Gene therapy medicine aiming at genetic retinal dystrophy related to RLBP1 gene variation and application of gene therapy medicine
By injecting codon-optimized human RLBP1-cDNA into the intravitreal space using a modified AAV vector, the RLBP1 protein is expressed, solving the treatment challenge of hereditary retinal dystrophy related to RLBP1 gene mutation, improving visual function and slowing disease progression.
Patent Information
- Application Number
- CN202511123577.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-08-12
- Publication Date
- 2025-11-14
- Estimated Expiration
- 2045-08-12
AI Technical Summary
There is a lack of effective treatments in the current technology to treat hereditary retinal dystrophy associated with RLBP1 gene mutations, which leads to symptoms such as decreased vision and visual field defects, seriously affecting patients' quality of life.
A modified AAV vector was used to carry codon-optimized human RLBP1-cDNA, which was then injected intravitreal to express the complete RLBP1 protein, participate in the visual circulation pathway, and rescue retinal function.
Gene therapy drugs improve retinal function, enhance patients' vision, or slow disease progression, reducing the difficulty of treatment procedures and increasing patient compliance.
Smart Images

Figure CN120944894A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biopharmaceuticals, and specifically to a method for... RLBP1 Gene therapy drugs for hereditary retinal dystrophy related to gene mutations and their applications. Specifically, it involves a recombinant adeno-associated virus vector carrying a human RLBP1 coding sequence expression cassette, and a gene drug containing the said gene expression cassette, belonging to the field of biotechnology. Background Technology
[0002] Hereditary retinal dystrophy (IRD) is the most common irreversible blinding eye disease, characterized by degeneration of photoreceptor cells and / or retinal pigment epithelial cells (RPE). Major clinical manifestations include decreased vision, night blindness, and visual field defects. This disease exhibits clinical and genetic heterogeneity; more than 300 pathogenic genes have been identified, and most lack effective treatments.
[0003] RLBP1 Retinal variation-associated retinal disease (RLBP1-IRD) includes various clinical phenotypes, such as retinal dystrophy of Bothnia, cone-and-bar cell dystrophy of Newfoundland, retinitis pigmentosa, and punctate retinal degeneration, all of which are inherited in an autosomal recessive manner. The clinically characteristic features of RLBP1-IRD are delayed dark adaptation, progressive visual loss, visual field defects, and abnormal electroretinograms. There is currently no effective treatment for this disease, and in its late stages, it severely impacts the quality of life of patients, placing a heavy burden on their families and society.
[0004] Therefore, the present invention aims to provide a gene therapy drug targeting RLBP1-IRD to solve the above-mentioned problems. Summary of the Invention
[0005] The purpose of this invention is to solve the above-mentioned problems and provide a solution for... RLBP1 Gene therapy drugs for hereditary retinal dystrophy related to gene mutations utilize a modified AAV vector to package codon-optimized human RLBP1-cDNA, followed by intravitreal injection. This allows for the expression of the complete and active RLBP1 protein, which participates in the visual circulation pathway, rescuing retinal dystrophy caused by gene mutations. RLBP1 Gene mutations causing retinal dysfunction can improve a patient's visual function or slow disease progression.
[0006] To achieve the above objectives, the technical solution of the present invention is as follows: A first aspect of the present invention is to provide a gene expression cassette comprising a coding sequence for retinaldehyde-binding protein 1, and optionally, a promoter, an enhancer, and / or an intron; Preferably, the coding sequence of the retinaldehyde-binding protein 1 comprises the sequence shown in SEQ ID NO:2 or a sequence having at least 85% identity with the sequence shown in SEQ ID NO:2.
[0007] Preferably, the promoter comprises a sequence as described in SEQ ID NO:4 or a sequence having at least 85% identity with it.
[0008] The enhancers include CMV / IE enhancers; Preferably, the CMV / IE enhancer comprises a sequence as described in SEQ ID NO:3 or a sequence having at least 85% identity with it.
[0009] Preferably, the introns include CB introns and / or human β-globulin introns; More preferably, the CB intron comprises a sequence as described in SEQ ID NO:5 or a sequence having at least 85% identity with it; More preferably, the human β-globulin intron comprises a sequence as described in SEQ ID NO:6 or a sequence having at least 85% identity with it.
[0010] Preferably, the gene expression cassette further includes a polyadenylation region; Optionally, the polyadenylation region is selected from human growth hormone or the polyadenylation region of SV40; More preferably, the SV40 polyadenylation region includes the sequence shown in SEQ ID NO:7 or a sequence having at least 85% identity with it.
[0011] Preferably, the polyadenylation region includes the human growth hormone polyadenylation region; More preferably, the human growth hormone polyadenylation region includes the sequence shown in SEQ ID NO:8 or a sequence having at least 85% identity with it.
[0012] Preferably, the structure of the gene expression cassette is as follows: [Promoter] - [Coding sequence of retinaldehyde-binding protein 1] - [Polyadecylate region]; The preferred sequence is [enhancer]-[promoter]-[coding sequence of retinaldehyde-binding protein 1]-[polyadenylation region]; More preferably, it is [enhancer]-[promoter]-[intron]-[coding sequence of retinaldehyde-binding protein 1]-[polyadenylation region].
[0013] More preferably, the nucleotide sequence of the gene expression cassette is shown in SEQ ID NO:10~11.
[0014] A second aspect of the present invention is to provide a gene delivery vector comprising the gene expression cassette described in the first aspect above.
[0015] Preferably, the gene delivery vector is a viral vector derived from a virus; Preferably, the gene delivery vector is a recombinant adeno-associated virus.
[0016] Preferably, the recombinant adeno-associated virus comprises a capsid protein, and the gene expression cassette is capsided within the capsid protein; Optionally, the capsid protein is selected from any one of the adeno-associated virus serotypes AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9 and AAV10 or a variant thereof.
[0017] Preferably, the capsid protein is an AAV2 capsid protein variant; More preferably, the AAV2 capsid protein variant comprises a sequence as shown in SEQ ID NO:12, or a sequence having at least 85% identity with SEQ ID NO:12.
[0018] A third aspect of the present invention is to provide a pharmaceutical composition comprising a gene expression cassette as described in the first aspect or a gene delivery vector as described in the second aspect. And, optionally, pharmaceutically acceptable carriers.
[0019] Use of the gene expression cassette as described in the first aspect above or the gene delivery vector as described in the second aspect above in the preparation of a medicament for treating a disease; Optionally, the disease is an eye disease; Preferably, the eye disease is an eye disease related to hereditary retinal dystrophy associated with RLBP1 gene mutations in the eye. More preferably, the eye disease is selected from one or more of Bothn retinal dystrophy, Newfoundland cone-rod cell dystrophy, white spot retinal degeneration, and retinitis pigmentosa.
[0020] A fourth aspect of the present invention is a method of treating a disease, comprising administering to a subject a therapeutically effective amount of a gene expression cassette as described in the first aspect above, or a gene delivery vector as described in the second aspect above, or a pharmaceutical composition as described in the third aspect above. Optionally, the disease is an eye disease; Preferably, the eye disease is an eye disease related to hereditary retinal dystrophy associated with RLBP1 gene mutations in the eye. More preferably, the eye disease is selected from one or more of the following: Bothn retinal dystrophy, Newfoundland cone-rod cell dystrophy, white spot retinal degeneration, and retinitis pigmentosa.
[0021] A fifth aspect of the present invention is to provide a gene therapy pharmaceutical composition for hereditary retinal dystrophy associated with RLBP1 gene mutations, the gene therapy pharmaceutical composition comprising: a plasmid vector containing a codon-optimized RLBP1 coding sequence RLBP1 opt and a plasmid vector containing a coding sequence for a RepCap protein of serotype IVT18, wherein the codon-optimized RLBP1 sequence is shown in SEQ ID NO:2 and the sequence of the RepCap protein of IVT18 is shown in SEQ ID NO:12.
[0022] Furthermore, in the gene therapy drug composition, the plasmid vector of the gene is an adeno-associated virus (AAV) plasmid vector. Furthermore, the gene therapy drug composition further includes the pHelper plasmid; Furthermore, the plasmid vectors containing the codon-optimized RLBP1 sequence RLBP1 opt are pscAAV-pRLBP1 short-RLBP1 opt-SV40 pA and pscAAV-CMV / IE / CB-RLBP1 opt-hGH pA, and their expression cassette nucleotide sequences are shown in SEQ ID NO:10 and SEQ ID NO:11, respectively. Furthermore, the plasmid vector containing the coding sequence of the RepCap protein of serotype IVT18 is pAAV-RC2_IVT18, which is obtained by Gibson assembly of the coding sequence of the RC2_IVB-NotI plasmid shown in SEQ ID NO:13 and the nucleic acid sequence encoding RepCap of IVT18.
[0023] A sixth aspect of the present invention provides a gene therapy drug targeting RLBP1-IRD, wherein the gene therapy drug is obtained by transfecting cells with the plasmid vector described in the fifth aspect above and then undergoing a viral packaging process. Furthermore, the gene therapy drug is administered by injection, preferably by intravitreal injection.
[0024] A seventh aspect of the present invention is to provide a method for preparing a gene therapy drug targeting RLBP1-IRD as described in the sixth aspect, characterized in that the gene therapy drug is prepared by the following steps: S1. Obtain the CDS sequence from the mRNA sequence of human RLBP1 and optimize its codons to obtain RLBP1opt; S2. The RLBP1 opt sequence is seamlessly cloned into the AAV vector plasmid pscAAV-pRLBP1 short-GFP-SV40 pA carrying the green fluorescent protein reporter gene expression cassette, and the GFP sequence in pscAAV-pRLBP1 short-GFP-SV40 pA is replaced to obtain pscAAV-pRLBP1 short-RLBP1 opt-SV40 pA. The expression cassette of the pscAAV-pRLBP1 short-RLBP1 opt-SV40 pA vector plasmid is pRLBP1 short-RLBP1 opt-SV40 pA. The same method is used to obtain the vector plasmid pscAAV-CMV / IE / CB-RLBP1 opt-hGH pA containing another promoter, and its expression cassette is CMV / IE / CB-RLBP1 opt-hGH pA. S3. The RepCap coding sequence encoding IVT18 is assembled with the RC2_IVB-NotI plasmid using Gibson to obtain a plasmid vector containing the RepCap protein coding sequence, pAAV-RC2_IVT18. S4. Obtain recombinant AAV-RLBP1 gene therapy drugs through a three-plasmid packaging system.
[0025] Furthermore, the operation in step S4 is as follows: 1) HEK 293T cells were used as host cells for seeding; 2) Use polyethyleneimine to co-transfect HEK293T cells with pscAAV-pRLBP1 short-RLBP1 opt-SV40pA plasmid or pscAAV-CMV / IE / CB-RLBP1 opt-hGH pA plasmid, pAAV-RC2_IVT18 plasmid and pHelper plasmid in a mass ratio of 1:1:1.5~2. After transfection, culture and harvest cells and supernatant. 3) Collect and lyse cells, digest free DNA molecules, and precipitate the supernatant on ice. Mix the cell lysate and supernatant, centrifuge, collect the supernatant, and finally purify it by ultracentrifugation to obtain the rAAV_IVT18-RLBP1 gene therapy drug. Preferably, in step 1), transfection is performed after the cells have grown to a confluence of 70% to 80% during cell culture. Preferably, in step 2), cells are collected after culturing for 48-96 hours following transfection; more preferably, cells are collected after 72 hours. Preferably, in step 3), the cells are lysed using sodium deoxycholate with 0.5% (w / v) added; the cell-free DNA is digested by adding 50 U / mL Benzonase nuclease and 2 mM MgCl2, and incubating at 35-38 ℃ for 1-3 hours; the supernatant is prepared using a 1:5 volume ratio of 40% PEG8000 and 2.5M NaCl solution; and iodixanol is used for ultracentrifugation.
[0026] The eighth aspect of the present invention is to provide the use of the RLBP1-IRD gene therapeutic agent described in the fifth aspect in the preparation of a medicament for treating eye diseases caused by RLBP1 gene mutations; Furthermore, the RLBP1 gene mutation-related hereditary retinal dystrophy; preferably, the hereditary retinal dystrophy includes Bothnia retinal dystrophy, Newfoundland cone-and-bar cell dystrophy, white spot retinal degeneration, and retinitis pigmentosa.
[0027] The beneficial effects of this invention include: 1) By optimizing the RLBP1 coding sequence, a recombinant AAV vector was constructed, and a drug that can be used to treat hereditary retinal dystrophy related to RLBP1 gene mutation was obtained through viral packaging. After codon optimization, the gene expression efficiency in vivo was improved, and good therapeutic effects could be achieved with low dosage. 2) By using IVT18 RepCap protein as the capsid protein, highly penetrating AAV virus particles are obtained, which enables the gene therapy drug to achieve good infection efficiency through intravitreal injection alone, reducing the difficulty of drug administration and improving patient compliance. Attached Figure Description
[0028] Figure 1 This is a schematic diagram of the pscAAV-pRLBP1 short-RLBP1 opt-SV40 pA carrier structure in an embodiment of the present invention; Figure 2 This is a schematic diagram of the pscAAV-CMV / IE / CB-RLBP1 opt-hGH pA viral vector structure in an embodiment of the present invention; Figure 3 This is a schematic diagram illustrating protein expression in ARPE cells after infection with the viral vectors pscAAV-pRLBP1 short-RLBP1 cds-SV40 pA and pscAAV-pRLBP1 short-RLBP1 opt-SV40 pA in this embodiment of the invention. Figure 4This is a schematic diagram illustrating protein expression in the mouse retina after infection with the viral vectors pscAAV-pRLBP1 short-RLBP1 cds-SV40 pA, pscAAV-pRLBP1 short-RLBP1 opt-SV40 pA, and pscAAV-CMV / IE / CB-RLBP1 opt-hGH pA in the embodiments of the present invention. Figure 5 This is a schematic diagram of the identification results of Rlbp1 gene knockout mice in the embodiments of the present invention, wherein A and B are the detection results of Rlbp1 mRNA and protein expression levels in knockout mice and wild-type mice, respectively; Figure 6 This is a set of schematic diagrams of the retinal structures of wild-type and gene knockout mice in the embodiments of the present invention, wherein A is the outer nuclear layer of the retina under HE staining of paraffin sections, and B is a comparison of the number of cells in the outer nuclear layer of the retina of mice of different ages. Figure 7 This is a schematic diagram of the quantitative results of all-trans retinol, all-trans retinaldehyde, 11-cis retinol, and 11-cis retinaldehyde in wild-type and gene knockout mice under three conditions in the embodiments of the present invention. Figure 8 This is a set of schematic diagrams showing the results of optical coherence tomography (OCT) examination of the retina of wild-type and gene knockout mice in the embodiments of the present invention. In this diagram, A shows the structure of each layer of the retina by OCT, and B shows the comparison of the thickness of the outer nuclear layer of the retina of mice at different ages. Figure 9 This is a set of electro-retinogram (ERG) results of wild-type and gene knockout mice in the embodiments of the present invention. A shows the ERG waves under different light intensity stimuli for dark adaptation and light adaptation, with the horizontal axis representing different stimuli and the vertical axis representing the amplitude; B is a line graph of the dark adaptation recovery time of mice after photobleaching and the amplitude of the ERG a wave. Figure 10 This is a schematic diagram of the visual function test results of Rlbp1 gene knockout mice and wild-type mice after gene therapy with different doses of drugs in the embodiments of the present invention. A is a comparison of ERG a wave amplitude at 4, 8, 12 and 24 weeks after drug administration, and B is a comparison of dark adaptation recovery time of mice after 24 weeks of drug administration. Figure 11 This is a schematic diagram showing the results of retinal function testing in mice 4 weeks after administration of the three AAV molecules in this embodiment of the invention. Detailed Implementation
[0029] The following detailed embodiments further illustrate the concept and technical effects of the present invention to fully understand its purpose, features, and effects. Unless otherwise specified, all methods described are conventional methods. Unless otherwise specified, all materials are available from publicly available commercial sources. The illustrative embodiments and descriptions of the present invention are used to explain the invention and do not constitute an undue limitation thereof. It should be noted that, unless otherwise specified, the embodiments and features described in the present invention can be combined with each other.
[0030] Example 1: Construction of Viral Vector
[0031] 1) Experimental materials
[0032] Plasmid: pHelper plasmid, purchased from Cell Biolabs and stored here. This plasmid contains adenovirus-derived helper genes E2A, E4, and VARNA, which are required for the preparation of recombinant AAV virus by co-transfection of HEK293 (or HEK293T) cells with three plasmids; The RC plasmid pAAV2 / 8 used for packaging AAV8 was purchased from Addgene (catalog number: 112864), and the plasmid was derived from Professor James M. Wilson of the University of Pennsylvania; ARPE-19 cell line (ATCC, CRL-2302); All-trans retinaldehyde (Sigma-Aldrich, R2500); All-trans retinol (Sigma-Aldrich, 95144). Methanol (Sigma-Aldrich, 322415); Acetonitrile (Merck, 40064184); Methyl tert-butyl ether (Sigma-Aldrich, 650560); Compound tropicamide (Santen, J20180051); Carbomer Eye Drops (Bausch & Lomb, J20150018) RLBP1 antibody (Santa Cruz Biotechnology, sc-59487); β-Tubulin antibody (Proteintech, 66240); Secondary antibody-rabbit (Proteintech, PR30011); Secondary antibody-mouse (Proteintech, PR30012); Trizol (Invitrogen, 15596018CN); Reverse transcription kit (Takara, RR036A); qPCR kit (Vazyme, Q712); BCA kit (Thermo, 23227); The experimental group consisted of RLBP1- / - C57BL / 6J mice and wild-type mice (purchased from Cyagen Laboratory Animal Technology Co., Ltd.).
[0033] 2) Construction of plasmid vectors with codon and expression cassette optimization To construct an AAV vector plasmid carrying the human RLBP1 coding sequence expression cassette, this embodiment first optimized the open reading frame of the RLBP1 gene by codons and then optimized the promoter of the expression vector, and constructed the corresponding expression vector plasmids.
[0034] The specific process is as follows: The CDS sequence (SEQ ID NO:1) of human RLBP1 mRNA sequence (NM_152443.3) registered in NCBI was obtained. Codon optimization was performed to obtain the RLBP1 opt sequence (SEQ ID NO:2). The RLBP1 CDS and opt sequences were sent to General Biotechnology (Anhui) Co., Ltd. for synthesis and seamless cloning into the AAV vector plasmid pscAAV-pRLBP1 short-GFP-SV40 pA carrying a green fluorescent protein (GFP) reporter gene expression cassette, which was stored by the applicant. The GFP sequence was replaced to obtain pscAAV-pRLBP1 short-RLBP1cds-SV40 pA and pscAAV-pRLBP1 short-RLBP1 opt-SV40 pA. Figure 1 The expression cassettes for this vector plasmid are pRLBP1 short-RLBP1 cds-SV40 pA (SEQ ID NO:9) and pRLBP1 short-RLBP1 opt-SV40 pA (SEQ ID NO:10). Based on these, the expression cassettes were optimized to obtain pscAAV-CMV / IE / CB-RLBP1 opt-hGH pA (…). Figure 2 The expression cassette for this plasmid is CMV / IE / CB-RLBP1 opt-hGH pA (SEQ ID NO:11).
[0035] SEQ ID NO:1 (human RLBP1 CDS nucleotide sequence) 5’-atgtcagaaggggtgggcacgttccgcatggtacctgaagaggaacaggagctccgtgcccaactggagcagctcacaaccaaggaccatggacctgtctttggcccgtgcagccagctgccccgccacaccttgcagaaggccaaggatgagctgaacgagagagaggagacccgggaggaggcagtgcgagagctgcaggagatggtgcaggcgcaggcggcctcgggggaggagctggcggtggccgtggcggagagggtgcaagagaaggacagcggcttcttcctgcgcttcatccgcgcacggaagttcaacgtgggccgtgcctatgagctgctcagaggctatgtgaatttccggctgcagtaccctgagctctttgacagcctgtccccagaggctgtccgctgcaccattgaagctggctaccctggtgtcctctctagtcgggacaagtatggccgagtggtcatgctcttcaacattgagaactggcaaagtcaagaaatcacctttgatgagatcttgcaggcatattgcttcatcctggagaagctgctggagaatgaggaaactcaaatcaatggcttctgcatcattgagaacttcaagggctttaccatgcagcaggctgctagtctccggacttcagatctcaggaagatggtggacatgctccaggattccttcccagcccggttcaaagccatccacttcatccaccagccatggtacttcaccacgacctacaatgtggtcaagcccttcttgaagagcaagctgcttgagagggtctttgtccacggggatgacctttctggtttctaccaggagatcgatgagaacatcctgccctctgacttcgggggcacgctgcccaagtatgatggcaaggccgttgctgagcagctctttggcccccaggcccaagctgagaacacagccttctga-3’; SEQ ID NO:2 (RLBP1 opt nucleotide sequence) 5’-atgagtgagggggtgggcaccttcaggatggtgccagaggaggagcaggagctgcgggcccagctggagcagctgaccaccaaggaccatggcccagtgtttgggccctgcagccagctgccccggcacaccctgcagaaggccaaggatgagctgaacgagcgggaggagacccgggaggaggccgtgcgggagctgcaggagatggtgcaggcccaggcggccagcggggaggagctggccgtggccgtggcggagcgggtgcaggagaaggacagcggcttcttcctgcgcttcatccgggcccgcaagttcaacgtgggccgggcctatgagctgctgcggggctatgtgaacttccgcctgcagtaccctgagctcttcgacagcctgagccccgaggctgtgcgctgcaccatcgaggctggctaccccggggtgctctccagccgggacaagtatggccgcgtggtcatgctcttcaacatcgagaactggcagagccaggagatcacctttgatgagatcctgcaggcctactgcttcatcctggagaagctgctggagaacgaggagacccagatcaacggcttctgcatcatcgagaacttcaagggcttcaccatgcagcaggctgccagcctgcgcacctcagacctgcgcaagatggtggacatgctgcaggactccttccccgcccgcttcaaggccatccacttcatccaccagccctggtacttcaccaccacctacaacgtggtgaagcccttcctgaagtccaagctgctggagcgggtgtttgtgcacggggatgacctgtcaggcttctaccaggagatcgatgagaacatcctgccctcagactttgggggcaccctgcccaagtacgatggcaaggccgtggctgagcagctgtttggcccccaggcccaggctgagaacacggccttctga-3’; SEQ ID NO:3 (CMV / IE enhancer nucleotide sequence) 5’-acgcgtctagttattaatagtaatcaattacggggtcattagttcatagcccatatatggagttccgcgttacataacttacggtaaatggcccgcctggctgaccgcccaacgacccccgcccattgacgtcaataatgacgtatgttcccatagtaacgccaatagggactttccattgacgtcaatgggtggagtatttacggtaaactgcccacttggcagtacatcaagtgtatcatatgccaagtacgccccctattgacgtcaatgacggtaaatggcccgcctggcattatgcccagtacatgaccttacgggactttcctacttggcagtacatctacgtattagtcatcgctattacca-3’; SEQ ID NO:4 (CB promoter nucleotide sequence) 5’-tggtcgaggtgagccccacgttctgcttcactctccccatctcccccccctccccacccccaattttgtatttatttattttttaattattttgtgcagcgatgggggcggggggggggggggcgcgcgccaggcggggcggggcggggcgaggggcggggcggggcgaggcggagaggtgcggcggcagccaatcagagcggcgcgctccgaaagtttccttttatggcgaggcggcggcggcggcggccctataaaaagcgaagcgcgcggcgggcgg-3’; SEQ ID NO:5 (CB intron nucleotide sequence) 5’-gtgagcgggcgggacggcccttctcctccgggctgtaattagcgcttggtttaatgacggcttgtttcttttctgtggctgcgtgaaagccttgaggggctccgggagggccctttgtgcggggggagcggctcggggggtgcgtgcgtgtgtgtgtgcgtggggagcgccgcgtgcggctccgcgctgcccggcggctgtgagcgctgcgggcgcggcgcggggctttgtgcgctccgcagtgtgcgcgaggggagcgcggccgggggcggtgccccgcggtgcggggggggctgcgaggggaacaaaggctgcgtgcggggtgtgtgcgtgggggggtgagcagggggtgtgggcgcgtcggtcgggctgcaaccccccctgcacccccctccccgagttgctgagcacggcccggcttcgggtgcggggctccgtacggggcgtggcgcggggctcgccgtgccgggcggggggtggcggcaggtgggggtgccgggcggggcggggccgcctcgggccggggagggctcgggggaggggcgcggcggcccccggagcgccggcggctgtcgaggcgcggcgagccgcagccattgccttttatggtaatcgtgcgagagggcgcagggacttcctttgtcccaaatctgtgcggagccgaaatctgggaggcgccgccgcaccccctctagcgggcgcggggcgaagcggtgcggcgccggcaggaaggaaatgggcggggagggccttcgtgcgtcgccgcgccgccgtccccttctccctctccagcctcggggctgtccgcggggggacggctgccttcgggggggacggggcagggcggggttcggcttctggcgtgtgaccggcggctctagagcctctgctaaccatgttcatgccttcttctttttcctacagctcctgggcaacgtgctggttattgtgctgtctcatcattttggcaaag-3’; SEQ ID NO:6 (Nucleotide sequence of human β-globulin intron) 5'-ggagtcgctgcgttgccttcgccccgtgccccgctccgcgccgcctcgcgccgcccgccccggctctgactgaccgcgttatcccacaggtgagcgggcgggacggcccttc tcctccgggctgtaattagcaagaggtaagggtttaagggatggttggttggtggggtattaatgtttaattacctgttttacaggcctgaaatcacttggttttaggttgg-3'; SEQ ID NO:7 (SV40 polyadenylation region nucleotide sequence) 5'-gatcataatcagccataccacatttgtagaggttttacttgctttaaaaaacctcccacacctccccctgaacctgaaacataaaatgaatgcaattgttgttgttaacttgtttattg cagcttataatggttacaaataaagcaatagcatcacaaatttcacaaataaagcatttttttcactgcattctagttgtggtttgtccaaactcatcaatgtatcttatcatgtctgg-3'; SEQ ID NO:8 (nucleotide sequence of the hGH polyadenylation region) 5’-cgggtggcatccctgtgacccctccccagtgcctctcctggccctggaagttgccactccagtgcccaccagccttgtcctaataaaattaagttgcatcattttgtctgactaggtgtccttctataatattatggggtggaggggggtggtatggagcaaggggcaagttgggaagacaacctgtagggcctgcggggtctattgggaaccaagctggagtgcagtggcacaatcttggctcactgcaatctccgcctcctgggttcaagcgattctcctgcctcagcctcccgagttgttgggattccaggcatgcatgaccaggctcagctaatttttgtttttttggtagagacggggtttcaccatattggccaggctggtctccaactcctaatctcaggtgatctacccaccttggcctcccaaattgctgggattacaggcgtgaaccactgctcccttccctgtccttcgg-3’ SEQ ID NO:9 (Nucleotide sequence of pRLBP1 short-RLBP1 cds-SV40 pA expression cassette)
[0036] SEQ ID NO:10 (pRLBP1 short-RLBP1 opt-SV40 pA expression cassette nucleotide sequence)
[0037] SEQ ID NO:11 (CMV / IE / CB-RLBP1 opt-hGH pA expression cassette nucleotide sequence)
[0038] Example 2: Packaging and Identification of Viruses In this embodiment, the three vector plasmids constructed in Example 1 were used to further package the virus. Based on the literature (Xiao X, et al. J Virol. 1998;72(3):2224-2232.), certain adjustments were made. A three-plasmid packaging system was used to package recombinant AAV, with the outer shell using IVT18 of the amino acid sequence SEQ ID NO:12.
[0039] The amino acid sequence of SEQ ID NO:12 is as follows: *
[0040] The specific construction method of RepCap plasmid pAAV-RC2_IVT18 for serotype IVT18 is as follows: Step 1) Construction of intermediate plasmid RC2_IVB-NotI plasmid A reverse P5 promoter sequence was added upstream of the Rep sequence on pAAV-RC2 (purchased from CellBiolabs, catalog number: VPK-410-SER2), and a NotI restriction endonuclease site was inserted at 1752 bp of the Cap2 sequence. The intermediate plasmid RC2_IVB-NotI was constructed by Anhui General Biotechnology, and the specific sequence is shown below: RC2_IVB-NotI plasmid vector sequence (SEQ ID NO:13) Step 2) Construction of AAV capsid protein expression plasmid encoding IVT18 The AAV capsid protein expression plasmid encoding IVT18 was constructed using the Gibson assembly method (see Gibson Assembly® Chemical Transformation Protocol (E2611) for specific steps, where the PCR fragment and NotI-digested linearized fragment are assembled using step 1 above). This resulted in the AAV capsid plasmid encoding IVT18. During the PCR fragment acquisition process, overlap extension PCR was used, amplifying the desired DNA fragment using only primer pairs (without template DNA). The primer sequences are shown below: Forward primer (SEQ ID NO:14): TGCCGCAAGACTGCCCCTAGCAGCGGCGTTGCCTCTCTGGAGGTTGGTAGATACAGAACCATACTG Reverse primer (SEQ ID NO:15): GCCGCTGCTAGGGGCAGTCTTGCGGCAAGACAAGCAGCTACCGCAGATGTCAACACACAAGGCG Experimental results: The constructed plasmid DNA was identified by enzyme digestion and Sanger sequencing, confirming the successful construction of the IVT18 capsid protein expression plasmid. The amino acid sequence of the AAV capsid protein expressed in the obtained AAV capsid protein expression plasmid is shown in SEQ ID NO:12.
[0041] Step 3) Plasmid transfection and packaging HEK 293T cells were seeded in 100 mm culture dishes and grown to 70%–80% confluence for plasmid transfection. 5 μg of pscAAV-pRLBP1 short-RLBP1 cds-SV40 pA plasmid, or pscAAV-pRLBP1 short-RLBP1 opt-SV40 pA plasmid, or pscAAV-CMV / IE / CB-RLBP1 opt-hGH pA plasmid, 5 μg of the IVT18-serotype RepCap plasmid pAAV-RC2_IVT18, and 10 μg of pHelper plasmid (purchased and stored by the applicant from CellBiolabs; this plasmid contains adenovirus-derived helper genes E2A, E4, and VA RNA, etc., required for the preparation of recombinant AAV virus by co-transfection of HEK293 (or HEK293T) cells with these three plasmids) were transfected. The cells were co-transfected into HEK293T cells, and the cells and supernatant were harvested 72 hours post-transfection. Cells were pelleted by low-speed centrifugation, and then lysed by adding 0.5% (w / v) sodium deoxycholate. Free DNA molecules were digested by adding 50 U / mL Benzonase nuclease and 2 mM MgCl2 and incubating at 37 °C for 2 hours. Simultaneously, the supernatant was precipitated on ice with a 1:5 volume solution of 40% PEG8000 and 2.5 M NaCl. The cell lysate and supernatant were mixed and centrifuged. The supernatant was then purified using iodixanol ultracentrifugation to obtain the recombinant AAV virus molecules. The AAV molecules corresponding to the three expression plasmids were named pIVB-2327, pIVB-2455, and pIVB-2608, respectively. pIVB-2327 served as a positive control, pIVB-2455 as a codon-optimized molecule, and pIVB-2608 as an expression cassette-optimized molecule. The purified AAV titer was then determined by qPCR and stored in a -80 °C freezer.
[0042] Step 4) Identification The specific measurement method is as follows: The physical titer of the prepared AAV virus genome was determined using qPCR. The specific procedure is as follows: Design primers and probes for qPCR detection targeting the ITR sequence of AAV molecules: QF: 5'-GGAACCCCTAGTGATGGAGTT-3' (SEQ ID NO: 16); QR: 5'-CGGCCTCAGTGAGCGA-3' (SEQ ID NO: 17); QP: 5'-6-FAM-CACTCCCTCTCTGCGCGCTCG-BHQ1-3' (SEQ ID NO: 18); QF and QR were used as primers, and QP was used as a probe. The 5' end of the probe was labeled with FAM fluorescent protein, and the 3' end was ligated with BlackBerryquencher. Primers and probes were synthesized by ThermoFisher Scientific. A 117 bp fragment in the ITR sequence was specifically amplified using QF and QR primers. The TaqMan probe binding method was used, with three plasmids at 1.0 × 10⁸ copies / mL and their 10-fold serial dilutions as standards. The physical titer of the viral genome was detected using Premix Ex Taq (Probe qPCR) reagent (TaKaRa, Beijing, China) and a real-time PCR instrument (model: Q5, ThermoFisher). The procedure was described in the instructions for the reagents used. The virus treatment method was described in the literature (Aurnhammer C, et al. Hum Gene TherMethods. 2012; 23(1): 18-28.).
[0043] Experimental results: The physical titers of the packaged recombinant AAV virus genomes were detected as follows: pIVB-2327 1.26 × 10¹³ vg / mL, pIVB-2455 2 × 10¹¹ vg / mL, and pIVB-2608 2 × 10¹¹ vg / mL.
[0044] Example 3: In vitro expression of pIVB-2327 and pIVB-2455 To determine the in vitro expression of the AAV viral vector carrying the RLBP1 expression cassette, ARPE-19 cells were infected with pre-packaged AAV virus. Cellular proteins were extracted and analyzed 48 hours after infection. Total protein was extracted using RIPA+PMSF and the concentration was quantified using a BCA kit. Gel preparation: 12% separating gel + 5% stacking gel. Protein samples were centrifuged at 98°C for 10 min, then centrifuged at 3000 rpm for 2 min, followed by electrophoresis. Transfer was performed using a constant current of 300 mA for 1 h, followed by blocking with 5% skim milk for 1 h. RLBP1 primary antibody was incubated overnight at 4°C. The primary antibody was recovered the next day, and the membrane was washed three times with TBST for 8 min each time. Secondary antibody was then incubated on a shaker at room temperature for 1 h, followed by recovery of the secondary antibody. The membrane was washed three times with TBST for 8 min each time. Imaging of the membrane under chemiluminescent blotting was performed using a Bio-Rad ChemiDoc™ MP imager. The results showed that RLBP1 was expressed in cells, and codon optimization increased RLBP1 protein expression. Figure 3 ).
[0045] Example 4: In vivo expression of pIVB-2327, pIVB-2455, and pIVB-2608 To determine the in vivo expression of the AAV viral vector carrying the RLBP1 expression cassette, this example used pre-packaged AAV virus to infect the retina of mice via intravitreal injection. The mouse strain used was C57BL / 6J wild-type mice. Four weeks after administration, the mice's eyes were enucleated, the retina was dissected, and tissue proteins were extracted and detected. The detection methods were the same as described above. The results showed that among the three recombinant AAV molecules, pIVB-2608 corresponded to the highest in vivo expression level of RLBP1 (…). Figure 4 ).
[0046] Example 5: Construction and identification of the Rlbp1 gene knockout mouse model The mouse strain used in this study was the C57BL / 6J mouse, with exon 5 of the Rlbp1 gene knocked out. Using CRISPR / Cas9 technology, sgRNA was designed, and Rlbp1 knockout mice were obtained through high-throughput electroporation of fertilized eggs. After reaching sexual maturity, sperm was collected, cryopreserved, and F0 generations with reproductive transmission capacity were obtained for further breeding.
[0047] All mice used in the experiments were purchased from Cyagen Biosciences Co., Ltd. The mice were housed at the Animal Center of Peking Union Medical College Hospital, with the room temperature controlled at 20-25℃, and free access to water and food. The housing was equipped with timed fluorescent lighting, and the mouse food and bedding were changed weekly. All procedures related to the housing, experimental handling, and euthanasia of the experimental mice were approved by the Animal Ethics Committee of the Animal Experiment Center of Peking Union Medical College Hospital.
[0048] Genotyping was performed on mice aged 3-4 weeks (w). A 1-3 mm sample of mouse tail was taken and a rapid genotyping kit was used. The specific method was as follows: 200 μL of Mouse Tissue Lysis Buffer and 4 μL of Proteinase K were added to an EP tube containing the mouse tail. The mixture was vortexed and incubated in a 55°C water bath for 20 min. After incubation, the tube was heated in a 98°C metal bath for 5 min to inactivate Proteinase K. The mixture was then vortexed thoroughly and centrifuged at 12000 rpm for 5 min. The supernatant was used for PCR amplification (primer sequences are shown in Table 1). A 3% agarose gel was prepared, and 5 μL of the PCR product was loaded into each well. Electrophoresis was performed at 120V for 25 min, followed by development. The amplification product from wild-type mice was a single band of 314 bp; the amplification product from heterozygous mice was a double band of 314 bp and 617 bp; and the amplification product from knockout homozygous mice was a single band of 617 bp.
[0049] To assess the effectiveness of Rlbp1 gene knockout, Rlbp1 mRNA and protein expression were detected. Retinas from wild-type mice (WT) and Rlbp1 knockout mice (Rlbp1- / -) were collected, mixed with 1 mL of Trizol, and lysed thoroughly on ice. 200 μL of chloroform was added, and the mixture was centrifuged at 12000 rpm for 15 min at 4°C. 500 μL of the supernatant was aspirated, and 500 μL of isopropanol was added. The mixture was incubated for 10 min. The supernatant was then centrifuged at 12000 rpm for 10 min at 4°C, and the supernatant was discarded, allowing the RNA to settle at the bottom of the tube. The tube was washed with 1 mL of 75% ethanol, gently mixed to suspend the RNA, and centrifuged at 7500 rpm for 5 min at 4°C. The supernatant was discarded (and carefully aspirated), and the tube was air-dried in a fume hood for 10–20 min. 20–50 μL of sterile DEPC water was added to dissolve the RNA sample, and the RNA concentration was measured. An appropriate amount of RNA was reverse transcribed into cDNA, and qPCR was performed. Primer sequences are shown in Table 1, reaction system in Table 2, and reaction procedure in Table 3. Protein expression detection was performed as described above. Results showed that, compared with wild-type control mice, the expression of Rlbp1 mRNA and protein in gene knockout mice was significantly reduced. Figure 5 A / B).
[0050] Table 1. Primer sequences for PCR and qPCR
[0051] Table 2 qPCR reaction system
[0052] Table 3 PCR Procedure
[0053] Example 6 Rlbp1 Clinical phenotype detection of gene knockout mice To understand the effects of Rlbp1 knockout on the function and structure of the mouse retina, retinal tissue sections were stained, retinal retinoid content was measured, and OCT and ERG examinations were performed on Rlbp1 knockout mice and wild-type mice, respectively.
[0054] Eyeballs were harvested from wild-type mice and Rlbp1 knockout mice, respectively. Muscle tissue attached to the surface of the eyeball was removed, preserving the optic nerve as much as possible. The eyes were fixed in fixative for at least 2 hours. After fixation, the tissue was embedded in paraffin, and sections (3 μm thick) were prepared. After preparation, sections with intact and clearly defined structures were stained with hematoxylin and eosin (HE) and observed under a microscope. Results showed that compared with wild-type mice, the number of outer nuclear cells in the retina of Rlbp1 knockout mice was significantly reduced. Figure 6 A / B).
[0055] Rlbp1 participates in the visual circulation, maintaining its conformational stability and promoting its formation by binding to 11-cis-retinal. To investigate the effect of Rlbp1 on the visual circulation, mouse retina was extracted for in vitro detection of visual circulation products. Rlbp1 knockout mice and wild-type mice were subjected to sufficient dark adaptation, followed by photobleaching and another 2 hours of dark adaptation. Mouse eyeballs were then harvested in the dark and rapidly cryopreserved in liquid nitrogen. All processes were conducted in the dark. Subsequently, 1 ml of methanol was added, and homogenization was performed at 4°C. Standard solutions of all-trans-retinol, all-trans-retinal, 11-cis-retinol, and 11-cis-retinal were prepared at a concentration of 100 ng / mL using acetonitrile as the solvent. The eyeball homogenate was added 1:1 to 200 μL of acetonitrile, vortexed for 1 min, then 1.2 mL of methyl tert-butyl ether was added, vortexed for 1 min, and retinyl acetate (internal standard) was added. The mixture was centrifuged at 14000 g for 10 min, and the supernatant was evaporated to dryness. The homogenate was reconstituted with a 1:3 ratio of water and methanol, and the results were analyzed using a mass spectrometer. The results showed that the contents of various products of the visual circulation in Rlbp1 knockout mice were significantly lower than those in wild-type mice. After photobleaching, the production rate of 11-cis-retinaldehyde in Rlbp1 knockout mice was significantly lower than that in wild-type mice, and all-trans-retinol accumulation was observed. Figure 7 ).
[0056] Retinal OCT examination was performed using the Micron IV Retinal Imaging Microscope (Phoenix Research Labs). Before the examination, one drop of compound tropicamide eye drops was instilled into each eye of the mice to dilate their pupils. After full pupil dilation, the mice were anesthetized with isoflurane. The mice's eyes were placed close to the lens, and the position and distance were adjusted to ensure the optic disc was centered and the structures of each layer were clearly visible in the OCT images. Images were captured using image overlay mode. OCT results showed that, compared with wild-type mice, the outer nuclear layer thickness of the retina was significantly reduced in Rlbp1 gene knockout mice. Figure 8 A / B) ERG detection was performed using the Celeris system (Diagnosys LLC). Mice underwent overnight dark adaptation for black-vision ERG recording. Pupils were fully dilated with tropicamide (1%) at least 10 minutes prior to the procedure. Mice were anesthetized with isoflurane. Throughout the ERG procedure, animals were placed on a heating plate to maintain body temperature at 37 °C. Two electrodes were placed along the axial direction of the eye, and resistance was measured. The resistance was adjusted to below 5 Ω before detection began. The dark-adapted ERG protocol consisted of five steps, with stimulation intensities sequentially ranging from -2.5 log, -2.0 log, -1 log, 0 log, and 1 log to induce firing in the mouse retina. All flashes were presented in the absence of background illumination, with a constant stimulation interval of 5 seconds for dim flashes and a constant stimulation interval of up to 30 seconds for bright flashes. After 5 minutes of light adaptation, the mouse retina was stimulated with light intensities of -1 log, 0 log, 1 log, and 1.5 log to induce firing. After the detection was completed, carbomer ophthalmic gel was applied to the mouse eyes. ERG wave analysis results showed that, compared with wild-type mice, the amplitude and peak latency of ERG a and b waves in RLBP1 knockout mice were significantly lower than those in wild-type mice under different light stimulation intensities. Figure 9 A), the dark adaptation recovery time is significantly prolonged after photobleaching ( Figure 9 B).
[0057] Example 7: Gene Therapy in Animal Models To investigate the therapeutic effect of pIVB-2455 on Rlbp1 gene-deficient mice, 20 four-week-old Rlbp1- / - mice (KO) were randomly divided into four groups of five each. Intravitreal injections were administered at doses of 5 × 10⁸ vg / eye, 2 × 10⁹ vg / eye, and 5 × 10⁹ vg / eye, respectively. pIVB-2327 (containing the human RLBP1 CDS sequence shown in SEQ ID NO:1) served as a positive control at a dose of 5 × 10⁹ vg / eye. ERG analysis was performed at 4, 8, 12, and 24 weeks post-injection. Results showed that the amplitude of the ERG a-wave in the treated groups was significantly higher than that in the knockout groups. The 5 × 10⁸ vg / eye dose group showed the most significant improvement in amplitude, reaching wild-type levels after 8 weeks of treatment. Figure 10 A). Simultaneously, the dark adaptation ability of knockout mice was significantly improved ( Figure 10 B). Compared with the control drug, pIVB-2455 required a significantly lower dose to achieve the same therapeutic effect. Based on the determined dosage, the therapeutic effects of pIVB-2455 and pIVB-2608 were compared, with pIVB-2327 as a positive control. ERG examination results showed that, at 4 weeks after administration, pIVB-2608 had a more significant delaying effect on retinal function decline compared to pIVB-2455 and the positive control. Figure 11 ).
[0058] The embodiments described above are only some embodiments of the present invention, not all embodiments. Other embodiments obtained by those skilled in the art based on the embodiments of the present invention without creative effort are all within the scope of protection of the present invention.
Claims
1. A gene expression cassette comprising a coding sequence for retinaldehyde-binding protein 1, and optionally, a promoter, an enhancer, and / or an intron; Preferably, the coding sequence of the retinaldehyde binding protein 1 comprises the sequence shown in SEQ ID NO:2 or a sequence having at least 85% identity with the sequence shown in SEQ ID NO:
2.
2. The gene expression cassette according to claim 1, wherein, The promoter includes the CB promoter; Preferably, the CB promoter comprises a sequence as described in SEQ ID NO:4 or a sequence having at least 85% identity with it.
3. The gene expression cassette according to any one of claims 1 to 2, wherein, The enhancers include CMV / IE enhancers; Preferably, the CMV / IE enhancer comprises a sequence as described in SEQ ID NO:3 or a sequence having at least 85% identity with it.
4. The gene expression cassette according to any one of claims 1 to 3, wherein, The introns include CB introns and / or human β-globulin introns; Preferably, the CB intron comprises a sequence as described in SEQ ID NO:5 or a sequence having at least 85% identity with it; Preferably, the human β-globulin intron comprises a sequence as described in SEQ ID NO:6 or a sequence having at least 85% identity with it.
5. The gene expression cassette according to any one of claims 1 to 4, wherein, The gene expression cassette also includes a polyadenylation region; Optionally, the polyadenylation region is selected from human growth hormone or the polyadenylation region of SV40; Preferably, the polyadenylation region includes the SV40 polyadenylation region; More preferably, the SV40 polyadenylation region includes the sequence shown in SEQ ID NO:7 or a sequence having at least 85% identity with it; Preferably, the polyadenylation region includes the human growth hormone polyadenylation region; More preferably, the human growth hormone polyadenylation region includes the sequence shown in SEQ ID NO:8 or a sequence having at least 85% identity with it.
6. The gene expression cassette according to any one of claims 1 to 5, wherein, The structure of the gene expression cassette is shown below: [Promoter] - [Coding sequence of retinaldehyde-binding protein 1] - [Polyadecylate region]; The preferred sequence is [enhancer]-[promoter]-[coding sequence of retinaldehyde-binding protein 1]-[polyadenylation region]; More preferably, it is [enhancer]-[promoter]-[intron]-[coding sequence of retinaldehyde-binding protein 1]-[polyadenylation region].
7. The gene expression cassette according to any one of claims 1 to 6, wherein, The nucleotide sequence of the gene expression cassette is shown in SEQ ID NO:10~11.
8. A gene delivery vector comprising the gene expression cassette according to any one of claims 1 to 7; Preferably, the gene delivery vector is a viral vector derived from a virus; Preferably, the gene delivery vector is a recombinant adeno-associated virus; Preferably, the recombinant adeno-associated virus comprises a capsid protein, and the gene expression cassette is capsided within the capsid protein; Optionally, the capsid protein is selected from any one of the adeno-associated virus serotypes AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9 and AAV10 or a variant thereof; More preferably, the capsid protein is AAV2 capsid protein or a variant thereof; More preferably, the capsid protein is an AAV2 capsid protein variant; More preferably, the AAV2 capsid protein variant comprises a sequence as shown in SEQ ID NO:12, or a sequence having at least 85% identity with SEQ ID NO:
12.
9. A pharmaceutical composition comprising a gene expression cassette as described in any one of claims 1 to 7 or a gene delivery vector as described in any one of claims 8 to 11. And, optionally, pharmaceutically acceptable carriers.
10. Use of the gene expression cassette as described in any one of claims 1 to 7 or the gene delivery vector as described in claim 8 in the preparation of a medicament for treating a disease; Optionally, the disease is an eye disease; Preferably, the eye disease is an eye disease related to hereditary retinal dystrophy associated with RLBP1 gene mutations in the eye. More preferably, the eye disease is selected from one or more of Bothn retinal dystrophy, Newfoundland cone-rod cell dystrophy, white spot retinal degeneration, and retinitis pigmentosa.
Citation Information
Patent Citations
Methods and compositions for detecting and treating retinal diseases
CN101426534A
Viral vectors for the treatment of retinal dystrophy
CN104470545A