or additions, for example, substitutions, deletions, or additions of 1-20 amino acids, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 amino acid substitutions, deletions, or additions, and has the biological function of the HNH domain; preferably, the amino acid sequence of the HNH domain derived from Amphibacillus xylanus is as shown in SEQ ID No. 14.
[0024] In one embodiment, the HNH domain is an HNH domain derived from *Rhodospirillum centenum*; in one embodiment, the amino acid sequence of the HNH domain derived from *Rhodospirillum centenum* has at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, or at least 99.9% sequence identity with SEQ ID No. 15, and has the biological function of the HNH domain; in one embodiment, the amino acid sequence of the HNH domain derived from *Rhodospirillum centenum* is identical to that of SEQ ID No. 15. Compared to ID No. 15, it has one or more amino acid substitutions, deletions, or additions, for example, substitutions, deletions, or additions of 1-20 amino acids, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 amino acid substitutions, deletions, or additions, and has the biological function of the HNH domain; preferably, the amino acid sequence of the HNH domain derived from Rhodospirillumcentenum is as shown in SEQ ID No. 15.
[0025] In one embodiment, the HNH domain is an HNH domain derived from *Amborella trichopoda*; in one embodiment, the amino acid sequence of the HNH domain derived from *Amborella trichopoda* has at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, or at least 99.9% sequence identity with SEQ ID No. 16, and has the biological function of the HNH domain; in one embodiment, the amino acid sequence of the HNH domain derived from *Amborella trichopoda* is identical to that of SEQ ID No. 16. Compared to No. 16, which has one or more amino acid substitutions, deletions, or additions, for example, substitutions, deletions, or additions of 1-20 amino acids, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 amino acid substitutions, deletions, or additions, and has the biological function of the HNH domain; preferably, the amino acid sequence of the HNH domain derived from Amborella trichopoda is as shown in SEQ ID No. 16.
[0026] In one embodiment, the HNH domain is an HNH domain derived from Glycine max; in one embodiment, the amino acid sequence of the HNH domain derived from Glycine max has at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, or at least 99.9% sequence identity with SEQ ID No. 17, and has the biological function of the HNH domain; in one embodiment, the amino acid sequence of the HNH domain derived from Glycine max is identical to that of SEQ ID No. 17. Compared to No. 17, which has one or more amino acid substitutions, deletions, or additions, for example, substitutions, deletions, or additions of 1-20 amino acids, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 amino acid substitutions, deletions, or additions, and has the biological function of the HNH domain; preferably, the amino acid sequence of the HNH domain derived from Glycine max is as shown in SEQ ID No. 17.
[0027] In one embodiment, the HNH domain is an HNH domain derived from Klebsormidium nitens; in one embodiment, the amino acid sequence of the HNH domain derived from Klebsormidium nitens has at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, or at least 99.9% sequence identity with SEQ ID No. 18, and has the biological function of the HNH domain; in one embodiment, the amino acid sequence of the HNH domain derived from Klebsormidium nitens is identical to that of SEQ ID No. 18. Compared to No. 18, it has one or more amino acid substitutions, deletions, or additions, for example, substitutions, deletions, or additions of 1-20 amino acids, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 amino acid substitutions, deletions, or additions, and has the biological function of the HNH domain; preferably, the amino acid sequence of the HNH domain derived from Klebsormidium nitens is as shown in SEQ ID No. 18.
[0028] In one embodiment, the HNH domain is an HNH domain derived from Salpingoeca rosetta; in one embodiment, the amino acid sequence of the HNH domain derived from Salpingoeca rosetta has at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, or at least 99.9% sequence identity with SEQ ID No. 19, and has the biological function of the HNH domain; in one embodiment, the amino acid sequence of the HNH domain derived from Salpingoeca rosetta is identical to that of SEQ ID No. 19. Compared to No. 19, it has one or more amino acid substitutions, deletions, or additions, for example, substitutions, deletions, or additions of 1-20 amino acids, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 amino acid substitutions, deletions, or additions, and has the biological function of the HNH domain; preferably, the amino acid sequence of the HNH domain derived from Salpingoeca rosetta is as shown in SEQ ID No. 19.
[0029] In one embodiment, the HNH domain is an HNH domain derived from Physcomitrium patens; in one embodiment, the amino acid sequence of the HNH domain derived from Physcomitrium patens has at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, or at least 99.9% sequence identity with SEQ ID No. 20, and has the biological function of the HNH domain; in one embodiment, the amino acid sequence of the HNH domain derived from Physcomitrium patens is identical to that of SEQ ID No. 20. Compared to No. 20, it has one or more amino acid substitutions, deletions, or additions, for example, substitutions, deletions, or additions of 1-20 amino acids, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 amino acid substitutions, deletions, or additions, and has the biological function of the HNH domain; preferably, the amino acid sequence of the HNH domain derived from Physcomitrium patens is as shown in SEQ ID No. 20.
[0030] In one embodiment, the HNH domain is an HNH domain derived from Ophiophagus hannah; in one embodiment, the amino acid sequence of the HNH domain derived from Ophiophagus hannah has at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, or at least 99.9% sequence identity with SEQ ID No. 21, and has the biological function of the HNH domain; in one embodiment, the amino acid sequence of the HNH domain derived from Ophiophagus hannah is identical to that of SEQ ID No. 21. Compared to No. 21, which has one or more amino acid substitutions, deletions, or additions, for example, substitutions, deletions, or additions of 1-20 amino acids, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 amino acid substitutions, deletions, or additions, and has the biological function of the HNH domain; preferably, the amino acid sequence of the HNH domain derived from Ophiophagus hannah is as shown in SEQ ID No. 21.
[0031] In one embodiment, the HNH domain is an HNH domain derived from *Symbiodinium microadriaticum*; in one embodiment, the amino acid sequence of the HNH domain derived from *Symbiodinium microadriaticum* has at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, or at least 99.9% sequence identity with SEQ ID No. 22, and has the biological function of the HNH domain; in one embodiment, the amino acid sequence of the HNH domain derived from *Symbiodinium microadriaticum* is identical to that of SEQ ID No. 22. Compared to SEQ ID No. 22, it has one or more amino acid substitutions, deletions, or additions, for example, substitutions, deletions, or additions of 1-20 amino acids, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 amino acid substitutions, deletions, or additions, and has the biological function of the HNH domain; preferably, the amino acid sequence of the HNH domain derived from Symbiodinium microadriaticum is as shown in SEQ ID No. 22.
[0032] In one embodiment, the HNH domain is an HNH domain derived from Bodo saltans; in one embodiment, the amino acid sequence of the HNH domain derived from Bodo saltans has at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, or at least 99.9% sequence identity with SEQ ID No. 23, and has the biological function of the HNH domain; in one embodiment, the amino acid sequence of the HNH domain derived from Bodo saltans is identical to that of SEQ ID No. 23. Compared to No. 23, which has one or more amino acid substitutions, deletions, or additions, for example, substitutions, deletions, or additions of 1-20 amino acids, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 amino acid substitutions, and has the biological function of an HNH domain; preferably, the amino acid sequence of the HNH domain derived from Bodo saltans is as shown in SEQ ID No. 23.
[0033] In one embodiment, the HNH domain is an HNH domain derived from *Agrococcus pavilionensis* RW1; in one embodiment, the amino acid sequence of the HNH domain derived from *Agrococcus pavilionensis* RW1 has at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, or at least 99.9% sequence identity with SEQ ID No. 24, and has the biological function of the HNH domain; in one embodiment, the amino acid sequence of the HNH domain derived from *Agrococcus pavilionensis* RW1 is identical to that of SEQ ID No. 24. Compared to ID No. 24, it has one or more amino acid substitutions, deletions, or additions, for example, substitutions, deletions, or additions of 1-20 amino acids, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 amino acid substitutions, deletions, or additions, and has the biological function of the HNH domain; preferably, the amino acid sequence of the HNH domain derived from Agrococcus pavilionensis RW1 is as shown in SEQ ID No. 24.
[0034] In one embodiment, the HNH domain is an HNH domain derived from Actinobacteria bacterium IMCC26256; in one embodiment, the amino acid sequence of the HNH domain derived from Actinobacteria bacterium IMCC26256 has at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, or at least 99.9% sequence identity with SEQ ID No. 25, and has the biological function of the HNH domain; in one embodiment, the amino acid sequence of the HNH domain derived from Actinobacteria bacterium IMCC26256 is identical to that of SEQ ID No. 25. Compared to No. 25, which has one or more amino acid substitutions, deletions, or additions, for example, substitutions, deletions, or additions of 1-20 amino acids, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 amino acid substitutions, deletions, or additions, and has the biological function of the HNH domain; preferably, the amino acid sequence of the HNH domain derived from Actinobacteria bacterium IMCC26256 is as shown in SEQ ID No. 25.
[0035] In one embodiment, the HNH domain is derived from the HNH domain of Eubacterium sp.; in one embodiment, the amino acid sequence of the HNH domain derived from Eubacterium sp. has at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, or at least 99.9% sequence identity with SEQ ID No. 26, and has the biological function of the HNH domain; in one embodiment, the amino acid sequence of the HNH domain derived from Eubacterium sp. is identical to that of SEQ ID No. 26. Compared to No. 26, which has one or more amino acid substitutions, deletions, or additions, for example, substitutions, deletions, or additions of 1-20 amino acids, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 amino acid substitutions, deletions, or additions, and has the biological function of the HNH domain; preferably, the amino acid sequence of the HNH domain derived from Eubacterium sp. is as shown in SEQ ID No. 26.
[0036] In one embodiment, the HNH domain is an HNH domain derived from *Zavarzinia aquatilis*; in one embodiment, the amino acid sequence of the HNH domain derived from *Zavarzinia aquatilis* has at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, or at least 99.9% sequence identity with SEQ ID No. 27, and has the biological function of the HNH domain; in one embodiment, the amino acid sequence of the HNH domain derived from *Zavarzinia aquatilis* is identical to that of SEQ ID No. 27. Compared to No. 27, which has one or more amino acid substitutions, deletions, or additions, for example, substitutions, deletions, or additions of 1-20 amino acids, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 amino acid substitutions, deletions, or additions, and has the biological function of the HNH domain; preferably, the amino acid sequence of the HNH domain derived from Zavarzinia aquatilis is as shown in SEQ ID No. 27.
[0037] In one embodiment, the HNH domain is an HNH domain derived from Oxalobacter formigenes; in one embodiment, the amino acid sequence of the HNH domain derived from Oxalobacter formigenes has at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, or at least 99.9% sequence identity with SEQ ID No. 28, and has the biological function of the HNH domain; in one embodiment, the amino acid sequence of the HNH domain derived from Oxalobacter formigenes is identical to that of SEQ ID No. 28. Compared to No. 28, which has one or more amino acid substitutions, deletions, or additions, for example, substitutions, deletions, or additions of 1-20 amino acids, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 amino acid substitutions, and has the biological function of the HNH domain; preferably, the amino acid sequence of the HNH domain derived from Oxalobacter formigenes is as shown in SEQ ID No. 28.
[0038] In one embodiment, the HNH domain has at least 80% sequence identity with any of SEQ ID No. 8-15, SEQ ID No. 17-26, or SEQ ID No. 28, and substantially retains the biological function of the HNH domain; or, the HNH domain has one or more amino acid substitutions, deletions, or additions compared to any of SEQ ID No. 8-15, SEQ ID No. 17-26, or SEQ ID No. 28, and substantially retains the biological function of the HNH domain.
[0039] In one embodiment, the amino acid sequence of the HNH domain is as shown in any one of SEQ ID No. 8-15, SEQ ID No. 17-26 or SEQ ID No. 28.
[0040] Preferably, the HNH domain has at least 80% sequence identity with any of SEQ ID No. 10-15, SEQ ID No. 18-19, SEQ ID No. 21-22, SEQ ID No. 24-26 or SEQ ID No. 28, and substantially retains the biological function of the HNH domain; or, the HNH domain has one or more amino acid substitutions, deletions or additions compared with any of SEQ ID No. 10-15, SEQ ID No. 18-19, SEQ ID No. 21-22, SEQ ID No. 24-26 or SEQ ID No. 28, and substantially retains the biological function of the HNH domain.
[0041] Preferably, the amino acid sequence of the HNH domain is as shown in any one of SEQ ID No. 10-15, SEQ ID No. 18-19, SEQ ID No. 21-22, SEQ ID No. 24-26 or SEQ ID No. 28.
[0042] The aforementioned "biological function with HNH domain" refers to the nuclease cleavage activity exhibited by having an HNH domain.
[0043] In one embodiment, the parental V-type Cas protein is wild-type Cas12j19 or a mutant Cas12j19 obtained by site-directed amino acid mutation.
[0044] In one embodiment, the parental V-type Cas protein is wild-type Cas12j19, whose amino acid sequence is shown in SEQ ID No. 29.
[0045] The wild-type Cas12j19 is described in Chinese patent CN111770992B, where it is named Cas12j.19. This application refers to it as Cas12j19.
[0046] In one embodiment, the amino acid sequence of the parental V-type Cas protein has at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, or at least 99.9% sequence identity with SEQ ID No. 29.
[0047] In one embodiment, the parental V-type Cas protein is a mutant Cas12j19 obtained by site-directed amino acid mutagenesis; the amino acid sequence of the parental V-type Cas protein, compared with SEQ ID No. 29, has one or more amino acid substitutions, deletions, or additions, for example, substitutions, deletions, or additions of 1-20 amino acids, or substitutions, deletions, or additions of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 amino acids.
[0048] Mutated Cas12j19 obtained by site-directed amino acid mutation can also serve as the parental type V Cas protein of this invention. For example, the Cas12j19 obtained by amino acid mutation is described in Chinese patent applications Nos. 2023100922319 and 2023110952452.
[0049] In one embodiment, the mutated Cas12j19 has a mutation at any one or more of the following amino acid sites in the amino acid sequence shown in SEQ ID No. 29: position 100, position 400, position 763, and position 45.
[0050] In one embodiment, the mutated Cas12j19 has mutations at the following amino acid sites in the amino acid sequence shown in SEQ ID No. 29: position 100, position 400, position 763, and position 45.
[0051] In one embodiment, the 100th amino acid is mutated to a non-E amino acid, such as A, V, G, L, S, F, W, Y, N, D, Q, K, M, T, C, P, H, R, I; preferably, it is mutated to K.
[0052] In one embodiment, the 400th amino acid is mutated to a non-S amino acid, such as A, V, G, Y, D, F, W, L, N, E, Q, K, M, T, C, P, H, R, I; preferably, it is mutated to R.
[0053] In one embodiment, the 763rd amino acid is mutated to a non-L amino acid, such as A, V, G, Y, D, F, W, S, N, E, Q, K, M, T, C, P, H, R, I; preferably, it is mutated to R.
[0054] In one embodiment, the 45th amino acid is mutated to a non-S amino acid, such as A, V, G, Y, D, F, W, L, N, E, Q, K, M, T, C, P, H, R, I; preferably, it is mutated to T.
[0055] In one embodiment, the HNH domain is positioned at the N-terminus of the parental V-type Cas protein.
[0056] In this invention, the HNH domain being located at the N-terminus of the parental V-type Cas protein can also be understood as the HNH domain being located between the first amino acid (usually methionine) and the second amino acid at the N-terminus of the parental V-type Cas protein; in some embodiments, the parental V-type Cas protein may not contain an N-terminal starting amino acid (e.g., methionine), in which case the HNH domain can be directly linked to the N-terminus of the parental V-type Cas protein, that is, the HNH domain is fused to the N-terminus of the parental V-type Cas protein.
[0057] In one embodiment, the HNH domain is positioned between the first and second amino acids at the N-terminus of the parental V-type Cas protein.
[0058] In one embodiment, the engineered V-type Cas protein of the present invention is selected from any group of I-III:
[0059] I. The engineered V-type Cas protein includes a parental V-type Cas protein and an HNH domain, wherein the HNH domain is located at the N-terminus of the parental V-type Cas protein;
[0060] The amino acid sequence of the parental type V Cas protein is as shown in SEQ ID No. 29, or the amino acid sequence of the parental type V Cas protein has at least 80% sequence identity with SEQ ID No. 29, or the amino acid sequence of the parental type V Cas protein has one or more amino acid substitutions, deletions, or additions compared with SEQ ID No. 29, or the parental type V Cas protein has mutations at any one or more of the following amino acid sites in the amino acid sequence shown in SEQ ID No. 29: position 100, position 400, position 763, and position 45;
[0061] II. Compared with the engineered V-type Cas protein described in I, it has at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity, and substantially retains the biological function of the engineered V-type Cas protein described in I;
[0062] III. Compared with the engineered V-type Cas protein described in I, it has one or more amino acid substitutions, deletions, or additions, for example, substitutions, deletions, or additions of 1-20 amino acids, or substitutions, deletions, or additions of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 amino acids; and it basically retains the biological functions of the engineered V-type Cas protein described in I.
[0063] The biological functions of the engineered V-Cas protein include those of the parental V-Cas protein, such as binding activity to guide RNA, endonuclease activity, or binding and cleaving activity to specific sites of the target sequence under the guidance of guide RNA (including but not limited to Cis cleavage activity and Trans cleavage activity); the biological functions of the engineered V-Cas protein also include the additional nuclease cleavage activity resulting from the fusion of the HNH domain.
[0064] Those skilled in the art will understand that the structure of a protein can be altered without adversely affecting its activity and function. For example, one or more conserved amino acid substitutions can be introduced into the amino acid sequence of a protein without adversely affecting the activity and / or three-dimensional structure of the protein molecule. Examples and implementations of conserved amino acid substitutions are familiar to those skilled in the art. Specifically, an amino acid residue can be substituted with another amino acid residue belonging to the same group as the site to be substituted, i.e., a nonpolar amino acid residue can replace another nonpolar amino acid residue, a polar uncharged amino acid residue can replace another polar uncharged amino acid residue, a basic amino acid residue can replace another basic amino acid residue, and an acidic amino acid residue can replace another acidic amino acid residue. Such substituted amino acid residues may or may not be encoded by the genetic code. Conservative substitutions, where an amino acid is replaced by another amino acid belonging to the same group, fall within the scope of this invention, as long as the substitution does not lead to the inactivation of the protein's biological activity. Therefore, the V-type Cas protein engineered by this invention can contain one or more conserved substitutions in its amino acid sequence, which are preferably generated by substitutions according to Table 1. In addition, the present invention also covers proteins that contain one or more other non-conservative substitutions, provided that such non-conservative substitutions do not significantly affect the desired function and biological activity of the proteins of the present invention.
[0065] Conserved amino acid substitutions can be performed at one or more predicted non-essential amino acid residues. “Non-essential” amino acid residues are those that can be altered (deleted, substituted, or replaced) without changing biological activity, while “essential” amino acid residues are required for biological activity. A “conserved amino acid substitution” is a substitution in which an amino acid residue is replaced by an amino acid residue with a similar side chain. Amino acid substitutions can be performed in the non-conserved regions of the engineered V-type Cas protein described above. Generally, such substitutions are not performed on conserved amino acid residues, or on amino acid residues located within conserved motifs, where such residues are required for protein activity. However, those skilled in the art will understand that functional variants may have fewer conserved or non-conserved alterations in conserved regions.
[0066] Table 1
[0067] The initial residues Representative substitution Preferred replacement Ala(A) Val; Leu; Ile Val Arg(R) Lys;Gln;Asn Lys Asn(N) Gln; His; Lys; Arg Gln Asp(D) Glu Glu Cys(C) Ser Ser Gln(Q) Asn Asn Glu(E) Asp Asp Gly(G) Pro; Ala Ala His(H) Asn; Gln; Lys; Arg Arg Ile(I) Leu; Val; Met; Ala; Phe Leu Leu(L) Ile; Val; Met; Ala; Phe Ile Lys(K) Arg;Gln;Asn Arg Met(M) Leu; Phe; Ile Leu Phe(F) Leu; Val; Ile; Ala; Tyr Leu Pro(P) Ala Ala Ser(S) Thr Thr Thr(T) Ser Ser Trp(W) Tyr; Phe Tyr Tyr(Y) Trp; Phe; Thr; Ser Phe Val(V) Ile; Leu; Met; Phe; Ala Leu
[0068] As is well known in the art, one or more amino acid residues can be altered (replaced, deleted, truncated, or inserted) from the N and / or C ends of a protein while retaining its functional activity. Therefore, proteins that have one or more amino acid residues altered from their N and / or C ends while retaining their desired functional activity are also within the scope of this invention. These alterations can include those introduced by modern molecular methods such as PCR, which includes PCR amplification that alters or lengthens the protein-coding sequence by means of oligonucleotides containing amino acid-coding sequences used in the PCR amplification.
[0069] It should be recognized that proteins can be altered in various ways, including amino acid substitutions, deletions, truncations, and insertions, and methods for such operations are generally known in the art. For example, amino acid sequence variants of the aforementioned proteins can be prepared by mutating DNA. This can also be accomplished through other forms of mutagenesis and / or directed evolution, for example, using known mutagenesis, recombination, and / or shuffling methods, combined with relevant screening methods, to perform single or multiple amino acid substitutions, deletions, and / or insertions.
[0070] Those skilled in the art will understand that these minor amino acid changes in the Cas protein of this invention can occur (e.g., naturally occurring mutations) or be generated (e.g., using r-DNA technology) without loss of protein function or activity. If these mutations occur in the catalytic domain, active site, or other functional domains of the protein, the properties of the polypeptide may be altered, but the polypeptide may retain its activity. If the mutations are not located near the catalytic domain, active site, or other functional domains, a smaller impact can be expected.
[0071] Those skilled in the art can identify the essential amino acids of the engineered V-type Cas protein of this invention using methods known in the art, such as localized mutagenesis, protein evolution, or bioinformatics analysis. The catalytic domains, active sites, or other functional domains of the protein can also be determined through physical structural analysis, such as by techniques like nuclear magnetic resonance, crystallography, electron diffraction, or photoaffinity labeling, combined with mutations in presumed key site amino acids.
[0072] In this invention, amino acid residues can be represented by a single letter or by three letters, for example: alanine (Ala, A), valine (Val, V), glycine (Gly, G), leucine (Leu, L), glutamic acid (Gln, Q), phenylalanine (Phe, F), tryptophan (Trp, W), tyrosine (Tyr, Y), aspartic acid (Asp, D), asparagine (Asn, N), glutamic acid (Glu, E), lysine (Lys, K), methionine (Met, M), serine (Ser, S), threonine (Thr, T), cysteine (Cys, C), proline (Pro, P), isoleucine (Ile, I), histidine (His, H), and arginine (Arg, R).
[0073] The term "AxxB" indicates that amino acid A at position xx is changed to amino acid B. For example, E100K means that E at position 100 is mutated to K. When multiple amino acid sites are mutated simultaneously, it can be expressed in a form similar to E100K-S400R. For example, E100K-S400R means that E at position 100 is mutated to K and S at position 400 is mutated to R.
[0074] The specific amino acid positions (numbers) within the protein described in this invention are determined using standard sequence alignment tools by comparing the amino acid sequence of the target protein with a reference amino acid sequence (e.g., SEQ ID No. 29), such as using the Smith-Waterman algorithm or the CLUSTALW2 algorithm. The sequence is considered aligned when the alignment score is the highest. The alignment score can be calculated according to the method described in Wilbur, WJ and Lipman, DJ (1983) Rapid similarity searches of nucleic acid and protein databanks. Proc. Natl. Acad. Sci. USA, 80:726-730. In the ClustalW2 (1.82) algorithm, the default parameters are preferably used: protein gap opening penalty = 10.0; protein gap extension penalty = 0.2; protein matrix = Gonnet; protein / DNA end gap = -1; protein / DNA GAPDIST = 4. The AlignX program (part of the vectorNTI group) is preferably used with default parameters suitable for multiple alignments (gap opening penalty: 10.0, gap extension penalty: 0.05) to determine the position of specific amino acids in the protein of the present invention by comparing the amino acid sequence of the protein with SEQ ID No. 29.
[0075] The present invention also provides a fusion protein comprising the engineered V-type Cas protein as described above and other modified portions.
[0076] In one embodiment, the modified portion is selected from other proteins or peptides, detectable markers, or any combination thereof.
[0077] In one embodiment, the modified portion is selected from epitope tags, reporter gene sequences, nuclear localization signal (NLS) sequences, targeting portions, transcriptional activation domains (e.g., VP64), transcriptional repression domains (e.g., KRAB or SID domains), nuclease domains (e.g., Fok1), and domains having activities selected from: nucleotide deaminases (e.g., adenosine deaminase or cytidine deaminase), methyltransferase activity, demethylase activity, transcriptional activation activity, transcriptional repression activity, transcriptional release factor activity, histone modification activity, nuclease activity, single-stranded RNA cleavage activity, double-stranded RNA cleavage activity, single-stranded DNA cleavage activity, double-stranded DNA cleavage activity, and nucleic acid binding activity; and any combination thereof. The NLS sequences are well known to those skilled in the art, and examples include, but are not limited to, the SV40 large T antigen, EGL-13, c-Myc, and TUS protein.
[0078] In one embodiment, the NLS sequence is located at, near, or close to the end (e.g., N-terminus, C-terminus, or both ends) of the Cas protein of the present invention.
[0079] The epitope tag is well known to those skilled in the art, including but not limited to His, V5, FLAG, HA, Myc, VSV-G, Trx, etc., and those skilled in the art can choose other suitable epitope tags (e.g., for purification, detection, or tracing).
[0080] The reporter gene sequences are well known to those skilled in the art, and examples include, but are not limited to, GST, HRP, CAT, GFP, HcRed, DsRed, CFP, YFP, BFP, etc.
[0081] In one embodiment, the fusion protein of the present invention includes a domain capable of binding to DNA molecules or intracellular molecules, such as maltose-binding protein (MBP), the DNA-binding domain (DBD) of Lex A, the DBD of GAL4, etc.
[0082] In one embodiment, the fusion protein of the present invention contains a detectable marker, such as a fluorescent dye, such as FITC or DAPI.
[0083] In one embodiment, the engineered V-type Cas protein of the present invention is optionally coupled, conjugated, or fused to the modified portion via a linker.
[0084] In one embodiment, the modified portion is directly connected to the N-terminus or C-terminus of the engineered V-type Cas protein of the present invention.
[0085] In one embodiment, the modified portion is attached to the N-terminus or C-terminus of the engineered V-type Cas protein of the present invention via a linker. Such linkers are well known in the art, and examples include, but are not limited to, linkers containing one or more (e.g., 1, 2, 3, 4, or 5) amino acids (e.g., Glu or Ser) or amino acid derivatives (e.g., Ahx, β-Ala, GABA, or Ava), or PEG, etc.
[0086] The engineered V-type Cas protein, protein derivative, or fusion protein of the present invention is not limited by its production method. For example, it can be produced by genetic engineering methods (recombinant technology) or by chemical synthesis methods. Engineering Nucleic acid of type V Cas protein
[0087] On the other hand, the present invention provides an isolated polynucleotide comprising:
[0088] (a) A multinucleotide sequence encoding the engineered V-type Cas protein or fusion protein of the present invention;
[0089] Alternatively, a polynucleotide complementary to the polynucleotide described in (a).
[0090] In one embodiment, the nucleotide sequence is codon-optimized for expression in prokaryotic cells. In another embodiment, the nucleotide sequence is codon-optimized for expression in eukaryotic cells.
[0091] In one embodiment, the cell is an animal cell, such as a mammalian cell.
[0092] In one embodiment, the cell is a human cell.
[0093] In one embodiment, the cell is a plant cell, such as the cell of a cultivated plant (e.g., cassava, corn, sorghum, wheat, or rice), algae, tree, or vegetable.
[0094] In one embodiment, the polynucleotide is preferably single-stranded or double-stranded.
[0095] Guide RNA (gRNA)
[0096] On the other hand, the present invention provides a gRNA comprising a first segment and a second segment; the first segment is also referred to as a "backbone region", "protein binding region", "protein binding sequence", or "direct repeat sequence"; the second segment is also referred to as a "target sequence for targeting nucleic acids", "target segment for targeting nucleic acids", or "guide sequence for targeting target sequences".
[0097] The first segment of the gRNA can interact with the Cas protein of the present invention, thereby enabling the Cas protein and gRNA to form a complex.
[0098] In a preferred embodiment, the first segment is a repeating sequence in the same direction as described above.
[0099] The target sequence or target region of the nucleic acid targeted by this invention comprises a nucleotide sequence complementary to a sequence in the target nucleic acid. In other words, the target sequence or target region of the nucleic acid targeted by this invention interacts with the target nucleic acid in a sequence-specific manner through hybridization (i.e., base pairing). Therefore, the target sequence or target region of the nucleic acid can be altered or modified to hybridize with any desired sequence within the target nucleic acid. The nucleic acid is selected from DNA or RNA.
[0100] The percentage of complementarity between the target sequence or target region of the target nucleic acid and the target sequence of the target nucleic acid may be at least 60% (e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100%).
[0101] The "backbone region," "protein-binding region," "protein-binding sequence," or "direct repeat sequence" of the gRNA of this invention can interact with CRISPR proteins (or Cas proteins). The gRNA of this invention guides the interacting Cas protein to a specific nucleotide sequence within the target nucleic acid through the targeting sequence of the target nucleic acid.
[0102] Preferably, the guide RNA comprises a first segment and a second segment in the 5' to 3' direction.
[0103] In this invention, the second segment can also be understood as a guide sequence for hybridization with the target sequence.
[0104] The gRNA of the present invention can form a complex with the Cas protein.
[0105] carrier
[0106] The present invention also provides a carrier comprising an engineered V-type Cas protein, an isolated nucleic acid molecule, or a polynucleotide as described above; preferably, it further comprises a regulatory element operatively linked thereto.
[0107] In one embodiment, the regulatory element is selected from one or more of the following: enhancers, transposons, promoters, terminators, leader sequences, polyadenylation sequences, and marker genes.
[0108] In one embodiment, the vector includes a cloning vector, an expression vector, a shuttle vector, and an integration vector.
[0109] In some implementations, the vectors included in the system are viral vectors (e.g., retroviral vectors, lentiviral vectors, adenovirus vectors, adeno-associated vectors, and herpes simplex vectors), and may also be plasmids, viruses, granules, bacteriophages, etc., which are well known to those skilled in the art.
[0110] CRISPR system
[0111] The present invention provides an engineered, non-naturally occurring vector system, or a CRISPR-Cas system, comprising an engineered V-Cas protein or a nucleic acid sequence encoding the engineered V-Cas protein and a nucleic acid encoding one or more guide RNAs.
[0112] In one embodiment, the nucleic acid sequence encoding the engineered V-type Cas protein and the nucleic acid encoding one or more guide RNAs are artificially synthesized.
[0113] In one embodiment, the nucleic acid sequence encoding the engineered V-type Cas protein and the nucleic acid encoding one or more guide RNAs do not coexist naturally.
[0114] The one or more guide RNAs target one or more target sequences in the cell. The one or more target sequences hybridize to the genomic loci of a DNA molecule encoding one or more gene products and guide the Cas protein to the genomic locus of the DNA molecule of the one or more gene products. Once the Cas protein reaches the target sequence location, it modifies, edits, or cuts the target sequence, thereby altering or modifying the expression of the one or more gene products.
[0115] The cells of this invention include one or more of animals, plants, or microorganisms.
[0116] In some embodiments, the Cas protein is codon-optimized for expression in cells.
[0117] In some embodiments, the Cas protein directs cleavage of one or both strands at the target sequence location.
[0118] The present invention also provides an engineered, non-naturally occurring carrier system, which may include one or more carriers, the one or more carriers comprising:
[0119] a) A first regulatory element, which is operatively linked to the gRNA.
[0120] b) A second regulatory element operatively linked to the Cas protein;
[0121] Components (a) and (b) are located on the same or different carriers in the system.
[0122] The first and second regulatory elements include promoters (e.g., constitutive or inducible promoters), enhancers (e.g., 35S promoters or 35S enhanced promoters), internal ribosome entry sites (IRES), and other expression control elements (e.g., transcription termination signals, such as polyadenylation signals and polyU sequences).
[0123] In some implementations, the vector in the system is a viral vector (e.g., a retroviral vector, lentiviral vector, adenovirus vector, adeno-associated vector, and herpes simplex vector), or it can be a plasmid, virus, granule, bacteriophage, or other type known to those skilled in the art.
[0124] In some embodiments, the system provided herein is a delivery system. In some embodiments, the delivery system is a nanoparticle, liposome, exosome, microbubble, or gene gun.
[0125] In one embodiment, the target sequence is a DNA or RNA sequence derived from prokaryotic or eukaryotic cells. In another embodiment, the target sequence is a non-naturally occurring DNA or RNA sequence.
[0126] In one embodiment, the target sequence is present within the cell. In another embodiment, the target sequence is present in the cell nucleus or cytoplasm (e.g., organelles). In one embodiment, the cell is a eukaryotic cell. In other embodiments, the cell is a prokaryotic cell.
[0127] In one embodiment, the Cas protein is linked to one or more NLS sequences. In one embodiment, the fusion protein comprises one or more NLS sequences. In one embodiment, the NLS sequence is linked to the N-terminus or C-terminus of the protein. In one embodiment, the NLS sequence is fused to the N-terminus or C-terminus of the protein.
[0128] On the other hand, the present invention relates to an engineered CRISPR system comprising the aforementioned Cas protein and one or more guide RNAs, wherein the guide RNA comprises a homologous repeat sequence and a spacer sequence capable of hybridizing with a target nucleic acid, and the Cas protein is capable of binding the guide RNA and targeting a target nucleic acid sequence complementary to the spacer sequence.
[0129] Protein-nucleic acid complexes / compositions
[0130] On the other hand, the present invention provides a complex or composition comprising:
[0131] (i) Protein components selected from: the engineered V-type Cas protein, derived protein, or fusion protein described above, and any combination thereof; and
[0132] (ii) A nucleic acid component comprising (a) a guide sequence capable of hybridizing with a target sequence; and (b) a unidirectional repeat sequence capable of binding to the engineered V-type Cas protein of the present invention.
[0133] The protein components and nucleic acid components combine to form a complex.
[0134] In one embodiment, the nucleic acid component is a guide RNA in a CRISPR-Cas system.
[0135] In one embodiment, the complex or composition is non-natural or modified. In one embodiment, at least one component of the complex or composition is non-natural or modified. In one embodiment, the first component is non-natural or modified; and / or, the second component is non-natural or modified.
[0136] Activated CRISPR complex
[0137] On the other hand, the present invention also provides an activated CRISPR complex comprising: (1) a protein component selected from: the engineered V-type Cas protein, derived protein, or fusion protein of the present invention, and any combination thereof; (2) a gRNA comprising (a) a guide sequence capable of hybridizing with a target sequence; and (b) a homologous repeat sequence capable of binding to the Cas protein of the present invention; and (3) a target sequence bound to the gRNA. Preferably, the binding is a binding between the target sequence of the target nucleic acid on the gRNA and the target nucleic acid.
[0138] The term “activated CRISPR complex”, “activated complex”, or “ternary complex” used in this article refers to the complex formed by the binding or modification of the Cas protein, gRNA, and target nucleic acid in the CRISPR system.
[0139] The Cas protein and gRNA of this invention can form a binary complex, which is activated upon binding to a nucleic acid substrate to form an activated CRISPR complex. The nucleic acid substrate is complementary to the spacer sequence (or, in other words, the guide sequence for hybridization with the target nucleic acid) in the gRNA. In some embodiments, the spacer sequence of the gRNA perfectly matches the target substrate. In other embodiments, the spacer sequence of the gRNA partially (continuously or discontinuously) matches the target substrate.
[0140] In a preferred embodiment, the activated CRISPR complex can exhibit side-branch nuclease cleavage activity, which refers to the non-specific or random cleavage activity of the activated CRISPR complex on single-stranded nucleic acids, also known in the art as trans cleavage activity.
[0141] Delivery and delivery composition
[0142] The engineered V-type Cas proteins, gRNAs, fusion proteins, nucleic acid molecules, vectors, systems, complexes, and compositions of this invention can be delivered by any method known in the art. Such methods include, but are not limited to, electroporation, lipid transfection, nuclear transfection, microinjection, acoustic pore effect, gene gun, calcium phosphate-mediated transfection, cationic transfection, liposome transfection, dendritic transfection, heat shock transfection, nuclear transfection, magnetic transfection, lipid transfection, puncture transfection, optical transfection, reagent-enhanced nucleic acid uptake, and delivery via liposomes, immunoliposomes, viral particles, artificial viruses, etc.
[0143] Therefore, in another aspect, the present invention provides a delivery composition comprising a delivery vector and selected from one or more of the following: engineered V-type Cas proteins, fusion proteins, nucleic acid molecules, vectors, systems, complexes and compositions of the present invention.
[0144] In one embodiment, the delivery carrier is a particle.
[0145] In one embodiment, the delivery vector is selected from lipid particles, sugar particles, metal particles, protein particles, liposomes, exosomes, microvesicles, gene guns, or viral vectors (e.g., replication-defective retroviruses, lentiviruses, adenoviruses, or adeno-associated viruses).
[0146] host cells
[0147] The present invention also relates to an in vitro, ex vivo, or in vivo cell or cell line or its progeny comprising: an engineered V-type Cas protein, a fusion protein, a nucleic acid molecule, a protein-nucleic acid complex, an activated CRISPR complex, a vector, or the delivery composition of the present invention.
[0148] In some implementations, the cell is a prokaryotic cell.
[0149] In some embodiments, the cell is a eukaryotic cell. In some embodiments, the cell is a mammalian cell. In some embodiments, the cell is a human cell. In some embodiments, the cell is a non-human mammalian cell, such as cells of non-human primates, cattle, sheep, pigs, dogs, monkeys, rabbits, or rodents (e.g., rats or mice). In some embodiments, the cell is a non-mammalian eukaryotic cell, such as cells of poultry (e.g., chickens), fish, or crustaceans (e.g., clams, shrimp). In some embodiments, the cell is a plant cell, such as cells of monocotyledonous or dicotyledonous plants, or cells of cultivated plants or food crops such as cassava, corn, sorghum, soybeans, wheat, oats, or rice, such as algae, trees, or productive plants, fruits, or vegetables (e.g., trees such as citrus trees, nut trees; nightshade plants, cotton, tobacco, tomatoes, grapes, coffee, cocoa, etc.).
[0150] In some implementations, the cell is a stem cell or stem cell line.
[0151] In some cases, the host cells of the present invention contain genetic or genomic modifications that are not present in their wild type.
[0152] Gene editing methods and applications
[0153] The engineered V-type Cas protein, nucleic acid, the above-described composition, the above-described CRISPR / Cas system, the above-described vector system, the above-described delivery composition, or the above-described activated CRISPR complex or the above-described host cell of the present invention can be used for any or more of the following purposes: targeting and / or editing target nucleic acids; cleaving double-stranded DNA, single-stranded DNA, or single-stranded RNA; non-specifically cleaving and / or degrading side-branched nucleic acids; non-specifically cleaving single-stranded nucleic acids; nucleic acid detection; detecting nucleic acids in target samples; specifically editing double-stranded nucleic acids; base editing double-stranded nucleic acids; base editing single-stranded nucleic acids. In other embodiments, they can also be used to prepare reagents or kits for any or more of the above purposes.
[0154] The present invention also provides the use of the above-engineered V-type Cas protein, nucleic acid, the above-described composition, the above-described CRISPR / Cas system, the above-described vector system, the above-described delivery composition, or the above-described activated CRISPR complex in gene editing, gene targeting, or gene cutting; or, in the preparation of reagents or kits for gene editing, gene targeting, or gene cutting.
[0155] In one embodiment, the gene editing, gene targeting, or gene cutting is performed intracellularly and / or extracellularly.
[0156] The present invention also provides a method for editing, targeting, or cleaving a target nucleic acid, the method comprising contacting the target nucleic acid with the engineered V-type Cas protein, nucleic acid, the composition, the CRISPR / Cas system, the vector system, the delivery composition, or the activated CRISPR complex. In one embodiment, the method comprises editing, targeting, or cleaving the target nucleic acid intracellularly or extracellularly.
[0157] The gene editing or editing of target nucleic acids includes modifying genes, knocking out genes, altering the expression of gene products, repairing mutations, and / or inserting polynucleotides, and gene mutations.
[0158] The editing can be performed in prokaryotic and / or eukaryotic cells.
[0159] On the other hand, the present invention also provides the use of the above-described engineered V-type Cas protein, nucleic acid, the above-described composition, the above-described CIRSPR / Cas system, the above-described carrier system, the above-described delivery composition, or the above-described activated CRISPR complex in nucleic acid detection, or in the preparation of reagents or kits for nucleic acid detection.
[0160] On the other hand, the present invention also provides a method for cleaving single-stranded nucleic acids, the method comprising contacting a nucleic acid population with the aforementioned engineered V-type Cas protein and gRNA, wherein the nucleic acid population comprises a target nucleic acid and a plurality of non-target single-stranded nucleic acids, and the engineered V-type Cas protein cleaves the plurality of non-target single-stranded nucleic acids.
[0161] The gRNA can bind to the Cas protein.
[0162] The gRNA can target the target nucleic acid.
[0163] The contact can be outside the body, outside the body, or inside the cells within the body.
[0164] Preferably, the cleavage of the single-stranded nucleic acid is non-specific.
[0165] On the other hand, the present invention also provides the use of the above-described engineered V-type Cas protein, nucleic acid, the above-described composition, the above-described CIRSPR / Cas system, the above-described vector system, the above-described delivery composition, or the above-described activated CRISPR complex in the non-specific cleavage of single-stranded nucleic acids, or in the preparation of reagents or kits for the non-specific cleavage of single-stranded nucleic acids.
[0166] On the other hand, the present invention also provides a kit for gene editing, gene targeting or gene cutting, the kit comprising the above-described engineered type V Cas protein, gRNA, nucleic acid, the above-described composition, the above-described CIRSPR / Cas system, the above-described vector system, the above-described delivery composition, the above-described activated CRISPR complex or the above-described host cell.
[0167] On the other hand, the invention provides the use of the above-described engineered type V Cas protein, nucleic acid, the above-described composition, the above-described CRISPR / Cas system, the above-described vector system, the above-described delivery composition, the above-described activated CRISPR complex, or the above-described host cell in the preparation of formulations or kits, said formulations or kits being used for:
[0168] (i) Gene or genome editing;
[0169] (ii) Target nucleic acid detection and / or diagnosis;
[0170] (iii) Editing target sequences in target loci to modify biological or non-human organisms;
[0171] (iv) Treatment of the disease;
[0172] (iv) Targeting target genes.
[0173] Preferably, the above-mentioned gene or genome editing is performed intracellularly or extracellularly.
[0174] Preferably, the target nucleic acid detection and / or diagnosis is performed in vitro.
[0175] Preferably, the treatment of the disease is to treat symptoms caused by defects in the target sequence at the target locus.
[0176] Methods for specifically modifying target nucleic acids
[0177] On the other hand, the present invention also provides a method for specifically modifying target nucleic acids, the method comprising: contacting the target nucleic acid with the above-described engineered V-type Cas protein, nucleic acid, the above-described composition, the above-described CIRSPR / Cas system, the above-described vector system, the above-described delivery composition, or the above-described activated CRISPR complex.
[0178] This specific modification can occur in vivo or in vitro.
[0179] This specific modification can occur either inside or outside the cell.
[0180] In some cases, the cells are selected from prokaryotic or eukaryotic cells, such as animal cells, plant cells, or microbial cells.
[0181] In one embodiment, the modification refers to a break in the target sequence, such as a single-strand / double-strand break in DNA or a single-strand break in RNA.
[0182] In some cases, the method further includes contacting the target nucleic acid with a donor polynucleotide, wherein the donor polynucleotide, a portion of the donor polynucleotide, a copy of the donor polynucleotide, or a portion of a copy of the donor polynucleotide is integrated into the target nucleic acid.
[0183] In one embodiment, the modification further includes inserting an editing template (e.g., exogenous nucleic acid) into the break.
[0184] In one embodiment, the method further includes contacting the editing template with the target nucleic acid or delivering it to a cell containing the target nucleic acid. In this embodiment, the method repairs the broken target gene by homologous recombination with a foreign template polynucleotide; in some embodiments, the repair results in a mutation, including the insertion, deletion, or substitution of one or more nucleotides of the target gene; in other embodiments, the mutation results in a change in one or more amino acids in a protein expressed from a gene containing the target sequence.
[0185] HNH domain and its applications
[0186] On the other hand, the present invention also provides an HNH structural domain.
[0187] In one embodiment, the HNH domain is selected from one or any of the following: an HNH domain derived from *Desulfococcus multivorans* DSM 2059, an HNH domain derived from *Delta proteobacterium NaphS2*, an HNH domain derived from *Candidatus Competibacter denitrificans* Run_A_D11, an HNH domain derived from *Rhodococcus sp.*, an HNH domain derived from *Tessaracoccus lapidicaptus*, an HNH domain derived from *Paraconexibacter algicola*, an HNH domain derived from *Euzebya pacifica*, an HNH domain derived from *Corynebacterium glutamicum*, an HNH domain derived from *Mycobacterium tuberculosis*, an HNH domain derived from *Eggerthia catenaformis*, an HNH domain derived from *Flavobacterium phage 11b*, and an HNH domain derived from *Haliscomenobacter*. HNH domains derived from *H. hydrossis*, *Amphibacillus xylanus*, *Rhodospirillum centenum*, *Amborella trichopoda*, *Glycine max*, *Klebsormidium nitens*, *Salpingoeca rosetta*, *Physcomitrium patens*, *Ophiophagus hannah*, *Symbiodinium microadriaticum*, *Bodo saltans*, *Agrococcus pavilionensis RW1*, *Actinobacteria bacterium IMCC26256*, and *Eubacterium*. The HNH domain of sp., the HNH domain derived from Zavarzinia aquatilis, or the HNH domain derived from Oxalobacter formigenes.
[0188] Alternatively, the HNH domain has at least 80% sequence identity with any of the sequences SEQ ID No. 8-15, SEQ ID No. 17-26 or SEQ ID No. 28, and substantially retains the biological function of the HNH domain derived from the sequence;
[0189] Alternatively, the HNH domain may have one or more amino acid substitutions, deletions, or additions compared to any of the sequences SEQ ID No. 8-15, SEQ ID No. 17-26, or SEQ ID No. 28, and substantially retain the biological function of the HNH domain derived from the sequence.
[0190] This invention also provides the application of the above-mentioned HNH domain in improving the editing efficiency of Cas protein.
[0191] This invention also provides the application of the above-mentioned HNH domain in the preparation of Cas proteins with improved editing efficiency.
[0192] In one embodiment, the Cas protein is a type V Cas protein; preferably, the type V Cas protein is selected from Cas12j19.
[0193] In one embodiment, the HNH domain is placed at the N-terminus of the Cas protein, thereby improving the editing efficiency of the Cas protein.
[0194] In one embodiment, the amino acid sequence of the Cas protein has at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, or at least 99.9% sequence identity with SEQ ID No. 29.
[0195] In one embodiment, the amino acid sequence of the Cas protein, compared with SEQ ID No. 29, has one or more amino acid substitutions, deletions, or additions, for example, substitutions, deletions, or additions of 1-20 amino acids, or substitutions, deletions, or additions of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 amino acids.
[0196] Terminology Definition
[0197] In this invention, unless otherwise stated, the scientific and technical terms used herein have the meanings commonly understood by those skilled in the art. Furthermore, the operational steps used herein, such as molecular genetics, nucleic acid chemistry, chemistry, molecular biology, biochemistry, cell culture, microbiology, cell biology, genomics, and recombinant DNA, are all conventional steps widely used in their respective fields. To better understand this invention, definitions and explanations of relevant terms are provided below.
[0198] Nucleic acid cleavage or cleavage of nucleic acids as used herein includes: DNA or RNA breaks in target nucleic acids generated by the engineered V-type Cas protein described herein (Cis cleavage), and DNA or RNA breaks in side-branched nucleic acid substrates (single-stranded nucleic acid substrates) (i.e., nonspecific or non-targeted, trans cleavage). In some embodiments, the cleavage is a double-stranded DNA break. In some embodiments, the cleavage is a single-stranded DNA break or a single-stranded RNA break.
[0199] CRISPR system
[0200] As used herein, the terms “regularly clustered short palindromic repeats (CRISPR)-CRISPR-related (Cas) (CRISPR-Cas) system” or “CRISPR system” are used interchangeably and have the meaning commonly understood by those skilled in the art, which typically includes transcripts or other elements relating to the expression of CRISPR-related (“Cas”) genes, or transcripts or other elements capable of directing the activity of said Cas genes.
[0201] CRISPR / Cas complex
[0202] As used herein, the term “CRISPR / Cas complex” refers to a complex formed by the binding of guide RNA or mature crRNA to the Cas protein, which contains a guide sequence that hybridizes to the target sequence and a homologous repeat sequence that binds to the Cas protein. This complex is capable of recognizing and cleaving polynucleotides that hybridize with the guide RNA or mature crRNA.
[0203] Guide RNA (gRNA)
[0204] As used herein, the terms “guide RNA (gRNA),” “mature crRNA,” and “guide sequence” are used interchangeably and have the meanings commonly understood by those skilled in the art. Generally, guide RNA may comprise a direct repeat sequence and a guide sequence, or consist substantially of or composed of a direct repeat sequence and a guide sequence.
[0205] In some cases, the guide sequence is any polynucleotide sequence that is sufficiently complementary to the target sequence to hybridize with the target sequence and guide the specific binding of the CRISPR / Cas complex to the target sequence. In one embodiment, the complementarity between the guide sequence and its corresponding target sequence is at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% when optimal alignment is achieved. Determining the optimal alignment is within the capabilities of a person skilled in the art. For example, publicly available and commercially available alignment algorithms and programs exist, such as, but not limited to, ClustalW, the Smith-Waterman algorithm in MATLAB, Bowtie, Geneious, Biopython, and SeqMan.
[0206] target sequence
[0207] A "target sequence" refers to a polynucleotide targeted by a guide sequence in the gRNA, such as a sequence complementary to that guide sequence, where hybridization between the target and guide sequences will promote the formation of a CRISPR / Cas complex (including the Cas protein and gRNA). Perfect complementarity is not required, as long as sufficient complementarity exists to induce hybridization and promote the formation of a CRISPR / Cas complex.
[0208] The target sequence can contain any polynucleotide, such as DNA or RNA. In some cases, the target sequence is located inside or outside the cell. In some cases, the target sequence is located in the cell nucleus or cytoplasm. In some cases, the target sequence may be located in an organelle of a eukaryotic cell, such as a mitochondrion or chloroplast. The sequence or template that can be used for recombination into a target locus containing the target sequence is referred to as an "edit template," "edit polynucleotide," or "edit sequence." In one embodiment, the edit template is a foreign nucleic acid. In one embodiment, the recombination is homologous recombination.
[0209] In this invention, the "target sequence," "target polynucleotide," or "target nucleic acid" can be any endogenous or exogenous polynucleotide for a cell (e.g., a eukaryotic cell). For example, the target polynucleotide can be a polynucleotide present in the nucleus of a eukaryotic cell. The target polynucleotide can be a sequence encoding a gene product (e.g., a protein) or a non-coding sequence (e.g., a regulatory polynucleotide or useless DNA). In some cases, the target sequence should be associated with a protospacer adjacent motif (PAM).
[0210] wild type
[0211] As used herein, the term “wildtype” has the meaning commonly understood by those skilled in the art as referring to the typical form of an organism, strain, or gene, or the characteristic that distinguishes it from mutant or variant forms when it exists in nature, is separable from its natural source and has not been intentionally modified by humans.
[0212] Derivatization
[0213] As used herein, the term "derivation" refers to the chemical modification of an amino acid, polypeptide, or protein in which one or more substituents are covalently linked to the amino acid, polypeptide, or protein. Substituents may also be referred to as side chains.
[0214] A derivatized protein is a derivative of the original protein. Generally, the derivatization of a protein does not adversely affect its desired activity (e.g., activity to bind to guide RNA, endonuclease activity, activity to bind to and cleave a target sequence at a specific site under the guidance of guide RNA). In other words, the derivative of a protein has the same activity as the original protein.
[0215] Derivatized proteins
[0216] Also known as "protein derivatives," these are modified forms of proteins, where one or more amino acids of the protein may be deleted, inserted, modified, and / or substituted.
[0217] Not naturally occurring
[0218] As used herein, the terms “non-naturally occurring” or “engineered” are used interchangeably and indicate artificial involvement. When these terms are used to describe nucleic acid molecules or peptides, they indicate that the nucleic acid molecule or peptide is at least substantially free from at least one other component bound to it, either naturally occurring or found in nature.
[0219] Orthologue (ortholog)
[0220] As used herein, the term "orthologue" has the meaning commonly understood by those skilled in the art. As further guidance, an "orthologue" of a protein, as described herein, refers to a protein belonging to a different species that performs the same or similar function as the protein that is its orthologue.
[0221] identity
[0222] As used herein, the term "identity" refers to the sequence matching between two polypeptides or two nucleic acids. Two compared sequences are identical at a position when the same base or amino acid monomeric subunit occupies the same location (e.g., a position in each of two DNA molecules is occupied by adenine, or a position in each of two polypeptides is occupied by lysine). The "percentage identity" between two sequences is a function of the number of matching positions shared by the two sequences divided by the number of positions compared × 100. For example, if six out of ten positions in two sequences match, then the two sequences have 60% identity. For example, the DNA sequences CTGACT and CAGGTT share 50% identity (three out of six positions match). Typically, two sequences are compared to produce the maximum identity. Such comparisons can be made using methods readily available, for example, computer programs such as the Align program (DNAstar, Inc.) Needleman et al. (1970) J. Mol. Biol. 48: 443-453. The percentage identity between two amino acid sequences can also be determined using the algorithm of E. Meyers and W. Miller (Comput. Appl Biosci., 4:11-17 (1988)) integrated into the ALIGN program (version 2.0), which uses a PAM120 weight residue table, a gap length penalty of 12, and a gap penalty of 4. Alternatively, the percentage identity between two amino acid sequences can be determined using the Needleman and Wunsch algorithm (J MoIBiol. 48:444-453 (1970)) in the GAP program integrated into the GCG software package (available at www.gcg.com), which uses a Blossum 62 matrix or a PAM250 matrix, along with gap weights of 16, 14, 12, 10, 8, 6, or 4, and length weights of 1, 2, 3, 4, 5, or 6.
[0223] carrier
[0224] The term "vector" refers to a nucleic acid molecule capable of delivering another nucleic acid molecule linked to it. Vectors include, but are not limited to, single-stranded, double-stranded, or partially double-stranded nucleic acid molecules; nucleic acid molecules including one or more free ends, or without free ends (e.g., circular); nucleic acid molecules including DNA, RNA, or both; and a wide variety of other polynucleotides known in the art. A vector can be introduced into a host cell through transformation, transduction, or transfection, thereby enabling the expression of its carried genetic material elements in the host cell. A vector can be introduced into a host cell to produce transcripts, proteins, or peptides, including proteins, fusion proteins, isolated nucleic acid molecules, etc., as described herein (e.g., CRISPR transcripts, such as nucleic acid transcripts, proteins, or enzymes). A vector may contain a variety of elements controlling expression, including, but not limited to, promoter sequences, transcription initiation sequences, enhancer sequences, selection elements, and reporter genes. Additionally, the vector may contain a replication initiation site.
[0225] One type of vector is a "plasmid," which is a circular double-stranded DNA loop into which another DNA fragment can be inserted, for example, using standard molecular cloning techniques.
[0226] Another type of vector is the viral vector, in which a virus-derived DNA or RNA sequence is present in a vector used to package the virus (e.g., retroviruses, replication-defective retroviruses, adenoviruses, replication-defective adenoviruses, and adeno-associated viruses). Viral vectors also contain polynucleotides carried by the virus used for transfection into a host cell. Some vectors (e.g., bacterial vectors with bacterial origins of replication and episodic mammalian vectors) are capable of autonomous replication in the host cells into which they are introduced.
[0227] Other vectors (e.g., non-attachment mammalian vectors) integrate into the host cell's genome upon introduction and thereby replicate along with the host genome. Furthermore, some vectors are capable of directing the expression of genes they are operatively linked to. Such vectors are referred to herein as "expression vectors."
[0228] host cells
[0229] As used herein, the term “host cell” refers to a cell that can be used to introduce a vector, including but not limited to prokaryotic cells such as Escherichia coli or Bacillus subtilis, and eukaryotic cells such as microbial cells, fungal cells, animal cells, and plant cells.
[0230] Those skilled in the art will understand that the design of expression vectors can depend on factors such as the selection of host cells to be transformed and the desired expression level.
[0231] Control element
[0232] As used herein, the term "regulatory element" is intended to include promoters, enhancers, internal ribosome entry sites (IRES), and other expression control elements (e.g., transcription termination signals such as polyadenylation signals and poly-U sequences), for which detailed description can be found in Goeddel, *Gene Expression Technology: Methods in Enzymology*, 185, Academic Press, San Diego, California (1990). In some cases, regulatory elements include those sequences that direct constitutive expression of a nucleotide sequence in many types of host cells and those sequences that direct expression of that nucleotide sequence only in certain host cells (e.g., tissue-specific regulatory sequences). Tissue-specific promoters can primarily direct expression in the desired tissue of interest, such as muscle, neurons, bone, skin, blood, specific organs (e.g., liver, pancreas), or specific cell types (e.g., lymphocytes). In some cases, regulatory elements can also be directed to express in a time-dependent manner (such as in a cell cycle-dependent or developmental stage-dependent manner), which may or may not be tissue or cell type specific. In some cases, the term "regulatory element" covers enhancer elements such as WPRE; CMV enhancer; R-U5' fragment in the LTR of HTLV-I (Mol. Cell. Biol., Vol. 8(1), pp. 466-472, 1988); SV40 enhancer; and intron sequence between exons 2 and 3 of rabbit β-globin (Proc. Natl. Acad. Sci. USA., Vol. 78(3), pp. 1527-31, 1981).
[0233] promoter
[0234] As used herein, the term "promoter" has the meaning known to those skilled in the art, referring to a non-coding nucleotide sequence located upstream of a gene that initiates the expression of a downstream gene. A constitutive promoter is a nucleotide sequence that, when operably linked to a polynucleotide encoding or defining a gene product, results in the production of the gene product in the cell under most or all physiological conditions of the cell. An inducible promoter is a nucleotide sequence that, when operably linked to a polynucleotide encoding or defining a gene product, results in the production of the gene product in the cell substantially only when an inducer corresponding to the promoter is present in the cell. A tissue-specific promoter is a nucleotide sequence that, when operably linked to a polynucleotide encoding or defining a gene product, results in the production of the gene product in the cell substantially only when the cell is a cell of the tissue type corresponding to that promoter.
[0235] NLS
[0236] A “nuclear localization signal” or “nuclear localization sequence” (NLS) is an amino acid sequence that “tags” a protein to allow it to be transported to the nucleus via nuclear transport; that is, a protein with an NLS is transported to the nucleus. Typically, an NLS contains positively charged Lys or Arg residues exposed on the protein surface. Exemplary nuclear localization sequences include, but are not limited to, NLS from the following: SV40 large T antigen, EGL-13, c-Myc, and TUS protein. In some embodiments, the NLS contains the PKKKRKV sequence. In some embodiments, the NLS contains the AVKRPAATKKAGQAKKKKLD sequence. In some embodiments, the NLS contains the PAAKRVKLD sequence. In some embodiments, the NLS contains the MSRRRKANPTKLSENAKKLAKEVEN sequence. In some embodiments, the NLS contains the KLKIKRPVK sequence. Other nuclear localization sequences include, but are not limited to, the acidic M9 domain of hnRNP A1, the KIPIK sequence in the yeast transcriptional repressor Matα2, and PY-NLS.
[0237] Operable connection
[0238] As used herein, the term “operably linked” is intended to mean that the nucleotide sequence of interest is linked to one or more regulatory elements in a manner that allows the expression of that nucleotide sequence (e.g., in an in vitro transcription / translation system or in the host cell when the vector is introduced into the host cell).
[0239] Complementarity
[0240] As used herein, the term "complementarity" refers to the ability of a nucleic acid to form one or more hydrogen bonds with another nucleic acid sequence via conventional Watson-Crick or other non-conventional types. The percentage of complementarity indicates the percentage of residues in a nucleic acid molecule that can form hydrogen bonds (e.g., Watson-Crick base pairing) with a second nucleic acid sequence (e.g., 5, 6, 7, 8, 9, 10 out of 10 are 50%, 60%, 70%, 80%, 90%, and 100% complementary). "Complete complementarity" means that all consecutive residues in a nucleic acid sequence form hydrogen bonds with the same number of consecutive residues in a second nucleic acid sequence. As used herein, “substantially complementary” refers to a complementarity of at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 100% in a region having 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50 or more nucleotides, or to two nucleic acids hybridizing under stringent conditions.
[0241] Strict conditions
[0242] As used herein, “strict conditions” for hybridization refer to conditions under which a nucleic acid complementary to the target sequence hybridizes primarily with the target sequence and substantially does not hybridize to non-target sequences. Strict conditions are typically sequence-dependent and vary depending on many factors. Generally, the longer the sequence, the higher the temperature at which it specifically hybridizes to its target sequence.
[0243] Hybridization
[0244] The terms “hybridization” or “complementary” or “substantially complementary” refer to nucleic acids (such as RNA, DNA) containing nucleotide sequences that enable them to bind non-covalently, that is, to form base pairs and / or G / U base pairs with another nucleic acid in a sequence-specific, antiparallel manner (i.e., nucleic acid-specific binding of complementary nucleic acids), also known as “annealing” or “hybridization”.
[0245] Hybridization requires two nucleic acids to contain complementary sequences, although mismatches between bases may exist. Suitable conditions for hybridization between two nucleic acids depend on their length and degree of complementarity, which are well-known variables in the art. Typically, hybridizable nucleic acids are 8 nucleotides or longer (e.g., 10 nucleotides or longer, 12 nucleotides or longer, 15 nucleotides or longer, 20 nucleotides or longer, 22 nucleotides or longer, 25 nucleotides or longer, or 30 nucleotides or longer).
[0246] It should be understood that the sequence of a polynucleotide does not need to be 100% complementary to the sequence of its target nucleic acid for specific hybridization. The polynucleotide may contain 60% or higher, 65% or higher, 70% or higher, 75% or higher, 80% or higher, 85% or higher, 90% or higher, 95% or higher, 98% or higher, 99% or higher, 99.5% or higher, or have 100% sequence complementarity with the target region of the target nucleic acid sequence it hybridizes with.
[0247] Hybridization of the target sequence with gRNA means that at least 60%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% of the nucleic acid sequences of the target sequence and gRNA can hybridize to form a complex; or it means that at least 12, 15, 16, 17, 18, 19, 20, 21, 22, or more bases of the nucleic acid sequences of the target sequence and gRNA can be complementary and hybridize to form a complex.
[0248] Express
[0249] As used herein, the term "expression" refers to the process by which a DNA template is transcribed into polynucleotides (such as mRNA or other RNA transcripts) and / or the transcribed mRNA is subsequently translated into peptides, polypeptides, or proteins. Transcripts and encoded polypeptides can be collectively referred to as "gene products." If the polynucleotides are derived from genomic DNA, expression can include the splicing of mRNA in eukaryotic cells.
[0250] connector
[0251] As used herein, the term "linker" refers to a linear polypeptide formed by the linkage of multiple amino acid residues via peptide bonds. The linkers of this invention can be synthetically produced amino acid sequences or naturally occurring polypeptide sequences, such as polypeptides with hinge region functions. Such linker polypeptides are well known in the art (see, for example, Holliger, P. et al. (1993) Proc. Natl. Acad. Sci. USA 90:6444-6448; Poljak, RJ et al. (1994) Structure 2:1 121-1123).
[0252] treat
[0253] As used in this article, the term "treatment" means to treat or cure a disease, to delay the onset of symptoms of a disease, and / or to slow the progression of a disease.
[0254] Subjects
[0255] As used herein, the term “subject” includes, but is not limited to, various animals, plants and microorganisms.
[0256] animal
[0257] For example, mammals, such as bovids, equines, sheep, suidae, canids, felines, lagos, rodents (e.g., mice or rats), non-human primates (e.g., macaques or cynomolgus monkeys), or humans. In some embodiments, the subject (e.g., a human) suffers from a condition (e.g., a condition caused by a disease-related gene defect).
[0258] plant
[0259] The term "plant" should be understood as any differentiated multicellular organism capable of photosynthesis, including crop plants at any stage of maturity or development, particularly monocotyledonous or dicotyledonous plants, vegetable crops including artichokes, kohlrabi, arugula, leeks, asparagus, lettuce (e.g., head lettuce, leaf lettuce, longleaf lettuce), bok choy, taro, cucurbits (e.g., melons, watermelons, crenshaw, cantaloupes, Roman melons), rapeseed crops (e.g., Brussels sprouts, cabbage, cauliflower, broccoli, kale, headless cabbage, Chinese cabbage, baby bok choy), artichokes, carrots, napa cabbage, okra, onions, celery, parsley, chickpeas, parsnip, chicory, peppers, potatoes, gourds (e.g., zucchini, cucumbers, baby zucchini, squash, pumpkin), radishes, dried onions, turnips Cabbage, purple eggplant (also known as eggplant), Brahman ginseng, lettuce, scallions, chicory, garlic, spinach, green onions, squash, leafy greens, beets (sugar beets and fodder beets), sweet potatoes, romaine lettuce, wasabi, tomatoes, turnips, and spices; fruits and / or vine crops such as apples, apricots, cherries, nectarines, peaches, pears, plums, prunes, cherries, quince, almonds, chestnuts, hazelnuts, pecans, pistachios, walnuts, citrus fruits, blueberries, boysenberries, cranberries, Spike currants, raspberries, strawberries, blackberries, grapes, avocados, bananas, kiwifruit, persimmons, pomegranates, pineapples, tropical fruits, pears, melons, mangoes, papayas, and lychees; field crops such as clover, alfalfa, evening primrose, silvergrass, corn / maize (feed corn, sweet corn, popcorn), hops, jojoba, peanuts, rice, safflower, small grain cereals (barley, oats, rye, wheat, etc.), sorghum, tobacco, kapok, legumes (beans, lentils, peas, soybeans), and oilseed plants (rapeseed, mustard). Vegetables, poppies, olives, sunflowers, coconuts, castor oil plants, cocoa beans, peanuts), Arabidopsis thaliana, fiber plants (cotton, flax, jute), Lauraceae (cinnamon, camphor), or a plant such as coffee, sugarcane, tea, and natural rubber plants; and / or bedding plants such as flowering plants, cacti, succulents and / or ornamental plants, and trees such as forests (broadleaf trees and evergreen trees such as conifers), fruit trees, ornamental trees, and nut-bearing trees, as well as shrubs and other seedlings.
[0260] Beneficial effects of the invention
[0261] This invention improves the activity of V-type Cas protein by fusing an HNH domain into the V-type Cas protein through engineering modification, and has broad application prospects.
[0262] The embodiments of the present invention will now be described in detail with reference to the accompanying drawings and examples. However, those skilled in the art will understand that the following drawings and examples are for illustrative purposes only and are not intended to limit the scope of the invention. Various objects and advantages of the present invention will become apparent to those skilled in the art from the following detailed description of the drawings and preferred embodiments. Attached Figure Description
[0263] Figure 1 Validation of the editing activity of the mutant Cas12j19 protein.
[0264] Figure 2 Validation of the efficiency of engineered Cas12j19 protein editing.
[0265] The sequence information involved in this invention is as follows:
[0266]
[0267]
[0268] Detailed Implementation
[0269] The following examples are for illustrative purposes only and are not intended to limit the invention. Unless otherwise specified, the experiments and methods described in the examples are generally performed according to conventional methods well known in the art and described in various references. For example, conventional techniques such as immunology, biochemistry, chemistry, molecular biology, microbiology, cell biology, genomics, and recombinant DNA used in this invention can be found in Sambrook, Fritsch, and Maniatis, *Molecular Cloning: A Laboratory Manual*, 2nd edition (1989); *Current Protocols in Molecular Biology* (edited by FM. Ausubel et al., (1987)); and the *Methods in Enzyme* series (academic publishing company): *PCR 2: A PRACTICAL*. APPROACH (edited by MJ MacPherson, BD Hames and GR Taylor (1995)), Harlow and Lane (1988) Antibodies, ALABORATORY MANUAL, and Animal Cell Culture (edited by R.R. Freshney (1987)).
[0270] Furthermore, unless specific conditions are specified in the examples, conventional conditions or conditions recommended by the manufacturer should be followed. Reagents or instruments whose manufacturers are not specified are all commercially available conventional products. Those skilled in the art will understand that the examples are described by way of illustration and are not intended to limit the scope of protection claimed by the invention. All disclosures and other references mentioned herein are incorporated herein by reference in their entirety.
[0271] Example 1. Obtaining the HNH domain
[0272] Through bioinformatics analysis, HNH domains with nuclease cleavage activity from different species were obtained. In this embodiment, the following HNH domains were selected:
[0273] SEQ ID No. source Sequence Abbreviation 1 Desulfococcus multivorans DSM 2059 DmHNH 2 Delta proteobacterium NaphS2 DpHNH 3 Candidatus Competibacter denitrificans Run_A_D11 CcdHNH 4 Rhodococcus sp. RdHNH 5 Tessaracoccus lapidicaptus TlHNH 6 Paraconexibacter algicola PcaHNH 7 Euzebya pacifica EpHNH 8 Corynebacterium glutamicum CgHNH 9 Mycobacterium tuberculosis MtHNH 10 Eggerthia catenaformis EcHNH 11 Flavobacterium phage 11b FpHNH 12 Haliscomenobacter hydrossis Hh1HNH 13 unknown K4LHNH 14 Amphibacillus xylanus AxHNH 15 Rhodospirillum centenum RcHNH 16 Amborella trichopoda AmtHNH 17 Glycine max GmsHNH 18 Klebsormidium nitens KnHNH 19 Salpingoeca rosetta SrHNH 20 Physcomitrium patens PpHNH 21 Ophiophagus hannah OhHNH 22 Symbiodinium microadriaticum SmHNH 23 Bodo saltans BsHNH 24 Agrococcus pavilionensis RW1 ApHNH 25 Actinobacteria bacterium IMCC26256 AbHNH 26 Eubacterium sp. EubHNH 27 Zavarzinia aquatilis ZaHNH 28 Oxalobacter formigenes OfHNH
[0274] Example 2. Optimization of Cas12j19 protein
[0275] For the known Cas protein (Cas12j.19 in CN111770992B, referred to as Cas12j19 in this embodiment), the applicant used bioinformatics to predict key amino acid sites that may affect its biological function, and mutated these amino acid sites to obtain a Cas mutant protein with enhanced editing activity. Specifically, the coding sequence of Cas12j19 was codon-optimized and synthesized. The amino acid sequence of wild-type Cas12j19 is shown in SEQ ID No. 29, and its nucleic acid sequence is shown in SEQ ID No. 30. Site-directed mutations were performed on the amino acids that could potentially bind to the target sequence using bioinformatics methods.
[0276] Variants of the Cas protein were generated through site-directed mutagenesis based on PCR. Specifically, the DNA sequence of the Cas12j19 protein was divided into two parts centered on the mutation site. Two pairs of primers were designed to amplify these two DNA sequences respectively, with the desired mutation sequence introduced onto the primers. Finally, the two fragments were loaded into the pcDNA3.3-eGFP vector using Gibson cloning. The combination of mutants was achieved by splitting the Cas12j19 protein DNA into multiple segments and constructing them using PCR and Gibson cloning. Fragment amplification kit: TransStart FastPfu DNA Polymerase (containing 2.5 mM dNTPs), detailed experimental procedures are available in the instruction manual. Gel recovery kit: For detailed experimental procedures, please refer to the instruction manual for the Gel DNA Extraction Mini Kit. The reagent kit used for vector construction is the pEASY-Basic Seamless Cloning and Assembly Kit (CU201-03). For detailed experimental procedures, please refer to the instruction manual.
[0277] Based on the above amino acid mutation sites, the wild-type protein (WT) of Cas12j19 and the protein with multiple amino acid site combinations of mutations were obtained.
[0278] A fluorescent reporter system suitable for verifying Cas12j19 cleavage was constructed based on the literature (Yang, Yi, et al. "Highly efficient and rapid detection of the cleavage activity of Cas9 / gRNA via a fluorescent reporter." Applied biochemistry and biotechnology 180.4(2016):655-667.). The fluorescent reporter vector contained RFP and a non-luminescent GFFP fluorescent protein, while the Cas vector contained a CFP fluorescent protein. FUT8-3 of the GFFP sequence was selected. ATG The target site GAGGCTGTCTACAATGGGGA was tested. The underlined position is the PAM sequence, and the DR sequence is GUGCUGCUGUCUCCCAGACGGGAGGCAGAACUGCAC. The editing efficiency can be determined by the ratio of GFP fluorescence in CFP and RFP after 48 hours of transfection into CHO cells using flow cytometry.
[0279] In this embodiment, the 100th amino acid of SEQ ID No. 29 was mutated to K, the 400th amino acid to R, the 763rd amino acid to R, and the 45th amino acid to T to obtain the tetraprotein E100K-S400R-L763R-S45T; the activity of the mutant protein was tested in the above manner, and the results are as follows. Figure 1 As shown, the editing efficiency of wild-type Cas12j19 (WT, shown in SEQ ID No. 29) is about 6%, while the editing efficiency of the tetraprotic proteins E100K-S400R-L763R-S45T is about 90%. The editing efficiency of the above tetraprotic proteins is significantly improved compared with that of wild-type Cas12j19.
[0280] Example 3. Effects of HNH domains from different sources on Cas protein activity
[0281] The tetraprotic protein E100K-S400R-L763R-S45T obtained in Example 2 was used as the parent protein and inserted into the HNH domain; in this embodiment, the above-mentioned tetraprotic protein E100K-S400R-L763R-S45T was defined as Cas-SF02.
[0282] In this embodiment, the HNH domains (SEQ ID No. 1-SEQ ID No. 28) from Example 1 were inserted between the first and second amino acids from the N-terminus of Cas-SF02, respectively, to obtain engineered Cas proteins DmHNH-Cas-SF02, DpHNH-Cas-SF02, CcdHNH-Cas-SF02, RdHNH-Cas-SF02, TlHNH-Cas-SF02, PcaHNH-Cas-SF02, EpHNH-Cas-SF02, CgHNH-Cas-SF02, MtHNH-Cas-SF02, EcHNH-Cas-SF02, FpHNH-Cas-SF02, Hh1HNH-Cas-SF02, and K4L. HNH-Cas-SF02, AxHNH-Cas-SF02, RcHNH-Cas-SF02, AmtHNH-Cas-SF02, GmsHNH-Cas-SF02, KnHNH-Cas-SF02, SrHNH-Cas-SF02, PpHNH-Cas-SF02, OhHNH-Cas-SF02, SmHNH-Cas-SF02, BsHNH-Cas-SF02, ApHNH-Cas-SF02, AbHNH-Cas-SF02, EubHNH-Cas-SF02, ZaHNH-Cas-SF02, OfHNH-Cas-SF02 (i.e., the N-terminus of the HNH domain shown in SEQ ID No. 1-28 is directly linked to the first amino acid of Cas-SF02, and the C-terminus of the HNH domain shown in SEQ ID No. 1-28 is directly linked to the second amino acid of Cas-SF02).
[0283] In this embodiment, the editing activity of the mutant protein Cas-SF02 and the 28 engineered Cas proteins were tested.
[0284] A target gene, FUT8-Cas-XX-g8, was designed targeting Chinese hamster ovary (CHO) cells. The gene sequence is: ATGGAAGGCTGCTTCTGTTCCCA, where the italicized portion represents the PAM sequence and the underlined region is the target area. The vector pcDNA3.3 was modified to carry EGFP fluorescent protein and the PuroR resistance gene. The SV40 NLS-Cas-XX fusion protein was inserted via XbaI and PstI restriction sites; the U6 promoter and gRNA sequence were inserted via Mfe1 restriction site. The CMV promoter initiates the expression of the SV40 NLS-Cas-XX-NLS-GFP fusion protein. The Cas-XX-NLS and GFP proteins are linked using the T2A linker. The EF-1α promoter initiates the expression of the puromycin resistance gene. Plating: 293T cells were plated at 70-80% confluence, with a seeding density of 8 x 10^4 cells / well in 12-well plates. Transfection: Transfect was performed 24 hours after plating. 6.25 μl of Hieff Trans was added to 100 μl of opti-MEM. TM Liposome nucleic acid transfection reagent, mix well; add 2.5 μg plasmid to 100 μl opti-MEM, mix well. Diluted HieffTrans... TM The liposome nucleic acid transfection reagent was mixed thoroughly with the diluted plasmid and incubated at room temperature for 20 min. The incubated mixture was then added to cell-coated culture medium for transfection. 48 h after transfection, cells were digested with trypsin-EDTA (0.05%) and sorted using flow cytometry (FACS) for GFP signaling.
[0285] DNA extraction, PCR amplification of the area near the editing region, and hiTOM sequencing: Cells were collected after trypsin digestion, and genomic DNA was extracted using a cell / tissue genomic DNA extraction kit (Biotech). The genomic DNA was amplified in the region near the target site. PCR products were then sequenced using hiTOM. Sequencing data analysis was performed, identifying the types and proportions of sequences within a 15nt upstream and 10nt downstream of the target site. Sequences with a SNV frequency greater than or equal to 1% or a non-SNV mutation frequency greater than or equal to 0.06% were identified to determine the editing efficiency of different Cas proteins at the target site.
[0286] The editing activities of the mutant protein Cas-SF02 and the aforementioned 28 engineered Cas proteins were statistically analyzed, and the results are as follows: Figure 2As shown, compared with the mutant protein Cas-SF02, CgHNH-Cas-SF02, MtHNH-Cas-SF02, EcHNH-Cas-SF02, FpHNH-Cas-SF02, Hh1HNH-Cas-SF02, K4LHNH-Cas-SF02, AxHNH-Cas-SF02, RcHNH-Cas-SF02, GmsHNH-Cas-SF02, KnHNH-Cas-SF02, SrHNH-Cas-SF02, PpHNH-Cas-SF02, OhHNH-Cas-SF02, SmHNH-Cas-SF02, BsHNH- The editing efficiency of Cas-SF02, ApHNH-Cas-SF02, AbHNH-Cas-SF02, EubHNH-Cas-SF02, and OfHNH-Cas-SF02 proteins in eukaryotic cells was increased; while the editing efficiency of DmHNH-Cas-SF02, DpHNH-Cas-SF02, CcdHNH-Cas-SF02, RdHNH-Cas-SF02, TlHNH-Cas-SF02, PcaHNH-Cas-SF02, EpHNH-Cas-SF02, AmtHNH-Cas-SF02, and ZaHNH-Cas-SF02 proteins in eukaryotic cells was decreased. Among them, the editing efficiency of EcHNH-Cas-SF02, FpHNH-Cas-SF02, Hh1HNH-Cas-SF02, K4LHNH-Cas-SF02, AxHNH-Cas-SF02, RcHNH-Cas-SF02, KnHNH-Cas-SF02, SrHNH-Cas-SF02, OhHNH-Cas-SF02, SmHNH-Cas-SF02, ApHNH-Cas-SF02, AbHNH-Cas-SF02, EubHNH-Cas-SF02, and OfHNH-Cas-SF02 proteins in eukaryotic cells was increased by more than 50%. Inserting EcHNH, FpHNH, Hh1HNH, K4LHNH, AxHNH, RcHNH, KnHNH, SrHNH, OhHNH, SmHNH, ApHNH, AbHNH, EubHNH, and OfHNH domains at the N-terminus can significantly improve the editing efficiency of the Cas-SF02 protein in eukaryotic cells.
[0287] Although specific embodiments of the invention have been described in detail, those skilled in the art will understand that various modifications and variations can be made to the details based on all the published teachings, and all such changes are within the scope of protection of the invention. The entire scope of the invention is given by the appended claims and any equivalents thereof.
Claims
1. An engineered V-type Cas protein, said engineered V-type Cas protein comprising a parental V-type Cas protein and an HNH domain, characterized in that, The HNH domain is located at the N-terminus of the parental V-type Cas protein; the amino acid sequence of the HNH domain is shown in any one of SEQ ID No. 8-15, SEQ ID No. 17-26 or SEQ ID No. 28; The parental V-type Cas protein is wild-type Cas12j19 or mutated Cas12j19 obtained by site-directed amino acid mutation; Preferably, the mutated Cas12j19 has mutations at the following amino acid sites in the amino acid sequence shown in SEQ ID No. 29: position 100, position 400, position 763, and position 45.
2. A fusion protein comprising the engineered V-type Cas protein of claim 1 and other modified portions.
3. An isolated polynucleotide, characterized in that, The polynucleotide is a polynucleotide sequence encoding the engineered V-type Cas protein of claim 1, or a polynucleotide sequence encoding the fusion protein of claim 2.
4. A carrier, characterized in that, The vector comprises the polynucleotide of claim 3 and a regulatory element operatively linked thereto.
5. A CRISPR-Cas system, characterized in that, The system comprises the engineered V-type Cas protein of claim 1 and at least one gRNA; The gRNA can bind to the engineered V-type Cas protein as described in claim 1.
6. A composition, characterized in that, The composition comprises: (i) A protein component selected from: the engineered V-type Cas protein of claim 1 or the fusion protein of claim 2; (ii) A nucleic acid component, which is gRNA, said gRNA being capable of binding the engineered V-type Cas protein of claim 1; The protein components and nucleic acid components combine to form a complex.
7. An engineered host cell, characterized in that, The host cell comprises the engineered V-type Cas protein of claim 1, or the fusion protein of claim 2, or the polynucleotide of claim 3, or the vector of claim 4, or the CRISPR-Cas system of claim 5, or the composition of claim 6.
8. The engineered V-type Cas protein of claim 1, or the fusion protein of claim 2, or the polynucleotide of claim 3, or the vector of claim 4, or the CRISPR-Cas system of claim 5, or the composition of claim 6, or the host cell of claim 7, in the application of any one or more of the following: gene editing, gene targeting, gene cutting, cutting double-stranded DNA, single-stranded DNA or single-stranded RNA, specifically editing double-stranded nucleic acids, base editing double-stranded nucleic acids, base editing single-stranded nucleic acids; Alternatively, in the preparation of formulations or kits for: gene editing, gene targeting, gene cutting, editing of target sequences in target loci to modify organisms, treatment of diseases, or targeting of target genes.
9. A method for editing, targeting, or cleaving a target nucleic acid, the method comprising contacting the target nucleic acid with an engineered V-type Cas protein of claim 1, or a fusion protein of claim 2, or a polynucleotide of claim 3, or a vector of claim 4, or a CRISPR-Cas system of claim 5, or a composition of claim 6, or a host cell of claim 7.
10. A kit for gene editing, gene targeting, or gene cutting, the kit comprising the engineered V-type Cas protein of claim 1, or the fusion protein of claim 2, or the polynucleotide of claim 3, or the vector of claim 4, or the CRISPR-Cas system of claim 5, or the composition of claim 6, or the host cell of claim 7.
11. The application of the HNH domain in improving the editing efficiency of wild-type Cas12j19 protein or mutant Cas12j19 protein, wherein the HNH domain is selected from one or any of the following: The HNH domain has at least 80% sequence identity with any of SEQ ID No. 8-15, SEQ ID No. 17-26 or SEQ ID No. 28, and substantially retains the biological function of the HNH domain; Alternatively, the HNH domain may have one or more amino acid substitutions, deletions, or additions compared to any of the sequences in SEQ ID No. 8-15, SEQ ID No. 17-26, or SEQ ID No. 28, and the biological function of the HNH domain may be substantially preserved.
Citation Information
Patent Citations
CRISPR enzymes and systems
CN109207477B
CRISPR-Cas12j enzymes and systems
CN111770992B
V-type Cas enzyme fused with HNH structural domain and application of V-type Cas enzyme
CN116790559A
Engineered Cas protein and application thereof
CN118613580A
Cas12j protein with improved editing activity and application thereof
CN119162150A