Application of wheat disease-resistant factor TaC4H1 in prevention and treatment of brown leaf rust

Abstract

The invention discloses application of a wheat disease-resistant factor TaC4H1 in prevention and treatment of brown leaf rust, and belongs to the technical field of genetic engineering. The coding gene CDS sequence of the wheat disease resistance factor TaC4H1 is as shown in SEQ ID NO: 1, and the amino acid sequence is as shown in SEQ ID NO: 2. According to the invention, a transgenic wheat strain capable of overexpressing TaC4H1 is obtained by adopting an agrobacterium-mediated method, and the condition that the wheat disease-resistant factor TaC4H1 plays a positive regulation role in wheat leaf rust resistance immune response is known by comparing the morbidity condition of transgenic wheat and wild Fielder wheat after being infected with physiological races of leaf rust THT and PHT and the expression condition of a disease-resistant related marker gene. On the basis, the wheat disease-resistant factor TaC4H1 can be used for creating a leaf rust-resistant wheat material, so that a gene resource and a technical thought are provided for leaf rust-resistant breeding of wheat.

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology and relates to the application of wheat disease resistance factor TaC4H1 in the prevention and control of leaf rust. Background Technology

[0002] Wheat leaf rust is caused by the fungus *Wheat Leaf Rust* (*Cyperus spp.*). Puccinia triticina Leaf rust is a parasitic fungal disease caused by a trophic fungus. This pathogen primarily infects wheat leaves, sometimes also damaging leaf sheaths, and in severe cases, can even spread to the stems and ears. Because the spores produced by the pathogen adhere to the leaf surface, they significantly hinder normal photosynthesis, impairing wheat's energy metabolism and ultimately affecting yield and quality. Furthermore, urediniospores can be dispersed long distances by wind, causing multiple infections within a single growing season, leading to widespread outbreaks of leaf rust.

[0003] In the practice of controlling wheat leaf rust, the main methods relied on the use of fungicides and the planting of resistant varieties. However, the frequent use of fungicides has led to the emergence of drug-resistant strains and also easily causes environmental pollution problems. Compared with the use of fungicides, promoting the planting of resistant varieties is a more environmentally friendly and effective control measure, and screening for superior disease-resistant genes is the key to breeding resistant varieties. Currently, wheat varieties carrying resistance genes have achieved certain results in controlling leaf rust, but newly emerging races often break through the resistance defenses of these varieties, posing an unprecedented challenge to the disease resistance of many cultivated varieties. Therefore, it is urgent to discover new disease-resistant gene resources and create new disease-resistant germplasm materials to achieve sustainable and green control of wheat leaf rust. Summary of the Invention

[0004] To address the aforementioned technical problems and deficiencies, this invention provides the application of wheat disease resistance factor TaC4H1 in the control of leaf rust. This invention clarifies the function of disease resistance factor TaC4H1 in the interaction between wheat and pathogens, providing more superior disease resistance genes for leaf rust resistance breeding.

[0005] In a first aspect, the present invention provides the application of wheat disease resistance factor TaC4H1 in the control of leaf rust, wherein the wheat disease resistance factor TaC4H1 plays a positive regulatory role in the immune response of wheat to leaf rust.

[0006] Furthermore, in the application of the wheat disease resistance factor TaC4H1 provided by the present invention in the control of leaf rust, the characteristic is that the CDS sequence of the encoding gene of the wheat disease resistance factor TaC4H1 is shown in SEQ ID NO:1, and the amino acid sequence is shown in SEQ ID NO:2.

[0007] Furthermore, in the application of the wheat disease resistance factor TaC4H1 provided by the present invention in the control of leaf rust, overexpression of the wheat disease resistance factor TaC4H1 enhances the resistance of wheat to leaf rust.

[0008] Secondly, the present invention provides a method for breeding wheat varieties resistant to leaf rust by overexpressing the gene encoding the wheat disease resistance factor TaC4H1.

[0009] Furthermore, the method for cultivating wheat varieties resistant to leaf rust provided by the present invention includes: constructing a recombinant overexpression vector and converting the recombinant overexpression vector into wheat.

[0010] The recombinant overexpression vector contains the gene encoding the wheat disease resistance factor TaC4H1.

[0011] Furthermore, in the method for breeding wheat varieties resistant to leaf rust provided by the present invention, the transformation method is Agrobacterium-mediated genetic transformation.

[0012] Furthermore, in the method for breeding wheat varieties resistant to leaf rust provided by the present invention, the primer sequences for constructing the recombinant overexpression vector are shown in SEQ ID NO:5 and SEQ ID NO:6.

[0013] Compared with the prior art, the technical solution provided by the present invention has at least the following beneficial effects or advantages: This invention demonstrates the feasibility of using the wheat resistance factor TaC4H1 to breed wheat varieties resistant to wheat leaf rust. Using an Agrobacterium-mediated genetic transformation system, this invention obtained wheat lines capable of overexpressing this resistance factor. By comparing the disease incidence and expression of resistance-related marker genes after infection with leaf rust fungus THT and PHT in transgenic lines and ordinary Fielder wheat, it was found that the wheat resistance factor TaC4H1 plays a positive regulatory role in wheat resistance to wheat leaf rust. Based on the characteristics of the wheat resistance factor TaC4H1, it can be used to create wheat germplasm materials resistant to wheat leaf rust, and it is expected to play a practical role in the control of wheat leaf rust. This invention provides a preferred method: constructing a recombinant overexpression vector containing the gene encoding the wheat resistance factor TaC4H1, transforming it into wheat plants, and obtaining stably inherited wheat lines capable of overexpressing this resistance factor through multiple generations of culture. This invention provides a technical approach for the breeding of wheat varieties resistant to wheat leaf rust, and also provides an environmentally friendly and effective new method for the control of wheat leaf rust. Attached Figure Description

[0014] Figure 1 To build TaC4H1 Vector map of gene overexpression lines.

[0015] Figure 2 for TaC4H1Schematic diagram of PCR detection fragments of gene overexpression lines.

[0016] Figure 3 for TaC4H1 Molecular detection and growth status of gene overexpression lines. In this table, A represents the PCR validation results of the overexpression lines; B represents... TaC4H1 Relative expression levels of the gene in overexpression lines and wild-type Fielder wheat plants; C represents the seedling growth of overexpression lines. TaC4H1 -OE-T3、 TaC4H1 -OE2-T3、 TaC4H1 -OE3-T3、 TaC4H1 -OE7-T3, OE2-T3, OE3-T3, OE7-T3, OE2, OE3, and OE7 are all T3 generation overexpression lines. Fielder is a wild-type Fielder wheat plant. * indicates... P <0.05.

[0017] Figure 4 for TaC4H1 Results of disease resistance identification in gene overexpression lines. Where A represents... TaC4H1 Phenotypic results of leaf disease incidence in gene-overexpressing lines and wild-type Fielder wheat plants; B represents... TaPR1 Relative gene expression level; C is... TaPR2 Relative gene expression level; D is... TaPR5 The relative expression level of genes; TaC4H1 -OE, OE2, OE3, and OE7 are all overexpression lines; Fielder is a wild-type Fielder wheat plant; * indicates... P <0.05. Detailed Implementation

[0018] The technical solution of the present invention will be described below with reference to embodiments. However, the present invention is not limited to the following embodiments. Unless otherwise specified, the experimental methods and detection methods described in each embodiment are conventional methods; unless otherwise specified, the reagents and materials can be purchased commercially.

[0019] Example 1 This embodiment provides the method for obtaining the gene encoding the wheat disease resistance factor TaC4H1.

[0020] The nucleotide sequence of the gene encoding the wheat disease resistance factor TaC4H1 was obtained from the Ensembl Plants website (https: / / plants.ensembl.org / Triticum_aestivum / Info / Index). The CDS sequence of the gene encoding the wheat disease resistance factor is shown below (SEQ ID NO:1): The amino acid sequence of the wheat disease resistance factor TaC4H1 is shown below (SEQ ID NO:2): ; Amplification TaC4H1 The full-length primer sequences for the gene are shown below (SEQ ID NO:3 and SEQ ID NO:4): TaC4H1 -F: 5'-ATGGCTGTCTCCGCGCGCAGGGTGGCCTTC-3' (SEQ ID NO: 3); TaC4H1 -R: 5'-TGCTGAGATGGGGTGGAAGGCGACGACGGA-3' (SEQ ID NO: 4).

[0021] Example 2 This embodiment provides the construction of overexpression transgenic lines.

[0022] according to Figure 1 The vector pattern shown, combined with existing technology, utilizes the amplified vector from Example 1. TaC4H1 The full-length gene sequence (SEQ ID NO:1) was obtained through a gateway reaction of homologous recombination. TaC4H1 The full-length amplified fragment of the gene was ligated into the overexpression vector CUB to obtain the recombinant overexpression vector. TaC4H1 -CUB. The recombinant overexpression vector... TaC4H1 -CUB was transfected into wheat Fielder plants using an Agrobacterium-mediated genetic transformation system to obtain plants capable of stable overexpression. TaC4H1 Genetically modified plants.

[0023] Constructing recombinant overexpression vectors TaC4H1 The primers used for CUB are shown below: TaC4H1 -CUB-F: 5'-CAGGTCGACTCTAGAGGATCCATGGCTGTCTCCGCGCGCAGGGTGGCCTTC-3' (SEQ ID NO: 5); TaC4H1 -CUB-R: 5'-GAGCTCGGTACCCGGGGATCCTGCTGAGATGGGGTGGAAGGCGACGACGGA-3' (SEQ ID NO: 6).

[0024] To obtain overexpression that can be stably inherited TaC4H1 High-generation wheat lines of the gene, for overexpression TaC4H1 The transgenic plants were cultured in multiple generations until the T3 generation. PCR detection was then performed on the transgenic plants, and a schematic diagram of the detected fragments is shown below. Figure 2 As shown, the detection primers are as follows: TaC4H1 -CUB-JC-F:GTGCCTTCCACCCCATCTCAGC (SEQ ID NO:7) TaC4H1 -CUB-JC-R:CCCATCTCATAAATAACGTCATG (SEQ ID NO:8) Test results as follows Figure 3 As shown in A, T3 generation positive strains (L2, L3 and L7) were selected based on the test results. Figure 3 B in TaC4H1 Relative expression levels in overexpression lines and control groups were analyzed in transgenic plants. TaC4H1 The relative expression level of the gene was significantly higher than that of wheat Fielder plants. This invention also photographically recorded the growth of transgenic plants and wheat Fielder plants during the seedling stage, such as... Figure 3 As shown in Figure C, the growth of the transgenic plants was not significantly different from that of the wheat Fielder plants.

[0025] Example 3 This embodiment demonstrates the disease resistance of the overexpressing transgenic lines.

[0026] Referring to the national standard GB / T 45211.2-2025 Technical Specification for Evaluation of Wheat Disease and Pest Resistance Part 2: Methods for Leaf Rust, in the overexpression... TaC4H1 The leaf surfaces of high-generation wheat lines and Fielder wheat plants after the second leaf unfolded were inoculated with leaf rust fungi strains THT and PHT, respectively. Fielder wheat plants served as the control group, and the gene was overexpressed. TaC4H1 The T3 generation wheat lines of the gene include TaC4H1 -OE2、 TaC4H1 -OE3、 TaC4H1 -OE7. Observe the disease incidence of plants in each group 12 days after inoculation.

[0027] Figure 4 Figure A records the disease incidence of different wheat lines after inoculation with THT and PHT physiological races of leaf rust. The figure shows that under THT and PHT infection, disease incidence increased in Fielder wheat plants and plants overexpressing THT and PHT. TaC4H1 In high-generation wheat plants, obvious chlorotic spots and spore masses can be observed on the leaf surface, but overexpression... TaC4H1 The number of spore masses on the leaf surface of advanced wheat plants was significantly less than that on the leaf surface of Fielder plants.

[0028] Example 4 This embodiment provides an analysis of the relative expression levels of disease resistance-related marker genes in overexpressed transgenic lines.

[0029] T3 generation cells that tested positive for PCR TaC4H1 Gene overexpression lines TaC4H1 -OE2、 TaC4H1 -OE3、 TaC4H1 -OE7 and Fielder wheat plants were inoculated with leaf rust fungi THT and PHT on the surface of the leaves after the second leaf unfolded, respectively. Samples were taken for analysis at 24 h and 48 h after inoculation.

[0030] Leaves from the inoculation site of wheat plants were cut, wrapped in aluminum foil, flash-frozen in liquid nitrogen, and stored at -80℃ for later use. Total RNA was extracted from wheat leaves using the Trizol method. First-strand cDNA was synthesized using reverse transcriptase XL (AMV) and the SMART method. qRT-PCR was used for detection. TaC4H1 Relative gene expression levels. Based on disease resistance-related marker genes. TaPR1 , TaPR2 , TaPR5 and elongation factor gene TaEF We designed specific quantitative PCR primers based on the given sequences. The qRT-PCR primer sequences are as follows: TaPR1-F: 5'-GAGAATGCAGACGCCAAGC-3' (SEQ ID NO: 9); TaPR1 -R: 5'-CTGGAGCTTGCAGTCGTTGATC-3' (SEQ ID NO: 10).

[0031] TaPR2 -F: 5'-AGGATGTTGCTTCCATGTTTGCCG-3' (SEQ ID NO: 11); TaPR2 -R: 5'-AAGTAGATGCGCATGCCGTTGATG-3' (SEQ ID NO: 12).

[0032] TaPR5 -F: 5'-CAAGCAGTGGTATCAACGCAGAG-3' (SEQ ID NO: 13); TaPR5 -R: 5'-GTGAAGCCACAGTTGTTCTTGATGTT-3' (SEQ ID NO: 14).

[0033] TaEF -F: 5'-TGGTGTCATCAAGCCTGGTATGGT-3' (SEQ ID NO: 15); TaEF -R: 5'-ACTCATGGTGCATCTCAACGGACT-3' (SEQ ID NO: 16).

[0034] Before use, qRT-PCR primers need to be tested for the specificity and amplification efficiency of their amplification products; the amplification efficiency should be ≥90%. TaEF The gene was used as an internal control in qRT-PCR analysis. Using an AceQ Universal SYBR qPCRMaster Mix (Vazyme, Nanjing, China) and a Bio-Rad CFX Manager quantitative PCR instrument (Bio-Rad, Hercules, California), qRT-PCR was performed using cDNA from different sampling sites for each strain as templates, following the instruction manual. Each gene was performed in triplicate. The Ct values, mean, and standard deviation of each replicate were generated by the quantitative PCR instrument after manually adjusting the baseline. Two [units / items] were used. -ΔΔCt Experimental data analysis was performed using relative quantitative algorithms to determine... TaPR1 , TaPR2 and TaPR5 The relative expression level of genes.

[0035] The results of qRT-PCR are as follows Figure 4 As shown in B, C, and D, Figure 4 Figure B in the text is TaPR1 Statistical graph of relative gene expression levels in control group and transgenic lines. Figure 4 Figure C in the diagram is TaPR2 Statistical graph of relative gene expression levels in control group and transgenic lines. Figure 4 The D diagram in the diagram is TaPR5 Statistical graph of relative gene expression levels in the control group and transgenic lines. Compared with the control group (Fielder wheat plants), at 24 and 48 h after inoculation with leaf rust, TaC4H1 In the T3 generation transgenic lines overexpressing TaPR1 , TaPR2 and TaPR5 The relative expression levels of all genes were significantly upregulated.

[0036] The embodiments described above are some, but not all, of the embodiments of the present invention. The detailed description of the embodiments of the present invention is not intended to limit the scope of the claimed invention, but merely to illustrate selected embodiments of the invention. All other embodiments obtained by those skilled in the art through related deductions and substitutions based on the inventive concept, without inventive effort, are within the scope of protection of the present invention.

Claims

1. The application of wheat disease resistance factor TaC4H1 in the control of leaf rust, characterized in that, The wheat disease resistance factor TaC4H1 plays a positive regulatory role in the immune response of wheat to leaf rust.

2. The application of the wheat disease resistance factor TaC4H1 according to claim 1 in the control of leaf rust, characterized in that, The CDS sequence of the gene encoding the wheat disease resistance factor TaC4H1 is shown in SEQ ID NO:1, and the amino acid sequence is shown in SEQ ID NO:

2.

3. The application of the wheat disease resistance factor TaC4H1 according to claim 1 in the control of leaf rust, characterized in that, Overexpression of the wheat disease resistance factor TaC4H1 enhances wheat resistance to leaf rust.

4. A method for breeding wheat varieties resistant to leaf rust, characterized in that, Overexpression of the gene encoding the wheat disease resistance factor TaC4H1.

5. The method for breeding wheat varieties resistant to leaf rust according to claim 4, characterized in that, include: A recombinant overexpression vector was constructed, and the recombinant overexpression vector was transformed into wheat. The recombinant overexpression vector contains the gene encoding the wheat disease resistance factor TaC4H1.

6. The method for breeding wheat varieties resistant to leaf rust according to claim 5, characterized in that, The transformation method is Agrobacterium-mediated genetic transformation.

7. The method for breeding wheat varieties resistant to leaf rust according to claim 5, characterized in that, The primer sequences for constructing the recombinant overexpression vector are shown in SEQ ID NO:5 and SEQ ID NO:6.

Images