MATE gene participating in flavonoid transport and accumulation in peony and application of MATE gene

Abstract

The invention discloses a MATE gene participating in flavonoid transport and accumulation in peony and application of the MATE gene, the MATE gene participating in flavonoid transport and accumulation is separated and identified from P.delavayi, and after the gene is silenced in the peony, yellow petals and color spots can be promoted to be obviously lightened; overexpression in Tobacco nipponense can significantly deepen the color of petals. The gene plays an important role in flavonoid transport and accumulation, can enrich a transgenic material library of peony flower yellow traits, and provides powerful support for molecular breeding for cultivating and regulating peony flower yellow traits in the future.

Description

Technical Field

[0001] This invention relates to a molecular biology technique, and more particularly to a MATE (Multidrug and Toxic Compound Extrusion) gene in peony that is involved in the transport and accumulation of various flavonoids and its applications. Background Technology

[0002] Peony (Paeonia suffruticosa), a famous ornamental flower in China, is known as the "King of Flowers" due to its rich colors. Compared to common colors like red, pink, and white, yellow peonies are more difficult to cultivate, and developing pure yellow peony varieties has always been a goal pursued by breeders. Most common yellow peony varieties on the market originate from Paeonia delavayi. Studies have shown that the main coloring substances in yellow peonies are flavonoids such as chalcone glycosides, flavonoid glycosides, and flavonol glycosides, and their accumulation depends on the activity of transport proteins.

[0003] In recent years, MATE (Multidrug and Toxic Compound Extrusion), as one of the gene families involved in the transport of secondary metabolites in plants, has received widespread attention. Existing studies have demonstrated that MATE achieves transmembrane transport of substrates driven by proton gradients, and the substrates it can transport include various flavonoids such as flavonols and anthocyanins. In the Arabidopsis mutant tt19 lacking the MATE transporter, the transport mechanism is disrupted, resulting in altered intracellular flavonol positions and significantly reduced levels. In wheat (Triticum aestivum), TaMATEL1 selectively recognizes dihydroquercetin and quercetin in vitro. In grapes, the MATE transporters VviMATE1, VviMATE3, and VviMATE4 can bind to glutathione, anthocyanin monomers, proanthocyanidin monomers, and flavonol monomers. In poplar, PtMATEU19 and PtMATEU20 can bind to various flavonoids in vitro. AtMATEF2 encodes MATE, which can bind to two unmethylated flavonols. These studies indicate that the MATE gene has broad application potential in flower color regulation in plants. However, research on MATE in peony remains lacking.

[0004] Currently, the breeding of new peony varieties relies heavily on hybridization, which is time-consuming and inefficient. In the future, with the continuous iteration of new technologies, it will be possible to use molecular breeding to achieve targeted improvement of ornamental plant phenotypes. Therefore, screening key genes controlling relevant phenotypic traits is a prerequisite for molecular breeding. The MATE gene, with its substrate diversity and transport specificity, is an ideal target for molecular breeding of flower color. This invention is the first to isolate the MATE gene involved in flower color transport from *Peony yunnanensis* and conduct related functional verification. This not only fills a research gap but also provides a new approach for targeted improvement of peony flower color, possessing significant application value.

[0005] In view of this, the present invention is hereby proposed. Summary of the Invention

[0006] The purpose of this invention is to provide a MATE gene involved in flavonoid transport and accumulation in peony and its application, so as to improve the pathway controlling the yellow trait of peony flowers.

[0007] The objective of this invention is achieved through the following technical solution:

[0008] The present invention relates to a MATE gene (PdMATE16) involved in flavonoid transport and accumulation in peony. A MATE gene involved in flavonoid transport and accumulation was isolated and identified from *P. delavayi*, and the CDS sequence of this gene is as follows:

[0009]

[0010] The MATE gene, which is involved in the transport and accumulation of flavonoids in peony, is applied to transgenic breeding through targeted regulation using transgenic technology.

[0011] Compared with existing technologies, the MATE gene involved in flavonoid transport and accumulation in peony and its application in this invention have had their function verified through heterologous transformation to tobacco and through virus-induced gene silencing (VIGS) technology in peony petals, demonstrating its ability to participate in flavonoid transport and accumulation. In tobacco, overexpression of the target gene promotes anthocyanin accumulation in petals; in peony, targeted silencing of the target gene not only significantly reduces the accumulation of total flavonoids in peony petals, making the yellow petals noticeably lighter, but also lightens the color spots and reduces anthocyanin content. Therefore, this gene can play a role in altering flower color, enriching and improving the transgenic material library of yellow peony flowers, and providing strong support for future molecular breeding of yellow peony flowers.

[0012] The MATE gene of this invention provides a new approach for regulating peony flower color using genetic engineering techniques and for cultivating a wide variety of new peony varieties, and has broad prospects in molecular breeding of peony flower color.

[0013] sequence list

[0014] CDS sequence of MATE gene—PdMATE16. Attached Figure Description

[0015] Figure 1 For the identification of transgenic tobacco plants, the figure shows: A: Phenotype of wild-type and transgenic tobacco plants; B: Relative expression level of PdMATE16; C: Determination of total anthocyanin content in wild-type and transgenic tobacco plants. WT: Wild-type plants; OE-1, OE-2, OE-3: Transgenic plants.

[0016] Figure 2 For the identification of VIGS-silenced peony plants, the figures show: A: Peony petal phenotypes of VIGS empty vector and silent plants; B: Relative expression level of PdMATE16; C: Detection of total flavonoid content in VIGS-silenced peony petals; D: Detection of total anthocyanin content in VIGS-silenced peony spots; TRV: Tobacco brittle virus empty vector silence group; TRV-PdMATE16: Target gene recombinant vector silence group. Detailed Implementation

[0017] The technical solutions in the embodiments of the present invention will be clearly and completely described below. Obviously, the described embodiments are only a part of the embodiments of the present invention, and not all of them. All other embodiments obtained by those skilled in the art based on the embodiments of the present invention without creative effort are within the protection scope of the present invention. Parts of the present invention not described in detail are prior art known in the art.

[0018] The technical solution provided by this invention specifically involves isolating and identifying a MATE gene involved in flavonoid transport and accumulation from *Paeonia delavayi*, named PdMATE16. While MATE genes, confirmed to have flavonoid transport and accumulation functions, perform similar functions in different plants, their CDS sequences are not identical. Therefore, isolating and identifying MATE genes involved in flavonoid transport and accumulation in peony can enrich the gene library for peony transgenic molecular breeding, providing support for future breeding of peonies with yellow flowers.

[0019] The present invention relates to a MATE gene (PdMATE16 gene) involved in flavonoid transport and accumulation in peony. A MATE gene involved in flavonoid transport and accumulation was isolated and identified from *P. delavayi*, and its CDS sequence is as follows:

[0020]

[0021] The MATE gene, which is involved in the transport and accumulation of flavonoids in peony, is applied to transgenic breeding through targeted regulation using transgenic technology.

[0022] When used in tobacco, overexpression of the target gene can promote the accumulation of anthocyanins in the petals.

[0023] Used in peonies for molecular transgenic improvement breeding of peony flower color.

[0024] By targeting and silencing the target gene, the accumulation of total flavonoids in peony petals was significantly reduced, making the yellow petals noticeably lighter; at the same time, the color spots were lightened and the anthocyanin content was reduced.

[0025] Therefore, this gene can be used to regulate the flower color of peonies.

[0026] The following will describe the process of transgenic breeding using the MATE gene provided by this invention, taking the overexpression of the PdMATE16 gene in tobacco and the silencing of the PdMATE16 gene in peony petals as examples, and then verify the feasibility of the corresponding transgenic breeding process.

[0027] The specific process by which the function of the MATE gene in flavonoid transport and accumulation described in this invention has been confirmed in tobacco and peony is as follows:

[0028] I. PdMATE16 gene heterologous transformation of tobacco

[0029] 1) Total RNA extracted from the petals of *Paeonia yunnanensis* was reverse transcribed, and the complete CDS sequence was cloned from the cDNA using a specific primer of PdMATE16. The sequence was then sent to a sequencing company for comparison to ensure its accuracy.

[0030] 2) Using seamless cloning technology, the complete CDS sequence of the PdMATE16 gene was inserted into the plant expression vector pCAMBIA1302, specifically between the NcoI and SpeI restriction sites. After construction, the recombinant vector was sequenced to ensure the accuracy of the inserted sequence.

[0031] 3) The constructed expression vector was transformed into Agrobacterium GV3101, and the transformation product was then evenly spread on YEP agar plates containing 50 μg / mL kanamycin. The plates were inverted and incubated at 28°C for 2-3 days. After incubation, single colonies were randomly selected for colony PCR amplification to screen for positive Agrobacterium clones containing the target vector, which were then labeled for subsequent experiments.

[0032] 4) Select confirmed Agrobacterium monoclonal colonies and inoculate them into 1.5 mL of LB liquid medium containing the appropriate antibiotic. Place the inoculated medium in a constant temperature shaking incubator, set the temperature to 28℃ and the shaking frequency to 200 rpm, and perform shaking culture for 24 hours.

[0033] 5) Based on an inoculation ratio of 1%, transfer the Agrobacterium culture obtained by shaking to 100 mL of LB broth containing antibiotics. Continue to incubate with shaking at 28°C and 200 rpm until the optical density (OD) of the bacterial culture reaches a certain value. 600 The concentration reached approximately 1.0. Centrifuge at 4000 rpm for 15 min and collect the precipitate.

[0034] 6) Resuspend the collected bacterial cells thoroughly by pipetting in transformation buffer to ensure uniform dispersion, and adjust the OD of the resuspended solution. 600 From approximately 0.6.

[0035] 7) Select sterile tobacco seedling leaves and cut them into leaf discs approximately the size of a thumbnail. After cutting, completely immerse the prepared leaf discs in a pre-suspended Agrobacterium solution for infection. Transfer the infected leaf discs to MS1 medium, tightly wrap the medium with aluminum foil to ensure complete protection from light, and then place them in a tobacco culture room at a constant temperature of 25°C for 3 days of dark incubation.

[0036] 8) Remove the leaves after dark incubation. First, wash the surface of the leaves with sterile water to remove the bacterial cells. Then, wash them once each with sterile water containing 1000 μg / mL and 500 μg / mL cephalosporin, followed by three more washes with sterile water. After washing, blot the surface of the leaf disc dry with filter paper, and then transfer the leaf disc face up to MS1 medium.

[0037] 9) Culture under light for 8-10 days. During this stage, callus tissue can be observed around the leaf rosette, which then gradually differentiates into small buds. After 3 weeks of culture, the small buds are cut off and transferred to MS2 medium.

[0038] 10) After growing in MS2 medium for 1 week, cut off the buds and transfer them to MS3 medium; after continuing to grow in MS3 medium for 1 week, cut off the larger buds and transfer them to rooting medium;

[0039] 11) One week after transplanting into the rooting medium, large buds will begin to root. After another week of growth, remove the rooted tobacco seedlings from the tissue culture bottle, carefully remove any solid culture medium adhering to the roots, and then transplant them into flowerpots. Cover the seedlings with a light-transmitting cover to maintain humidity. Remove the cover after 2-3 days of growth. Then, conduct positive seedling identification. Cultivate the identified seedlings until they reach the flowering stage, continuously observing phenotypic changes and taking photos as needed.

[0040] 12) The plant growth environment is set as follows: relative humidity is maintained at 60%, temperature is constant at 23℃, light cycle is set to 16 hours of light and 8 hours of darkness, and light intensity is controlled at 80-200 μmol / (m²・s).

[0041] II. Silencing the PdMATE16 gene in peony petals using virus-induced gene silencing (VIGS) technology.

[0042] 1) Total RNA was extracted from the petals of *Paeonia yunnanensis* and converted into cDNA using reverse transcription. Based on research on the PdMATE16 gene, its 279 bp non-conserved domain sequence was selected, and upstream and downstream specific primers were designed. The target sequence was amplified and cloned using PCR technology, and the accuracy of the cloned sequence was ensured by sequencing.

[0043] 2) Using seamless cloning technology, the 279 bp sequence of the PdMATE16 gene was directionally inserted between two restriction enzyme sites (EcoRI and BamHI) in the plant expression vector pTRV2-GFP. After construction, the recombinant plasmid was sequenced again to verify the correctness of the inserted sequence and the integrity of the reading frame, avoiding the impact of base mutations or frameshifts on subsequent experimental results.

[0044] 3) The successfully constructed expression vector was transformed into Agrobacterium GV3101. The transformed Agrobacterium was evenly spread on YEP plates containing 50 μg / mL kanamycin and 25 μg / mL rifampin, and the plates were inverted and incubated at 28℃ for 2-3 days. After colonies grew, single colonies were randomly selected and PCR amplification was performed using the colonies as templates. The amplification products were analyzed by agarose gel electrophoresis, and the correctly identified Agrobacterium single clones were labeled for subsequent experiments.

[0045] 4) Select a single Agrobacterium clone that has been correctly identified and inoculate it into 5 mL of LB liquid medium containing the corresponding antibiotic. Place the medium in a shaker at 28℃ and 200 rpm for shaking culture for 16-20 h.

[0046] 5) Transfer the initially cultured Agrobacterium to 100 mL of LB liquid medium at an inoculation ratio of 1%. The LB liquid medium is formulated with 100 μg / mL kanamycin, 25 μg / mL rifampin, 10 mM MES, and 200 μM AS. Incubate the transferred medium overnight at 28°C and 200 rpm using a shaker. Continue incubation until the bacterial concentration reaches OD500. 600 When the temperature reaches 1.8, remove the cells, centrifuge at 5000 rpm for 10 min, and collect the bacterial cells.

[0047] 6) The collected bacterial cells were resuspended using Agrobacterium infection buffer. The Agrobacterium infection buffer was formulated with sterile water as the solvent, containing 10 mM MES, 100 μM AS, and 10 mM MgCl2. After resuscitation, the OD of the bacterial suspension was adjusted using a spectrophotometer. 600 The pH was adjusted to approximately 1.0 to ensure that Agrobacterium was in a suitable state of infection activity. Agrobacterium infection buffer containing pTRV1 was mixed with Agrobacterium infection buffer containing pTRV2-GFP (as a control) and pTRV2-GFP-PdMATE16 in equal volumes. Silwet L-77 was added to both mixed infection buffers to a final concentration of 0.01%. The mixed infection buffers were placed in the dark and incubated at 24°C for 4 hours to allow Agrobacterium to adapt to the infection buffer environment and further activate. The buffers were then ready for use.

[0048] 7) The specific operation of infection is as follows: The test material is the peony variety 'Haihuang'. Unopened and tight flower buds are selected. Using a syringe, bacterial solution is injected into the flower bud, calyx and flower stem. The amount of bacterial solution used for each flower bud is about 3 mL. The treatment group and other important information are clearly marked on the label.

[0049] 8) After injection, tightly wrap the peony buds with black plastic bags to provide shade. The shading period is set to 24 hours, after which the buds will be placed in a normal environment for growth.

[0050] 9) After about 7 days of cultivation, closely observe the phenotypic changes of peony buds and flowers, take photos and test pigments.

[0051] As can be seen from the above implementation scheme, the present invention can enrich the library of transgenic materials that promote the transport and accumulation of flavonoids in peony flowers, and the present invention can be used to target and regulate the yellow trait of peony flowers through transgenic technology.

[0052] The above description is merely a preferred embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any variations or substitutions that can be easily conceived by those skilled in the art within the scope of the technology disclosed in the present invention should be included within the scope of protection of the present invention. Therefore, the scope of protection of the present invention should be determined by the scope of the claims.

[0053] WIPO ST.26 Standard:

[0054] 1. CDS sequence of the MATE gene—PdMATE16:

[0055] ATGGAGGCTCCGCTTATCGTGAATGGTGGTGATGTGGAAGGGGACTATCTTCCGGCGAGG 60

[0056] AGTTTGAGTGAGGTGAAGTCTGTATTCTGGGCAGAGACTGTGAAGCTATGGAAGATAGGA 120

[0057] GGTCCCATCGCTTTCAATATACTGTGTCAATACGGGGTTAATTCTGTGACTAATATCTTT 180

[0058] GTTTGGCCATATCGGTGACCTTGAGCTTTCGGCTGTTTCTATCTCTCTTTCTGTCATTTCT 240

[0059] ATCTTCTCTTTTGGCTTCATGCTTGGTATGGGGAGTGCACTGGAGACGCTATGCGGACAA 300

[0060] GCTTTTGGTGCTGGGAAAATTGACATGCTCGGTGTTTATATGCAACGCTCTTGGTTAATT 360

[0061] TTGTTGGTCAGTTGTGTTATCCTTCTTGCCAATTTACATCTTTGCAACTCCAATTCTAAAG 420

[0062] CTTCTTGGGCAAGAAGATGAAATAGCCCAACTTGCTGGACAATTCACGTTACAAATCATT 480

[0063] CCTCAATTGTTCTCACTTGCCATCAACTTCCCAACGTCAAAGCTCCTTCAGGCCCAGAGC 540

[0064] AAGGTTAAAGTACTTGCATGGGTTGCATTTGTGGCTCTGATTTTACACATTGGACTGCTT 600

[0065] TGGCTCTTCATAGTTGTATTCGATTGGGGTACGACTGGTGCAGCTGTAGCGTATGATATT 660

[0066] ACAAACTGGGGAATTGCCGTGGCCCAAGTTGTATATGCTATTGTTTGGTGTGAGGGATGG 720

[0067] AGTGGATTCTCATGGTCTGCTTTAAAGGATATTTGGGCCTTTGTTAGGCTGTCCCTTGCC 780

[0068] TCCGCCGTGATGCTTTGCCTCGAAATTTGGTATATGATGACTATAATCGTTCTCGCAGGC 840

[0069] CACCTCAGCAATGCAGTGATTGCAGTTGATTCTCTTTCTATTTGCATGAATTTTAATGGG 900

[0070] TGGGAGGCAATGTTATTCATTGGAATAAATGCTGCTATAAGCGTTCGGGTCTCCAATGAG 960

[0071] CTGGGAATGGGACATCCAAGAGCAGCCAAATACTCTGTCTATGTGACAGTCATCCAGTCT 1020

[0072] CTCGTCATTGGGCTTTTATGCATGGTTATTGTGCTAATAACTAAGGACTACTTTGCGGTC 1080

[0073] ATTTTTACAAGCAGCAAACAAGTGCAACGGGCAGTCGCTAACCTTGCTTACCTTCTTGGT 1140

[0074] ATAACCATGGTTCTTAACAGCGTCCAGCCAGTGATATCGGGTGTTGCTGTGGGAGGTGGG 1200

[0075] TGGCAAGCATTGGTGGCTTATATCAATTTGGGAAGTTATTACGTTTTTGGCCTCCCTCTT 1260

[0076] GGGTATCTTCTTGGCTACAAAATGAATTTGGGAGTGACGGGACTTTGGGGGGGCATGATA 1320

[0077] TCTGGAACAGCTCTGCAGACGTTGATCCTTTTGTACGTGCTTTATAAAACGAACTGGAAC 1380

[0078] AAGGAGGTGGAGCAATCATCCGAACGGATGCGAAAGTGGGGTGGGCAAGACATAACCGAG 1440

[0079] AAGATAGTTGCTAGTGTGTAA 1461。

Images