Multicolor multiple digital PCR (Polymerase Chain Reaction) method and application thereof in detecting pathogenic microorganisms infected by central nervous system and drug-resistant genes
By using multicolor multiplex digital PCR technology, the PCR reaction system is divided into independent units and combined with fluorescently labeled TaqMan probes, which solves the sensitivity and specificity problems in the detection of pathogens causing central nervous system infections, and enables rapid, efficient, and low-cost detection of multiple pathogens and drug resistance genes.
Patent Information
- Application Number
- CN202511106767.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-08-07
- Publication Date
- 2025-11-14
AI Technical Summary
Existing methods for detecting pathogens causing central nervous system infections suffer from low sensitivity, poor specificity, and low throughput, making it difficult to meet clinical needs. Furthermore, multiplex PCR technology is prone to problems such as decreased amplification efficiency, reduced sensitivity, and decreased specificity when using high detection multiples.
The multicolor multiplex digital PCR method is used to divide the PCR reaction system into tens of thousands of independent reaction units. By combining TaqMan probes and primers with different fluorescent labels, the simultaneous detection of multiple pathogens and drug resistance genes can be achieved. By utilizing the high sensitivity and specificity of digital PCR, different targets can be distinguished through multicolor fluorescent channels.
It achieves a high positive detection rate and rapid detection of pathogenic microorganisms and drug-resistant genes in the central nervous system, shortens the detection time to 3 hours, reduces costs, and is more cost-effective.
Smart Images

Figure BDA0005538860050000071 
Figure BDA0005538860050000072 
Figure BDA0005538860050000081
Abstract
Description
Technical Field
[0001] This invention relates to the field of biotechnology, and in particular to a multicolor multiplex digital PCR method and its application in the detection of pathogenic microorganisms and drug resistance genes in central nervous system infections. Background Technology
[0002] Central nervous system (CNS) infections are acute or chronic inflammatory diseases caused by pathogenic microorganisms (including bacteria, fungi, viruses, spirochetes, parasites, rickettsiae, and prions) invading the brain parenchyma, spinal cord, its meninges, and blood vessels. They are among the most common diseases of the nervous system. Viral meningitis or encephalitis (viral encephalitis), purulent meningitis (purulent encephalitis), tuberculous meningitis (tuberculous encephalitis), cryptococcal meningitis (cryptococcal encephalitis), and neurocysticercosis are common clinical types. Despite the increasing use of antibiotics in clinical practice, the improvement of healthcare systems worldwide, and a deeper understanding of the pathogenesis of infections, the incidence and mortality rates of CNS infections remain high globally. This is partly due to the damage to the immune system caused by acquired immunodeficiency syndrome (AIDS), and partly due to the use of various immunosuppressants in cancer chemotherapy and organ transplantation. The emergence of multidrug-resistant strains and the role of large-scale population migration also cannot be ignored. The infection rate of postoperative CNSIs after neurosurgery ranges from 4.6% to 25%, accounting for 0.8% to 7% of all CNSIs. Depending on the surgical type, the incidence of postoperative meningitis ranges from 1.5% to 8.6%, with external ventricular drainage-related infections reaching 8% to 22%. The incidence of CNSIs caused by craniocerebral trauma and external lumbar drainage is 1.4% and 5%, respectively. The mortality rate of postoperative meningitis and / or ventriculitis after neurosurgery ranges from 3% to 33%. Common pathogens causing CNSIs include Gram-negative bacteria, Gram-positive bacteria, and fungi, with the former two being predominant. Anaerobic bacteria are common pathogens causing brain abscesses. According to data from the 2019 CHINET (China Antimicrobial Resistance Surveillance Network), common Gram-negative bacteria include Acinetobacter, Klebsiella pneumoniae, Escherichia coli, and Pseudomonas aeruginosa, while common Gram-positive bacteria include Staphylococcus epidermidis, Staphylococcus hominis, Staphylococcus capitulata, Staphylococcus aureus, Enterococcus, Staphylococcus aureus, and Streptococcus pneumoniae. The infection rate of Gram-positive bacteria is 55%, and that of Gram-negative bacteria is 45%. In recent years, CNSIs caused by Gram-negative bacteria have shown an upward trend.
[0003] Rapid and accurate detection and identification of the infecting pathogens are crucial for early diagnosis of CNSI, timely and effective treatment, and reducing mortality and disability rates. However, the initial clinical manifestations of CNSI from different pathogens are nonspecific, requiring a combination of serological and cerebrospinal fluid (CSF) examinations, as well as neuroimaging, for diagnosis. Traditional detection methods, such as serum and CSF culture and smear staining, can confirm the pathogenic microorganism, but their positive rate is only about 10%, making accurate microbiological diagnosis of CNSI difficult. This remains a challenge for precise etiological treatment of CNSI.
[0004] Digital PCR is an absolute quantification technique for nucleic acid molecules. It distributes a PCR reaction system into a large number of microreaction units, each containing one or more copies of the target nucleic acid molecule, performing "single-molecule template PCR amplification." After amplification, the copy number of the target gene in the original sample can be obtained by the number of positive reaction units and the Poisson distribution formula. Compared with traditional quantitative PCR, digital PCR has the advantages of high sensitivity, high specificity, good reproducibility, and absolute quantification without dependence on standards and standard curves.
[0005] Multiplex PCR refers to a PCR reaction in which two or more pairs of primers are added to the same PCR reaction system to simultaneously amplify multiple nucleic acid fragments. This allows for the simultaneous detection of multiple targets, significantly improving detection efficiency while reducing costs. TaqMan hydrolysis probes are a commonly used probe in multiplex PCR. They are labeled with a fluorescent reporter group at the 5' end and a fluorescent quencher group at the 3' end. By labeling different fluorescent reporter and quencher groups at different sequence ends, different TaqMan hydrolysis probes can be formed. Adding these probes, along with corresponding primers and templates, to the same reaction system, combined with the instrument's ability to detect different fluorescence, enables the simultaneous detection of multiple targets.
[0006] Conventional pathogen detection techniques, such as direct microscopy, bacterial / fungal culture, antigen-antibody detection, and traditional nucleic acid detection, suffer from low sensitivity, poor specificity, and low throughput, making them insufficient to meet clinical needs. Literature reports that nearly half of meningoencephalitis patients have no identifiable cause, with cases of encephalitis without a clear pathogen reaching as high as 69.8%. Rapid molecular diagnostics is an emerging pathogen diagnostic technology with advantages such as short detection cycles, simple operation, and the ability to effectively improve pathogen diagnosis and guide antimicrobial therapy. In recent years, metagenomic next-generation sequencing (mNGS) has been widely used clinically, improving diagnostic accuracy, but it faces challenges such as a lack of standardized testing methods, long processing times, and significant background bacterial interference. The FilmArray meningitis / encephalitis (FAME) panel is an automated rapid molecular diagnostic device based on the principle of multiplex PCR (polymerase chain reaction). It can qualitatively detect 14 of the most common acute CNS infection pathogens within 1 hour, including 6 bacteria (Escherichia coli, Haemophilus influenzae, Listeria monocytogenes, Neisseria meningitidis, Streptococcus agalactiae, and Streptococcus pneumoniae), 1 fungus (Cryptococcus neoformans), and 7 viruses (cytomegalovirus, enterovirus, herpes simplex virus type 1, herpes simplex virus type 2, human herpesvirus type 6, human diicovirus, and varicella-zoster virus).
[0007] Multiplex PCR technology allows for the detection of multiple pathogens in a single amplification reaction, significantly reducing costs. However, as the number of detection multiples increases, amplification efficiency, sensitivity, and specificity tend to decrease, affecting detection accuracy. Digital PCR technology, by dividing a large-volume reaction system into tens of thousands of independent reaction units, ensures that the amplification of each target does not interfere with each other, greatly improving the detection multiple. Therefore, providing a multicolor multiplex digital PCR method capable of detecting pathogens infecting the central nervous system and drug resistance genes is of significant practical importance. Summary of the Invention
[0008] In view of this, the present invention provides a multicolor multiplex digital PCR method and its application in the detection of pathogenic microorganisms and drug resistance genes in central nervous system infections. It can detect multiple pathogens and drug resistance genes in a single tube reaction system at one time, and has the advantages of high positive detection rate, fast detection speed, strong specificity and low cost.
[0009] To achieve the above-mentioned objectives, the present invention provides the following technical solution:
[0010] This invention provides a combination of nucleic acid molecules, including nucleic acid molecule X;
[0011] The nucleic acid molecule X has:
[0012] (1) A nucleotide sequence as shown in SEQ ID NO:X; or
[0013] (2) A nucleotide sequence obtained by substituting, deleting, or adding one or more bases to the nucleotide sequence shown in (1), and whose function is the same as or similar to that of (1); or
[0014] (3) A nucleotide sequence that is at least 90% homologous to the nucleotide sequence shown in (1) or (2);
[0015] X is selected from any integer from 1 to 83;
[0016] The number of items is 2 to 5.
[0017] In some specific embodiments of the present invention, the above-mentioned nucleic acid molecule combination includes nucleic acid molecule 1 with the sequence of SEQ ID NO:1, nucleic acid molecule 2 with the sequence of SEQ ID NO:2, nucleic acid molecule 3 with the sequence of SEQ ID NO:3, nucleic acid molecule 4 with the sequence of SEQ ID NO:4, nucleic acid molecule 5 with the sequence of SEQ ID NO:5, nucleic acid molecule 6 with the sequence of SEQ ID NO:6, nucleic acid molecule 7 with the sequence of SEQ ID NO:7, nucleic acid molecule 8 with the sequence of SEQ ID NO:8, nucleic acid molecule 9 with the sequence of SEQ ID NO:9, nucleic acid molecule 10 with the sequence of SEQ ID NO:10, nucleic acid molecule 11 with the sequence of SEQ ID NO:11, nucleic acid molecule 12 with the sequence of SEQ ID NO:12, nucleic acid molecule 13 with the sequence of SEQ ID NO:13, nucleic acid molecule 14 with the sequence of SEQ ID NO:14, nucleic acid molecule 15 with the sequence of SEQ ID NO:15, nucleic acid molecule 16 with the sequence of SEQ ID NO:16, nucleic acid molecule 17 with the sequence of SEQ ID NO:17, and so on. Nucleic acid molecule 18 with sequence NO:18, nucleic acid molecule 19 with sequence NO:19, nucleic acid molecule 20 with sequence NO:20, nucleic acid molecule 21 with sequence NO:21, nucleic acid molecule 22 with sequence NO:22, nucleic acid molecule 23 with sequence NO:23, nucleic acid molecule 24 with sequence NO:24, nucleic acid molecule 25 with sequence NO:25, nucleic acid molecule 26 with sequence NO:26, nucleic acid molecule 27 with sequence NO:27, nucleic acid molecule 28 with sequence NO:28, nucleic acid molecule 29 with sequence NO:29, nucleic acid molecule 30 with sequence NO:30, nucleic acid molecule 31 with sequence NO:31, nucleic acid molecule 32 with sequence NO:32, nucleic acid molecule 33 with sequence NO:33, nucleic acid molecule 34 with sequence NO:34, and nucleic acid molecule 35 with sequence NO:25, nucleic acid molecule 26 with sequence NO:26, nucleic acid molecule 27 with sequence NO:27, nucleic acid molecule 28 with sequence NO:28, nucleic acid molecule 29 with sequence NO:29, nucleic acid molecule 30 with sequence NO:30, nucleic acid molecule 31 with sequence NO:31, nucleic acid molecule 32 with sequence NO:32, nucleic acid molecule 33 with sequence NO:33, nucleic acid molecule 34 with sequence NO:35, nucleic acid molecule 35 with sequence NO:26, nucleic acid molecule 26 with sequence NO:27, nucleic acid molecule 28 with sequence NO:28, nucleic acid molecule 29 with sequence NO:29, nucleic acid molecule 30 with sequence NO:30, nucleic acid molecule 31 with sequence NO:31, nucleic acid molecule 32 with sequence NO:32, nucleic acid molecule 33 with sequence NO:33, nucleic acid molecule 34 with sequence NO:35, nucleic acid molecule Nucleic acid molecule 35 with sequence NO:35, nucleic acid molecule 36 with sequence NO:36, nucleic acid molecule 37 with sequence NO:37, nucleic acid molecule 38 with sequence NO:38, nucleic acid molecule 39 with sequence NO:39, nucleic acid molecule 40 with sequence NO:40, nucleic acid molecule 41 with sequence NO:41, nucleic acid molecule 42 with sequence NO:42, nucleic acid molecule 43 with sequence NO:43, and nucleic acid molecule 44 with sequence NO:35.Nucleic acid molecule 44 with SEQ ID NO:44, nucleic acid molecule 45 with SEQ ID NO:45, nucleic acid molecule 46 with SEQ ID NO:46, nucleic acid molecule 47 with SEQ ID NO:47, nucleic acid molecule 48 with SEQ ID NO:48, nucleic acid molecule 49 with SEQ ID NO:49, nucleic acid molecule 50 with SEQ ID NO:50, nucleic acid molecule 51 with SEQ ID NO:51, nucleic acid molecule 52 with SEQ ID NO:52, nucleic acid molecule 53 with SEQ ID NO:53, nucleic acid molecule 54 with SEQ ID NO:54, nucleic acid molecule 55 with SEQ ID NO:55, nucleic acid molecule 56 with SEQ ID NO:56, nucleic acid molecule 57 with SEQ ID NO:57, nucleic acid molecule 58 with SEQ ID NO:58, nucleic acid molecule 59 with SEQ ID NO:59, nucleic acid molecule 60 with SEQ ID NO:60, and nucleic acid molecule 60 with SEQ ID NO:44. Nucleic acid molecule 61 with sequence NO:61, 62 with sequence NO:62, 63 with sequence NO:63, 64 with sequence NO:64, 65 with sequence NO:65, 66 with sequence NO:66, 67 with sequence NO:67, 68 with sequence NO:68, 69 with sequence NO:69, 70 with sequence NO:70, 71 with sequence NO:71, 72 with sequence NO:72, 73 with sequence NO:73, 74 with sequence NO:74, 75 with sequence NO:75, 76 with sequence NO:76, 77 with sequence NO:77, and 78 with sequence NO:69. Two or more of the following: nucleic acid molecule 78 with sequence NO:78, nucleic acid molecule 79 with sequence NO:79, nucleic acid molecule 80 with sequence NO:80, nucleic acid molecule 81 with sequence NO:81, nucleic acid molecule 82 with sequence NO:82, or nucleic acid molecule 83 with sequence NO:83.
[0018] In some specific embodiments of the present invention, the above-mentioned nucleic acid molecule combinations include one or more of the following combinations: combination 1, combination 2, combination 3, combination 4, combination 5, combination 6, combination 7, combination 8, combination 9, combination 10, combination 11, combination 12, combination 13, combination 14, combination 15, combination 16, combination 17, combination 18, combination 19, combination 20, combination 21, combination 22, combination 23, combination 24, combination 25, combination 26, or combination 27;
[0019] Combination 1 includes nucleic acid molecule 1, nucleic acid molecule 2, and nucleic acid molecule 3; Combination 2 includes nucleic acid molecule 4, nucleic acid molecule 5, and nucleic acid molecule 6; Combination 3 includes nucleic acid molecule 7, nucleic acid molecule 8, and nucleic acid molecule 9; Combination 4 includes nucleic acid molecule 10, nucleic acid molecule 11, and nucleic acid molecule 12; Combination 5 includes nucleic acid molecule 13, nucleic acid molecule 14, and nucleic acid molecule 15; Combination 6 includes nucleic acid molecule 16, nucleic acid molecule 17, and nucleic acid molecule 18; Combination 7 includes nucleic acid molecule 19, nucleic acid molecule 20, nucleic acid molecule 21, and nucleic acid molecule 22. Combination 8 includes nucleic acid molecules 23, 24, and 25; combination 9 includes nucleic acid molecules 26, 27, and 28; combination 10 includes nucleic acid molecules 29, 30, and 31; combination 11 includes nucleic acid molecules 32, 33, and 34; combination 12 includes nucleic acid molecules 35, 36, and 37; combination 13 includes nucleic acid molecules 38, 39, and 40; combination 14 includes nucleic acid molecules 41, 42, and 25. Acid molecule 43 and nucleic acid molecule 44; combination 15 includes nucleic acid molecule 45, nucleic acid molecule 46 and nucleic acid molecule 47; combination 16 includes nucleic acid molecule 48, nucleic acid molecule 49 and nucleic acid molecule 50; combination 17 includes nucleic acid molecule 51, nucleic acid molecule 52 and nucleic acid molecule 53; combination 18 includes nucleic acid molecule 54, nucleic acid molecule 55 and nucleic acid molecule 56; combination 19 includes nucleic acid molecule 57, nucleic acid molecule 58 and nucleic acid molecule 59; combination 20 includes nucleic acid molecule 60, nucleic acid molecule 61 and nucleic acid molecule 62; combination 21 includes Nucleic acid molecules 63, 64, and 65; combination 22 includes nucleic acid molecules 66, 67, and 68; combination 23 includes nucleic acid molecules 69, 70, and 71; combination 24 includes nucleic acid molecules 72, 73, and 74; combination 25 includes nucleic acid molecules 75, 76, and 77; combination 26 includes nucleic acid molecules 78, 79, and 80; combination 27 includes nucleic acid molecules 81, 82, and 83.
[0020] In some specific embodiments of the present invention, the above-mentioned nucleic acid molecule combinations are:
[0021] The 5' ends of nucleic acid molecules 3, 22, 25, 43, 47, 50, and 65 are modified with FAM.
[0022] The 5' ends of nucleic acid molecules 6, 21, 28, 40, 44, 53, and 68 are modified with VIC.
[0023] The 5' ends of nucleic acid molecule 9, nucleic acid molecule 31, nucleic acid molecule 56, and nucleic acid molecule 71 are modified with ROX;
[0024] The 5' ends of nucleic acid molecules 12, 34, 59, 74, and 77 are modified with CY5.
[0025] The 5' ends of nucleic acid molecules 15, 37, 62, 80, and 83 are modified with CY5.5.
[0026] The 5' end of the nucleic acid molecule 18 is modified with CY7.
[0027] In some specific embodiments of the present invention, the above-mentioned nucleic acid molecule combinations are:
[0028] The 3' ends of nucleic acid molecules 3, 6, 9, 12, 21, 22, 25, 28, 31, 34, 43, 44, 47, 50, 53, 56, 59, 65, 68, 71, 74, and 77 are modified with MGB.
[0029] The 3' ends of nucleic acid molecules 15, 18, 37, 40, 62, 80, and 83 are modified with BHQ3.
[0030] In some specific embodiments of the present invention, the above-mentioned nucleic acid molecule combinations are:
[0031] The nucleic acid molecules 1, 2, 4, 5, 7, 8, 10, 11, 13, 14, 16, 17, 19, 20, 23, 24, 26, 27, 29, 30, 32, 33, 35, 36, 38, 39, 41, and 42 are described. 45, the nucleic acid molecules 46, 48, 49, 51, 52, 54, 55, 57, 58, 60, 61, 63, 64, 66, 67, 69, 70, 72, 73, 75, 76, 78, 79, 81, 82, 84, and 85 are primers; and / or
[0032] Nucleic acid molecules 3, 6, 9, 12, 15, 18, 21, 22, 25, 28, 31, 34, 37, 40, 43, 44, 47, 50, 53, 56, 59, 62, 65, 68, 71, 74, 77, 80, 83, and 86 are probes; and / or
[0033] The nucleic acid molecule assembly also includes a primer and probe set as an internal control.
[0034] This invention also provides the use of the above-described nucleic acid molecule combinations in any of the following:
[0035] (1) Detection of pathogenic microorganisms causing central nervous system infections;
[0036] (2) Detection of drug resistance genes;
[0037] (3) Detect pathogenic microorganisms and drug resistance genes in the central nervous system;
[0038] (4) Prepare products for detecting pathogenic microorganisms that infect the central nervous system;
[0039] (5) Prepare products for detecting drug resistance genes;
[0040] (6) Prepare products for detecting pathogenic microorganisms and drug resistance genes in central nervous system infections;
[0041] The pathogenic microorganisms causing central nervous system infections include one or more of the following: Pseudomonas aeruginosa, Escherichia coli, Klebsiella pneumoniae, Acinetobacter baumannii, CoNS, Staphylococcus aureus, Enterococcus, Streptococcus, Listeria monocytogenes, Haemophilus influenzae, Mycobacterium tuberculosis, Neisseria meningitidis, Candida albicans, Cryptococcus, Herpesvirus 1, Herpesvirus 2, Herpesvirus 3, Herpesvirus 4, Herpesvirus 5, or Herpesvirus 6.
[0042] The drug resistance genes include one or more of KPC, mecA, OXA-48, NDM, IMP, vanA, or vanM;
[0043] The products include reagents, reagent kits, or devices.
[0044] The present invention also provides products for detecting pathogenic microorganisms and / or drug-resistant genes infecting the central nervous system, comprising the above-mentioned combination of nucleic acid molecules, and acceptable excipients, auxiliaries or components.
[0045] In some specific embodiments of the present invention, the above-mentioned product:
[0046] The concentrations of nucleic acid molecule 21, nucleic acid molecule 22, nucleic acid molecule 43, and nucleic acid molecule 44 in the reaction system are 100 nM;
[0047] The concentration of nucleic acid molecule 47, nucleic acid molecule 50, nucleic acid molecule 53, nucleic acid molecule 56, nucleic acid molecule 59, nucleic acid molecule 62, nucleic acid molecule 65, nucleic acid molecule 68, nucleic acid molecule 71, nucleic acid molecule 74, nucleic acid molecule 77, nucleic acid molecule 80, and nucleic acid molecule 83 in the reaction system is 200 nM;
[0048] The concentration of nucleic acid molecule 3, nucleic acid molecule 6, nucleic acid molecule 9, nucleic acid molecule 12, nucleic acid molecule 15, nucleic acid molecule 18, nucleic acid molecule 25, nucleic acid molecule 28, nucleic acid molecule 31, nucleic acid molecule 34, nucleic acid molecule 37 and nucleic acid molecule 40 in the reaction system is 300 nM;
[0049] The concentrations of nucleic acid molecule 19, nucleic acid molecule 20, nucleic acid molecule 41, and nucleic acid molecule 42 in the reaction system are 500 nM;
[0050] The concentration of nucleic acid molecules 45, 46, 48, 49, 51, 52, 54, 55, 57, 58, 60, 61, 63, 64, 66, 67, 69, 70, 72, 73, 75, 76, 78, 79, 81, and 82 in the reaction system is 800 nM.
[0051] The concentration of nucleic acid molecule 1, nucleic acid molecule 2, nucleic acid molecule 4, nucleic acid molecule 5, nucleic acid molecule 7, nucleic acid molecule 8, nucleic acid molecule 10, nucleic acid molecule 11, nucleic acid molecule 13, nucleic acid molecule 14, nucleic acid molecule 16, nucleic acid molecule 17, nucleic acid molecule 23, nucleic acid molecule 24, nucleic acid molecule 26, nucleic acid molecule 27, nucleic acid molecule 29, nucleic acid molecule 30, nucleic acid molecule 32, nucleic acid molecule 33, nucleic acid molecule 35, nucleic acid molecule 36, nucleic acid molecule 38, and nucleic acid molecule 39 in the reaction system is 1000 nM.
[0052] This invention also provides a digital PCR detection method that distinguishes different detection items based on primer and probe concentration gradients and fluorescence channels;
[0053] The number of the detection items is M×(2) N -1), where M is the number of primer-probe concentration gradients and N is the number of fluorescence channels.
[0054] In some specific embodiments of the present invention, the above-described digital PCR detection method is based on the detection of the above-described nucleic acid molecule combination.
[0055] The primer-probe set and method of the present invention have the following effects:
[0056] Currently, the gold standard for detecting central nervous system infections is the culture method, but it has a long detection cycle and a low positive detection rate. Other molecular biology or serological detection methods cannot simultaneously meet the requirements of fast detection speed and high positive detection rate. However, the multicolor multiplex digital PCR method can cover common pathogens and drug resistance genes of central nervous system infections through two detection panels, resulting in faster detection speed and higher positive detection rate. Generally, it only takes 3 hours from obtaining the sample to getting the test result, and the cost of consumables and reagents is further reduced, making it more cost-effective. Attached Figure Description
[0057] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the accompanying drawings used in the description of the embodiments or the prior art will be briefly introduced below.
[0058] Figure 1 This demonstrates the detection of multiple targets using a single fluorescence channel. Here, 1 represents target 1 with a lower primer and probe concentration, such as 500 nM or 150 nM, and 2 represents target 2 with a higher primer and probe concentration, such as 1000 nM or 300 nM.
[0059] Figure 2 This demonstrates how TaqMan probes labeled with multiple fluorescent groups enable multiplex digital PCR. Here, 1 represents target 1, whose TaqMan probe is labeled with the CY5 fluorescent group, and the primer / probe concentrations are 1000 nM and 300 nM; 2 represents target 2, whose TaqMan probe is labeled with the FAM fluorescent group, and the primer / probe concentrations are 1000 nM and 300 nM; and 3 represents target 3, whose TaqMan probe is labeled with both CY5 and FAM fluorescent groups, and the primer / probe concentrations are 500 nM and 100 nM.
[0060] Figure 3 Show the combined 2D scatter plot;
[0061] Figure 4 Show the combined 2-dimensional scatter plot. Detailed Implementation
[0062] This invention discloses a multicolor multiplex digital PCR method and its application in detecting pathogenic microorganisms and drug resistance genes in central nervous system infections. Those skilled in the art can refer to the content of this document and appropriately modify the process parameters to achieve the same result. It should be particularly noted that all similar substitutions and modifications are obvious to those skilled in the art and are considered to be included in this invention. The method and application of this invention have been described through preferred embodiments. Those skilled in the art can obviously make modifications or appropriate alterations and combinations to the methods and applications described herein without departing from the content, spirit, and scope of this invention to realize and apply the technology of this invention.
[0063] This invention relates to a detection reagent developed using multicolor multiplex digital PCR technology to detect common pathogens and drug resistance genes in central nervous system infections. The detection targets include 12 bacteria (Pseudomonas aeruginosa, Escherichia coli, Klebsiella pneumoniae, Acinetobacter baumannii, coagulase-negative staphylococci (CoNS), Staphylococcus aureus, Enterococci, Streptococci, Listeria monocytogenes, Haemophilus influenzae, Mycobacterium tuberculosis, Neisseria meningitidis), 2 fungi (Candida and Cryptococcus), 6 viruses (herpesviruses 1-6), and 7 drug resistance genes (KPC, mecA, OXA-48, NDM, IMP, vanA, vanM). Using two reaction tubes, the reagent can complete the detection of cerebrospinal fluid samples within three hours, significantly improving detection sensitivity and specificity, reducing detection costs, and enabling the monitoring of both the type and quantity of pathogens.
[0064] The leading digital PCR platform includes seven fluorescence channels: FAM, VIC, ROX, CY5, A425, CY5.5, and CY7. Theoretically, each fluorescence channel can detect one target, but by adjusting the primer and probe concentrations, it is possible to detect multiple targets with a single fluorescence channel. Figure 1 As shown, 1 represents target 1 with a lower primer and probe concentration, such as 500 nM or 150 nM; 2 represents target 2 with a higher primer and probe concentration, such as 1000 nM or 300 nM. That is, by adjusting the primer and probe concentration, multiple targets can be detected in one fluorescence channel.
[0065] The 5' end of the TaqMan probe is a fluorescent reporter group, typically labeled with only one fluorescent marker. During PCR amplification, the emitted fluorescence can be detected by the corresponding fluorescence channel of the reader. However, TaqMan probes can also be labeled with multiple fluorescent markers, enabling multiplex digital PCR, such as... Figure 2 As shown, 1 represents target 1, whose TaqMan probe is labeled with the CY5 fluorescent group, and the primer and probe concentrations are 1000 nM and 300 nM; 2 represents target 2, whose TaqMan probe is labeled with the FAM fluorescent group, and the primer and probe concentrations are 1000 nM and 300 nM; 3 represents target 3, whose TaqMan probe is labeled with both CY5 and FAM fluorescent groups, and the primer and probe concentrations are 500 nM and 100 nM.
[0066] Both of the above methods can achieve multiplex digital PCR, but they can also be combined to detect more targets in a single experiment. Assuming the number of fluorescence channels is N, the multi-fluorescent probe labeling method can achieve (2... N -1) Redetection: Assuming M concentration gradients are set for the primers and probes of each fluorescence channel, M redetections can be achieved. Combining these two methods, M×(2) can be achieved. N -1) Re-detection.
[0067] The detection targets, fluorescent labels, and primer / probe concentrations are shown in Tables 1 and 2.
[0068] Table 1
[0069]
[0070] Table 2
[0071]
[0072]
[0073] The primer and probe sequences are shown in Table 3:
[0074] Table 3
[0075]
[0076]
[0077]
[0078] The sequence of the amplified fragment is as follows:
[0079] Pseudomonas aeruginosa:
[0080] CCACTCTGCAATCCAGTTCATAAATCCCATAAAAGCCCTCTTCCGCTCCCCGCCAGCCTCCCCGCATCCCGCA CCCTAGACGCCCCGCCGCTCTCCGCCGGCTCGCCCGACAAGAAAAACCAACCGC(SEQ ID NO:87)
[0081] Escherichia coli:
[0082] TCCGAAGAGGATTCACAAGAACATACCGGCAGTCAGTTGCGTATTGCGGCGTATGGCC(SEQ ID NO:88)
[0083] Klebsiella pneumoniae:
[0084] CATAATGTCGCAAGACCAAAGTGGGGGACCTTCGGGCCTCATGCCATCAGATGTGCCCAGATGG(SEQID NO:89)
[0085] Acinetobacter baumannii:
[0086] TTCATGTGCGGCTTTAGTGAGTCATTCTGCATTTGCAGCAGACTTGGAAGCCGACATGAAAACTT(SEQID NO:90)
[0087] CoNS:
[0088] CAGTTGAAGGGACAGATTTAGAAGCTAAATCAATCGAAGAAATTGTTGCTAATTTAGATAGTGTGCCATCTAA TATTCAAACAGCTGTTCGTAATAATGGCGGTGG (SEQ ID NO:91)
[0089] Listeria monocytogenes:
[0090] ATGGCACCACCAGCATCTCCGCCTGCAAGTCCTAAGACGCCAATCGAAAAGAAACACGCGGAT(SEQID NO:92)
[0091] Haemophilus influenzae:
[0092] TGCTGATCTTCAACAACGTTACAATACCGTTTATTTCGGTTTTGATAAATATGACATTACTGGTGAATACGTT CAAATCTTAGACGCACACGCTGCATATTTAAATGCAACGCCAGCTG (SEQ ID NO:93)
[0093] Staphylococcus aureus:
[0094] CGTCACGGTTTTAGATTCTTCTAAATCATATTTTGGTTTCTCCTAAACGGTAATCCACAAACTCTAATGACAA ATTACCAGT(SEQ ID NO:94)
[0095] Enterococci:
[0096] GCACCGCGGGTCCATCCATCAGCGACACCCGAAAGCGCCTTTCACTCTTATGC(SEQ ID NO:95)
[0097] Candida:
[0098] TCGGCACCTTACGAGAAATCAAAGTCTTTGGGTTCTGGGGGGAGTATGGTCGCAAGGCTGAAA(SEQID NO:96)
[0099] Streptococcus:
[0100] CAACCGCTGCATAGGTCTCAGCATTCCAACCGCCCCCAACGTCCCAGGCACCATTATC(SEQ ID NO:97)
[0101] Mycobacterium tuberculosis:
[0102] GGGCGCGGGATTGGTGCGGGCGATTTGCTCGCGCACATGCAAGCAAATCGAACGCCGGGAGATTA(SEQID NO:98)
[0103] Neisseria meningitidis:
[0104] GAAACGAGCGAAAGTCGGATATGCGGATAGCGTTCGTTGAATTTTGTTGCCAGCGGC (SEQ ID NO:99)
[0105] Cryptococcus:
[0106] TGGTCATGATGTCTGTCCAAGTCTTCATGCTTGCTCTCGTATTCCTCGGTACTCTTAACAAGCAACTTACCGT CTGCA(SEQ ID NO:100)
[0107] HSV-2 plasmid:
[0108] CGTCGTCTGCGCCAAATACGCCTTAGCAGACCCCTCGCTTAAGATGGCCGATCCC (SEQ ID NO:101)
[0109] EBV-plasmid:
[0110] GGCCCCCCGGTATCGGGCCAGAGGTAAGTGGACTTTAATTTTTTCTGCTAAGCCCAACACTCC(SEQID NO:102)
[0111] HHV-6 plasmid:
[0112] GTGTAAGCGTGTGGTAATGGACTAAGTGTGCGTTATTTTCTGTATTAATTTTTTGTTTCTGAAAATAAAATTG AATTGATAGTACTTACGTGTGTATTGTAGCAGCTGG(SEQ ID NO:103)
[0113] CMV plasmid:
[0114] TGCCGCCAGTCGTAACGATTCACGGAGCACCAGCCGAACGTGGTGATCCGCCGATCGATG(SEQ IDNO:104)
[0115] VZV plasmid:
[0116] CAGATTATCCGACATGCAGTCAATTTCAACGTCGCTTAACGTTAATTGGCGACTTGCCGG(SEQ IDNO:105)
[0117] HSV-1 plasmid:
[0118] TCGTCGTCAGCACCGTCATCCACACCTTATCGTTTTTGTGTATTGGTGCGATGGCGAC(SEQ ID NO:106)
[0119] KPC plasmid:
[0120] GCCGTGCAATACAGTGATAACGCCGCCGCCAATTTGTTGCTGAAGGAGTTGGGCGGCC(SEQ ID NO:107)
[0121] MecA plasmid:
[0122] CATTCTTTGGAACGATGCCTATCTCATATGCTGTTCCTGTATTGGCCAATTCCACATTGTTTCGGT(SEQ ID NO:108)
[0123] OXA-48 plasmid:
[0124] GGGCGAACCAAGCATTTTTACCCGCATCTACCTTTAAAATTCCCAATAGCTTGATCGC(SEQ ID NO:109)
[0125] NDM plasmid:
[0126] GACCGCCCAGATCCTCAACTGGATCAAGCAGGAGATCAACCTGCCGGTCGCG(SEQ ID NO:110)
[0127] IMP- plasmid:
[0128] TGGTTGTTCCAAGTCACAGTGAAGCTGGAGACGCATCACTCTTGAAACTTACATTAGAGCAGGCGG(SEQ ID NO:111)
[0129] vanA plasmid:
[0130] GCCGGAAAAAGGCTCTGAAAACGCAGTTATAACCGTTCCCGCAGACCTTTCAGCAGAGGAGCGAGGA (SEQ ID NO: 112)
[0131] vanM plasmid:
[0132] GCCAGCGTTTTTCGCAATAATATATGCCAGTGATTTGTCCATACAAACCGCCGAACTTTGAATATCACAGCCT ACATAAGGTATCCAGACAATTCAAATAATCCTTGTTATGGCGC (SEQ ID NO: 113)
[0133] Internal control plasmid:
[0134] TGAATTTGCAATTGCCCCACCCCCATTTCAGCGTGAAGCGCTTTTCACTAGTTTGCGACATCTCAAACCACAC TGCGCCAAGAGAGGAAACGGTTTC (SEQ ID NO: 114)
[0135] It should be understood that the expression “one or more of…” individually includes each of the objects described after the expression, as well as various different combinations of two or more of the described objects, unless otherwise understood from the context and usage. The expression “and / or” combined with three or more described objects should be understood to have the same meaning, unless otherwise understood from the context.
[0136] The terms “including,” “having,” or “containing,” including the use of their grammatical synonyms, should generally be understood as open-ended and non-restrictive, for example, not excluding other unstated elements or steps, unless otherwise specifically stated or understood from the context.
[0137] It should be understood that the order of the steps or the order in which certain actions are performed is not important as long as the invention remains operational. Furthermore, two or more steps or actions can be performed simultaneously.
[0138] The use of any and all instances or exemplary language such as “e.g.” or “including” in this document is merely intended to better illustrate the invention and is not intended to limit the scope of the invention unless the claims are made. No language in this specification should be construed as indicating that any unclaimed element is essential to the practice of the invention.
[0139] Furthermore, the numerical ranges and parameters used to define the present invention are approximate values, and the relevant values in the specific embodiments have been presented as precisely as possible. However, any value inevitably contains standard deviations due to individual test methods. Therefore, unless explicitly stated otherwise, it should be understood that all ranges, quantities, values, and percentages used in this disclosure are modified with the word "approximately." Here, "approximately" generally means an actual value within plus or minus 10%, 5%, 1%, or 0.5% of a particular value or range.
[0140] Unless otherwise specified, the raw materials, reagents, consumables and instruments involved in this invention are all commercially available products and can be purchased from the market.
[0141] The 5×ddPCR mix mentioned in the examples is a reaction premix for droplet digital PCR independently developed and sold by Leading Gene.
[0142] The present invention will be further illustrated below with reference to the embodiments:
[0143] Example 1: Primer and probe concentration optimization
[0144] Taking Panel 1 as an example, the primer and probe sequences are shown in Table 2, and the concentration combinations of each primer and probe are shown in Tables 4 and 5:
[0145] Table 4
[0146]
[0147] Table 5
[0148]
[0149] (1) The reaction system is prepared as shown in Table 6:
[0150] Table 6
[0151]
[0152]
[0153] The primer-probe mixture 1 is a mixture of primers and probes containing Panel 1;
[0154] The templates were obtained by mixing plasmids of Pseudomonas aeruginosa, HSV-1, and Listeria monocytogenes after a certain dilution.
[0155] (2) Sample addition: Take 15 μl of the reaction system and add it into the microfluidic chip sample inlet cup. Cap the oil reservoir cup and place the chip in the sample preparation instrument for droplet preparation.
[0156] (3) PCR amplification: After the droplet preparation is completed, the chip is transferred to the PCR amplification instrument, and the amplification program is set to perform PCR amplification. The amplification conditions are: 95℃ for 5 min, 95℃ for 15 s, 60℃ for 30 s, 40 cycles.
[0157] (4) Reading and analysis: After amplification, remove the chip and place it in the biochip reader. Set the scanning channels FAM, VIC, ROX, CY5, CY5.5, CY7, and A425. Position the channel VIC, select the chip to be scanned, and complete the chip scanning and analysis.
[0158] (5) The analysis results are shown in Table 7:
[0159] Table 7
[0160] target Detection values for combination 1 (copies / μl) Combination 2 detection values (copies / μl) Pseudomonas aeruginosa 115.32 97.59 HSV-1 103.19 88.62 Listeria monocytogenes 127.07 110.80
[0161] (6) Two-dimensional scatter plot as shown Figure 3 , Figure 4 As shown in the two-dimensional scatter plot, the scatter plot partitioning is better when the primer and probe concentrations for Pseudomonas aeruginosa are 1000 nM and 300 nM, for HSV-1 are 800 nM and 200 nM, and for Listeria monocytogenes are 500 nM and 100 nM.
[0162] Example 2: Optimization of Amplification Conditions
[0163] Amplification conditions 1: 95℃ for 5 min, 95℃ for 15 s, 60℃ for 30 s, 40 cycles;
[0164] Amplification condition 2: 95℃ for 5 min, 95℃ for 15 s, 58℃ for 30 s, 40 cycles;
[0165] Amplification condition 3: 95℃ for 5 min, 95℃ for 15 s, 62℃ for 30 s, 40 cycles;
[0166] The reaction system was prepared in the same way as in Example 1, and the primer and probe concentrations were as shown in Tables 1 and 2. The detection was carried out according to the digital PCR operating procedure in Example 1. PCR amplification was performed using amplification conditions 1, 2, and 3, respectively, and the analysis results are shown in Table 8.
[0167] Table 8
[0168]
[0169] Example 3: Repeatability Test
[0170] (1) The reaction system is prepared as shown in Table 9:
[0171] Table 9
[0172]
[0173]
[0174] The primer-probe mixture 1 is a mixture containing the primers and probes shown in Table 1;
[0175] The primer-probe mixture 2 is a mixture containing the primers and probes shown in Table 2;
[0176] Template 1 is a mixture of plasmids from Pseudomonas aeruginosa, HSV-1, Klebsiella pneumoniae, EBV, CoNS, and Listeria monocytogenes after a certain dilution.
[0177] Template 2 is a mixture of plasmids from Staphylococcus aureus, KPC, Enterococcus, OXA-48, and Neisseria meningitidis after a certain degree of dilution.
[0178] (2) The experiment was carried out according to the digital PCR operating procedure in Example 1. Each panel was tested 10 times, and the coefficient of variation (CV) of the detection results of each target was calculated.
[0179] (3) Test results
[0180] The test results for Panel 1 are shown in Table 10:
[0181] Table 10
[0182]
[0183] The test results for Panel 2 are shown in Table 11:
[0184] Table 11
[0185]
[0186] For both detection panels, the repeatability CV was <10%.
[0187] Example 4: Specificity Test
[0188] Nucleic acid extracted from bacterial suspensions or purchased standards corresponding to *Pseudomonas aeruginosa*, *Escherichia coli*, *Klebsiella pneumoniae*, *Acinetobacter baumannii*, *Staphylococcus epidermidis*, *Haemophilus influenzae*, *Listeria monocytogenes*, *Staphylococcus aureus*, *Candida albicans*, *Enterococcus faecalis*, *Streptococcus pneumoniae*, *Mycobacterium tuberculosis*, *Cryptococcus neoformans*, *Neisseria meningitidis*, HSV-1, HSV-2, VZV, EBV, CMV, and HHV-6 was diluted to 0.1 ng / μl. Taking *Pseudomonas aeruginosa* as an example, when verifying the specificity of *Pseudomonas aeruginosa*, equal volumes of nucleic acids corresponding to other targets (excluding *Pseudomonas aeruginosa*) were mixed as templates and detected using Panel 1. The primer and probe concentrations were the same as in Table 1 or Table 2, the reaction system was the same as in Example 2, the amplification conditions were the same as in Example 1, and the digital PCR operation steps were the same as in Example 1. Similarly, the specificity of other targets was also tested using this method. The results of the specificity test are shown in Table 12.
[0189] Table 12
[0190] target Output values (copies / μl) Remark Pseudomonas aeruginosa 0.09 Negative Escherichia coli 0 Negative Klebsiella pneumoniae 0 Negative Acinetobacter baumannii 0 Negative CoNS 0.18 Negative Haemophilus influenzae 0 Negative Listeria monocytogenes 0 Negative HSV-1 / -2 0.09 Negative VZV 0 Negative EBV 0 Negative CMV 0.09 Negative HHV-6 0.09 Negative Staphylococcus aureus 0 Negative Candida 0.18 Negative Enterococcus 0.09 Negative Streptococcus 0.21 Negative Mycobacterium tuberculosis 0 Negative Cryptococcus 0 Negative Neisseria meningitidis 0 Negative
[0191] For the specificity verification of drug resistance genes, strains or synthesized plasmids expressing KPC, mecA, OXA-48, NDM, vanA, or vanM were selected respectively. The nucleic acids were diluted to a certain extent. Taking KPC as an example, when verifying the specificity of KPC, other plasmids or nucleic acids besides KPC were mixed and detected using Panel 1. The primer and probe concentrations were the same as in Table 1 or Table 2, the reaction system was the same as in Example 2, the amplification conditions were the same as in Example 1, and the digital PCR operation steps were the same as in Example 1. The method for verifying whether KPC has any overlap with other drug resistance sites was also used. Similarly, the specificity verification of other targets was performed using the same method. The specific detection results are shown in Table 13.
[0192] Table 13
[0193]
[0194]
[0195] Example 5: Sensitivity Test
[0196] Taking *Pseudomonas aeruginosa* as an example, the nucleic acid extracted from the *Pseudomonas aeruginosa* bacterial culture was appropriately diluted to a concentration of 60 copies / μl, denoted as S1. Then, it was diluted again to obtain S2 (30 copies / μl), S3 (15 copies / μl), S4 (10 copies / μl), and S5 (5 copies / μl). Panel 1 was used to detect S1, S2, S3, S4, and S5 respectively. 1 μl of nucleic acid was loaded, and the primer and probe concentrations were the same as in Table 1 or Table 2. The reaction system was the same as in Example 2, the amplification conditions were the same as in Example 1, and the digital PCR operation steps were the same as in Example 1. Each step was repeated 5 times. The detection results are shown in Table 14.
[0197] Table 14
[0198]
[0199] The lowest concentration that can be detected with 100% accuracy is taken as the LOD. The LOD for Pseudomonas aeruginosa is 15 copies / reaction. The LOD values for other targets were measured using the same method, as shown in Table 15.
[0200] Table 15
[0201]
[0202]
[0203] Example 6: Clinical Sample Testing
[0204] Five cerebrospinal fluid samples (≥1 ml each) were collected, one positive and one negative. Digital PCR was performed using Panel 1 and Panel 2, respectively. The primer and probe concentrations were the same as in Table 1 or Table 2. The reaction system was the same as in Example 2, the amplification conditions were the same as in Example 1, and the digital PCR operation steps were the same as in Example 1. The detection results are shown in Table 16.
[0205] Table 16
[0206] Serial Number Digital PCR test results Culture results 1 CoNS, 78.44 copies / μl Staphylococcus epidermidis 2 Cryptococcus, 2.72 copies / μl Cryptococcus neoformans 3 Klebsiella pneumoniae, 60.06 copies / μl Klebsiella pneumoniae 4 Escherichia coli, 131.27 copies / μl E. coli 5 Enterococcus faecalis, 44.2 copies / μl Enterococcus faecalis 6 Negative Negative 7 Negative Negative 8 Negative Negative 9 Negative Negative 10 Negative Negative
[0207] The results of digital PCR detection were 100% consistent with those of the culture method.
[0208] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.
Claims
1. A nucleic acid molecule assembly, characterized in that, Including nucleic acid molecule X; The nucleic acid molecule X has: (1) A nucleotide sequence as shown in SEQ ID NO:X; or (2) A nucleotide sequence obtained by substituting, deleting, or adding one or more bases to the nucleotide sequence shown in (1), and whose function is the same as or similar to that of (1); or (3) A nucleotide sequence that is at least 90% homologous to the nucleotide sequence shown in (1) or (2); X is selected from any integer from 1 to 83; The number of items is 2 to 5.
2. The nucleic acid molecule combination as described in claim 1, characterized in that, include: Nucleic acid molecule 1 with sequence SEQ ID NO:1, 2 with sequence SEQ ID NO:2, 3 with sequence SEQ ID NO:3, 4 with sequence SEQ ID NO:4, 5 with sequence SEQ ID NO:5, 6 with sequence SEQ ID NO:6, 7 with sequence SEQ ID NO:7, 8 with sequence SEQ ID NO:8, 9 with sequence SEQ ID NO:9, 10 with sequence SEQ ID NO:10, 11 with sequence SEQ ID NO:11, 12 with sequence SEQ ID NO:12, 13 with sequence SEQ ID NO:13, 14 with sequence SEQ ID NO:14, 15 with sequence SEQ ID NO:15, 16 with sequence SEQ ID NO:16, 17 with sequence SEQ ID NO:17, 18 with sequence SEQ ID NO:18, and 19 with sequence SEQ ID NO:
19. Nucleic acid molecule 19 with sequence NO:19, nucleic acid molecule 20 with sequence NO:20, nucleic acid molecule 21 with sequence NO:21, nucleic acid molecule 22 with sequence NO:22, nucleic acid molecule 23 with sequence NO:23, nucleic acid molecule 24 with sequence NO:24, nucleic acid molecule 25 with sequence NO:25, nucleic acid molecule 26 with sequence NO:26, nucleic acid molecule 27 with sequence NO:27, nucleic acid molecule 28 with sequence NO:28, nucleic acid molecule 29 with sequence NO:29, nucleic acid molecule 30 with sequence NO:30, nucleic acid molecule 31 with sequence NO:31, nucleic acid molecule 32 with sequence NO:32, nucleic acid molecule 33 with sequence NO:33, nucleic acid molecule 34 with sequence NO:34, nucleic acid molecule 35 with sequence NO:35, and nucleic acid molecule 36 with sequence NO:27, nucleic acid molecule 27 with sequence NO:28, nucleic acid molecule 29 with sequence NO:29, nucleic acid molecule 30 with sequence NO:30, nucleic acid molecule 31 with sequence NO:31, nucleic acid molecule 32 with sequence NO:32, nucleic acid molecule 33 with sequence NO:33, nucleic acid molecule 34 with sequence NO:34, nucleic acid molecule 35 with sequence NO:35, and nucleic acid molecule 36 with sequence NO:27, nucleic acid molecule 28 with sequence NO:28, nucleic acid molecule 29 with sequence NO:29, nucleic acid molecule 35 with sequence NO:29, nucleic acid molecule 36 with sequence NO:27, nucleic acid molecule 28 with sequence NO:28, nucleic acid molecule 29 ... Nucleic acid molecule 36 with sequence NO:36, nucleic acid molecule 37 with sequence NO:37, nucleic acid molecule 38 with sequence NO:38, nucleic acid molecule 39 with sequence NO:39, nucleic acid molecule 40 with sequence NO:40, nucleic acid molecule 41 with sequence NO:41, nucleic acid molecule 42 with sequence NO:42, nucleic acid molecule 43 with sequence NO:43, nucleic acid molecule 44 with sequence NO:44, and nucleic acid molecule 45 with sequence NO:36.Nucleic acid molecule NO:45, 45; nucleic acid molecule with sequence SEQ ID NO:46, 46; nucleic acid molecule with sequence SEQ ID NO:47, 47; nucleic acid molecule with sequence SEQ ID NO:48, 48; nucleic acid molecule with sequence SEQ ID NO:49, 49; nucleic acid molecule with sequence SEQ ID NO:50, 50; nucleic acid molecule with sequence SEQ ID NO:51, 51; nucleic acid molecule with sequence SEQ ID NO:52, 52; nucleic acid molecule with sequence SEQ ID NO:53, 53; nucleic acid molecule with sequence SEQ ID NO:54, 54; nucleic acid molecule with sequence SEQ ID NO:55, 55; nucleic acid molecule with sequence SEQ ID NO:56, 56; nucleic acid molecule with sequence SEQ ID NO:57, 57; nucleic acid molecule with sequence SEQ ID NO:58, 58; nucleic acid molecule with sequence SEQ ID NO:59, 59; nucleic acid molecule with sequence SEQ ID NO:60, 60; nucleic acid molecule with sequence SEQ ID NO:61, 61; and nucleic acid molecule with sequence SEQ ID NO:
60. Nucleic acid molecule 62 with sequence NO:62, nucleic acid molecule 63 with sequence NO:63, nucleic acid molecule 64 with sequence NO:64, nucleic acid molecule 65 with sequence NO:65, nucleic acid molecule 66 with sequence NO:66, nucleic acid molecule 67 with sequence NO:67, nucleic acid molecule 68 with sequence NO:68, nucleic acid molecule 69 with sequence NO:69, nucleic acid molecule 70 with sequence NO:70, nucleic acid molecule 71 with sequence NO:71, nucleic acid molecule 72 with sequence NO:72, nucleic acid molecule 73 with sequence NO:73, nucleic acid molecule 74 with sequence NO:74, nucleic acid molecule 75 with sequence NO:75, nucleic acid molecule 76 with sequence NO:76, nucleic acid molecule 77 with sequence NO:77, nucleic acid molecule 78 with sequence NO:79, nucleic acid molecule 79 with sequence NO:70, nucleic acid molecule 70 with sequence NO:70, nucleic acid molecule 71 with sequence NO:71, nucleic acid molecule 72 with sequence NO:72, nucleic acid molecule 73 with sequence NO:73, nucleic acid molecule 74 with sequence NO:74, nucleic acid molecule 75 with sequence NO:75, nucleic acid molecule 76 with sequence NO:76, nucleic acid molecule 77 with sequence NO:77, nucleic acid molecule 78 with sequence NO:79, nucleic acid molecule 79 with sequence NO:79, nucleic acid molecule 70 ...0 with sequence NO:79, nucleic acid molecule 70 with sequence NO:79, nucleic acid molecule 70 with sequence NO:79, nucleic acid molecule Two or more of the following: nucleic acid molecule 79 with ID NO: 79, nucleic acid molecule 80 with sequence SEQ ID NO: 80, nucleic acid molecule 81 with sequence SEQ ID NO: 81, nucleic acid molecule 82 with sequence SEQ ID NO: 82, or nucleic acid molecule 83 with sequence SEQ ID NO:
83.
3. The nucleic acid molecule combination as described in claim 2, characterized in that, Including one or more of the following combinations: Combination 1, Combination 2, Combination 3, Combination 4, Combination 5, Combination 6, Combination 7, Combination 8, Combination 9, Combination 10, Combination 11, Combination 12, Combination 13, Combination 14, Combination 15, Combination 16, Combination 17, Combination 18, Combination 19, Combination 20, Combination 21, Combination 22, Combination 23, Combination 24, Combination 25, Combination 26, or Combination 27; Combination 1 includes nucleic acid molecule 1, nucleic acid molecule 2, and nucleic acid molecule 3; Combination 2 includes nucleic acid molecule 4, nucleic acid molecule 5, and nucleic acid molecule 6; Combination 3 includes nucleic acid molecule 7, nucleic acid molecule 8, and nucleic acid molecule 9; Combination 4 includes nucleic acid molecule 10, nucleic acid molecule 11, and nucleic acid molecule 12; Combination 5 includes nucleic acid molecule 13, nucleic acid molecule 14, and nucleic acid molecule 15; Combination 6 includes nucleic acid molecule 16, nucleic acid molecule 17, and nucleic acid molecule 18; Combination 7 includes nucleic acid molecule 19, nucleic acid molecule 20, nucleic acid molecule 21, and nucleic acid molecule 22. Combination 8 includes nucleic acid molecules 23, 24, and 25; combination 9 includes nucleic acid molecules 26, 27, and 28; combination 10 includes nucleic acid molecules 29, 30, and 31; combination 11 includes nucleic acid molecules 32, 33, and 34; combination 12 includes nucleic acid molecules 35, 36, and 37; combination 13 includes nucleic acid molecules 38, 39, and 40; combination 14 includes nucleic acid molecules 41, 42, and 25. Acid molecule 43 and nucleic acid molecule 44; combination 15 includes nucleic acid molecule 45, nucleic acid molecule 46 and nucleic acid molecule 47; combination 16 includes nucleic acid molecule 48, nucleic acid molecule 49 and nucleic acid molecule 50; combination 17 includes nucleic acid molecule 51, nucleic acid molecule 52 and nucleic acid molecule 53; combination 18 includes nucleic acid molecule 54, nucleic acid molecule 55 and nucleic acid molecule 56; combination 19 includes nucleic acid molecule 57, nucleic acid molecule 58 and nucleic acid molecule 59; combination 20 includes nucleic acid molecule 60, nucleic acid molecule 61 and nucleic acid molecule 62; combination 21 includes Nucleic acid molecules 63, 64, and 65; combination 22 includes nucleic acid molecules 66, 67, and 68; combination 23 includes nucleic acid molecules 69, 70, and 71; combination 24 includes nucleic acid molecules 72, 73, and 74; combination 25 includes nucleic acid molecules 75, 76, and 77; combination 26 includes nucleic acid molecules 78, 79, and 80; combination 27 includes nucleic acid molecules 81, 82, and 83.
4. The nucleic acid molecule combination as described in claim 3, characterized in that, include: The 5' ends of nucleic acid molecules 3, 22, 25, 43, 47, 50, and 65 are modified with FAM. The 5' ends of nucleic acid molecules 6, 21, 28, 40, 44, 53, and 68 are modified with VIC. The 5' ends of nucleic acid molecule 9, nucleic acid molecule 31, nucleic acid molecule 56, and nucleic acid molecule 71 are modified with ROX; The 5' ends of nucleic acid molecules 12, 34, 59, 74, and 77 are modified with CY5. The 5' ends of nucleic acid molecules 15, 37, 62, 80, and 83 are modified with CY5.
5. The 5' end of the nucleic acid molecule 18 is modified with CY7.
5. The nucleic acid molecule combination as described in claim 3 or 4, characterized in that, include: The 3' ends of nucleic acid molecules 3, 6, 9, 12, 21, 22, 25, 28, 31, 34, 43, 44, 47, 50, 53, 56, 59, 65, 68, 71, 74, and 77 are modified with MGB. The 3' ends of nucleic acid molecules 15, 18, 37, 40, 62, 80, and 83 are modified with BHQ3.
6. The nucleic acid molecule combination according to any one of claims 1 to 5, characterized in that, include: The nucleic acid molecules 1, 2, 4, 5, 7, 8, 10, 11, 13, 14, 16, 17, 19, 20, 23, 24, 26, 27, 29, 30, 32, 33, 35, 36, 38, 39, 41, and 42 are described. 45, the nucleic acid molecules 46, 48, 49, 51, 52, 54, 55, 57, 58, 60, 61, 63, 64, 66, 67, 69, 70, 72, 73, 75, 76, 78, 79, 81, 82, 84, and 85 are primers; and / or The nucleic acid molecules 3, 6, 9, 12, 15, 18, 21, 22, 25, 28, 31, 34, 37, 40, 43, 44, 47, 50, 53, 56, 59, 62, 65, 68, 71, 74, 77, 80, 83, and 86 are probes; and / or The nucleic acid molecule assembly also includes a primer and probe set as an internal control.
7. The use of the nucleic acid molecule combination according to any one of claims 1 to 6 in any of the following: (1) Detection of pathogenic microorganisms causing central nervous system infections; (2) Detection of drug resistance genes; (3) Detect pathogenic microorganisms and drug resistance genes in the central nervous system; (4) Prepare products for detecting pathogenic microorganisms that infect the central nervous system; (5) Prepare products for detecting drug resistance genes; (6) Prepare products for detecting pathogenic microorganisms and drug resistance genes in the central nervous system; The pathogenic microorganisms causing central nervous system infections include one or more of the following: Pseudomonas aeruginosa, Escherichia coli, Klebsiella pneumoniae, Acinetobacter baumannii, CoNS, Staphylococcus aureus, Enterococcus, Streptococcus, Listeria monocytogenes, Haemophilus influenzae, Mycobacterium tuberculosis, Neisseria meningitidis, Candida albicans, Cryptococcus, Herpesvirus 1, Herpesvirus 2, Herpesvirus 3, Herpesvirus 4, Herpesvirus 5, or Herpesvirus 6. The drug resistance genes include one or more of KPC, mecA, OXA-48, NDM, IMP, vanA, or vanM; The products include reagents, reagent kits, or devices.
8. A product for detecting pathogenic microorganisms and / or drug resistance genes causing central nervous system infections, characterized in that, Includes nucleic acid molecule combinations as described in any one of claims 1 to 6, and acceptable excipients, auxiliaries, or components; The products include reagents, reagent kits, or devices.
9. The product as described in claim 8, characterized in that, include: The concentrations of nucleic acid molecule 21, nucleic acid molecule 22, nucleic acid molecule 43, and nucleic acid molecule 44 in the reaction system are 100 nM; The concentration of nucleic acid molecule 47, nucleic acid molecule 50, nucleic acid molecule 53, nucleic acid molecule 56, nucleic acid molecule 59, nucleic acid molecule 62, nucleic acid molecule 65, nucleic acid molecule 68, nucleic acid molecule 71, nucleic acid molecule 74, nucleic acid molecule 77, nucleic acid molecule 80, and nucleic acid molecule 83 in the reaction system is 200 nM; The concentration of nucleic acid molecule 3, nucleic acid molecule 6, nucleic acid molecule 9, nucleic acid molecule 12, nucleic acid molecule 15, nucleic acid molecule 18, nucleic acid molecule 25, nucleic acid molecule 28, nucleic acid molecule 31, nucleic acid molecule 34, nucleic acid molecule 37 and nucleic acid molecule 40 in the reaction system is 300 nM; The concentrations of nucleic acid molecule 19, nucleic acid molecule 20, nucleic acid molecule 41, and nucleic acid molecule 42 in the reaction system are 500 nM; The concentration of nucleic acid molecules 45, 46, 48, 49, 51, 52, 54, 55, 57, 58, 60, 61, 63, 64, 66, 67, 69, 70, 72, 73, 75, 76, 78, 79, 81, and 82 in the reaction system is 800 nM. The concentration of nucleic acid molecule 1, nucleic acid molecule 2, nucleic acid molecule 4, nucleic acid molecule 5, nucleic acid molecule 7, nucleic acid molecule 8, nucleic acid molecule 10, nucleic acid molecule 11, nucleic acid molecule 13, nucleic acid molecule 14, nucleic acid molecule 16, nucleic acid molecule 17, nucleic acid molecule 23, nucleic acid molecule 24, nucleic acid molecule 26, nucleic acid molecule 27, nucleic acid molecule 29, nucleic acid molecule 30, nucleic acid molecule 32, nucleic acid molecule 33, nucleic acid molecule 35, nucleic acid molecule 36, nucleic acid molecule 38, and nucleic acid molecule 39 in the reaction system is 1000 nM.
10. A digital PCR detection method, characterized in that, Different detection items are distinguished based on primer and probe concentration gradients and fluorescence channels; The number of the detection items is M×(2) N -1), where M is the number of primer-probe concentration gradients and N is the number of fluorescence channels.