Improved HBoV1 auxiliary system and application thereof in efficient replication of AAV2

By knocking down the TEAD1 gene and modifying the promoter of the AAV2 plasmid, the replication efficiency of AAV2 under the HBoV1 helper system was improved, the problem of insufficient activation of AAV p5, p19 and p40 promoters was solved, the AAV2 viral yield was increased, and the cost of gene therapy drugs was reduced.

CN120944977APending Publication Date: 2025-11-14HENAN UNIVERSITY
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202511162102.8
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-08-19
Publication Date
2025-11-14

AI Technical Summary

Technical Problem

In the process of assisting AAV replication, the existing HBoV1 assist system results in insufficient activation of the AAV p5, p19 and p40 promoters, low expression levels of Rep and Cap proteins, leading to low viral yield and excessively high costs for gene therapy drugs.

Method used

By screening host cytokines to regulate the HBoV1 helper system, knocking down the TEAD1 gene, and modifying the p5 and p40 promoters of the AAV2 plasmid, a modified HEK293T cell line and a modified pIAAV2 plasmid were constructed to promote the expression of AAV2 Rep and Cap proteins and improve the efficiency of AAV2 replication and packaging.

Benefits of technology

It significantly increased the expression levels of AAV2 Rep and Cap proteins, enhanced AAV2 genome replication and progeny viral particle production, and reduced the cost of gene therapy drugs.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120944977A_ABST
    Figure CN120944977A_ABST
Patent Text Reader

Abstract

The invention belongs to the field of biological medicine, and relates to a modified HBoV1 auxiliary system and application thereof in efficient replication of AAV2. The application discovers that knock-down of the TEAD1 gene can improve adeno-associated virus replication under the assistance of the type I human bocavirus auxiliary gene, including improvement of AAV2 Rep and Cap protein expression levels, enhancement of genome replication and increase of filial generation virus particles. According to the present invention, two types of the modified pIAAV2 plasmids capable of improving the AAV2 replication and packaging efficiency are obtained by simultaneously modifying the p5 promoter and the p40 promoter of the AAV2, and after the modified pIAAV2 plasmids and the HBoV1 auxiliary gene are co-transfected to the HEK293T cell, the AAV2 Rep and Cap protein expression can be promoted, the virus yield of the gene treatment drug using the AAV as the carrier in clinic can be improved, the gene treatment cost can be substantially reduced, and the application prospect is broad. The development potential is high.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biomedicine and relates to the modification of the HBoV1 auxiliary system. Background Technology

[0002] Adeno-associated virus (rAAV) is a promising gene therapy vector with advantages such as a wide range of transducible tissues and organs, strong targeting, low immune response, long-term expression of exogenous genes, and high safety. However, the main obstacle to the widespread clinical application of AAV-based gene therapy drugs is the need for high doses of the vector per patient (more than 10 doses per patient) for a single injection. 14 The high cost of gene therapy drugs, often involving individual viral particles (hundreds of thousands to millions of dollars), makes viral replication extremely expensive. As a replication-defective virus, AAV requires the participation of helper viruses and host factors to produce viral loads. HBoV1 (Human Bocavirus 1) assists AAV in viral replication by encoding non-structural proteins NP1 and NS2, as well as the long non-coding RNA BocaSR (bocavirus-transcribed small non-coding RNA). Existing research focuses on improving replication efficiency by modifying these proteins, such as the application with publication number CN118931844A. However, compared to adenovirus (AdV) helper systems, the HBoV1 helper system suffers from problems such as ineffective activation of AAV p5, p19, and p40 promoters, low expression levels of Rep and Cap proteins, and consequently, low viral yield. It is speculated that the restrictive effect of host factors is one of the main reasons for the low AAV promoter activity under the HBoV1 system. Therefore, conducting research on the mechanism of host factor-restricted AAV replication under the HBoV1-assisted system has significant theoretical guiding significance and practical application value for developing novel and efficient AAV vector production systems. Summary of the Invention

[0003] To address the aforementioned technical problems, this invention proposes a modified HBoV1 auxiliary system and its application in efficient AAV2 replication.

[0004] The technical solution of this invention is implemented as follows: This invention screens host cytokines to regulate the efficiency of the HBoV1 helper system in assisting AAV replication, and finds that TEAD1 can regulate it.

[0005] On the one hand, protection is requested for a method of constructing a modified HEK293T cell line, the steps of which are: constructing shRNA targeting the TEAD1 gene in a lentiviral vector, and using a lentiviral knockdown system to construct a modified HEK293T cell line with knocked-down TEAD1.

[0006] The shRNAs described above include the forward sequence shown in SEQ ID No. 1 and the reverse sequence shown in SEQ ID No. 2.

[0007] Forward sequence (SEQ ID No. 1): 5'-GCTCAAACACTTACCAGAGAA-3'; Reverse sequence (SEQ ID No. 2): 5'-CCAGAAGGAAATCTCGTGATT-3'; The aforementioned lentiviral vectors are pLKO.1, pLKO.1-Puro, or pLKO.1-TRC vectors.

[0008] In addition, during the experimental process, this application also discovered that since TEAD1 is a transcription factor, it is very likely that there are binding sites on the three promoters of AAV2.

[0009] Secondly, protection is requested for a modified pIAAV2 plasmid, the promoter sequence of which includes the p5-Mut1 promoter sequence shown in SEQ ID No. 3, and the p40-Mut2 promoter sequence shown in SEQ ID No. 4 or the p40-Mut1-Mut2 promoter sequence shown in SEQ ID No. 5.

[0010] p5-Mut1 promoter sequence (SEQ ID No. 3): 5'-ggaggggtggagtcgtgacgtgaattacgtcatagggttagggaggtcctgtattagaggtcacgtgagtgttttgcgacattttgcg acaccatgtggtcacgctggCtGtttaagcccgagtgagcacgcagggtctccattttgaagcgggaggtttgaacgcgcagccgcc-3'; p40-Mut2 promoter sequence (SEQ ID No. 4): 5'-ggtcaccaagcaggaagtcaaagactttttccggtgggcaaaggatcacgtggttgaggtggagcatgaGttTtacgtcaaaaagggtgg agccaagaaaagacccgcccccagtgacgcagatataagtgagcccaaacgggtgcgcgagtcagttgcgcagccatcgacgtcagacgc-3'; p40-Mut1-Mut2 promoter sequence (SEQ ID No. 5): 5'-ggtcaccaagcaAgaGgtcaaagactttttccggtgggcaaaggatcacgtggttgaggtggagcatgaGttTtacgtcaaaaagggtgg agccaagaaaagacccgcccccagtgacgcagatataagtgagcccaaacgggtgcgcgagtcagttgcgcagccatcgacgtcagacgc-3'.

[0011] Thirdly, protection is requested for an HBoV1 auxiliary system, selected from any of the following: (1) Includes the modified HEK293T cell line constructed according to claim 1, the pIAAV2 plasmid, and the plasmid containing the HBoV1 helper gene; (2) HEK293T cell line, the modified pIAAV2 plasmid as described in claim 4, and plasmid containing the HBoV1 helper gene; (3) Includes the modified HEK293T cell line constructed according to claim 1, the modified pIAAV2 plasmid described in claim 4, and the plasmid containing the HBoV1 helper gene.

[0012] Fourthly, protection is requested for the use of the aforementioned HBoV1 helper system in enhancing the expression levels of AAV2 Rep and Cap proteins.

[0013] Fifthly, protection is requested for the application of the aforementioned HBoV1 auxiliary system in improving the efficiency of AAV2 genome replication.

[0014] Sixthly, protection is requested for the application of the aforementioned HBoV1 auxiliary system in increasing the yield of AAV2 progeny viruses.

[0015] Seventhly, the specific steps of the above application are as follows: the modified pIAAV2 plasmid (pIAAV2-p5-Mut1&p40-Mut2 plasmid or pIAAV2-p5-Mut1&p40-Mut1-Mut2 plasmid) and plasmids containing HBoV1 helper genes (NP1, NS2, BocaSR) are co-transfected into HEK293T cells. After transfection for no less than 48 hours, Q-PCR experiments show that the number of AAV2 progeny virus particles increases.

[0016] The aforementioned HEK293T cells can also be replaced with the modified HEK293T cell line constructed in this application.

[0017] The present invention has the following beneficial effects: This invention discovers that knocking down the TEAD1 gene can enhance adeno-associated virus (AAV) replication assisted by human bocavirus 1 (HBoV1) helper genes (NP1, NS2, BocaSR), including increased expression levels of AAV2 Rep and Cap proteins, enhanced genome replication, and increased progeny viral particles. Simultaneously, the p5 and p40 promoters of AAV2 were modified to obtain two modified pIAAV2 plasmids that can improve AAV2 replication and packaging efficiency. When these modified pIAAV2 plasmids are co-transfected with HBoV1 helper genes (NP1, NS2, BocaSR) into HEK293T cells, the TEAD1 protein is no longer bound during transcription, thus promoting AAV2 Rep and Cap protein expression, genome replication, and progeny viral particle production. Promoting AAV2 replication can further increase the viral yield of AAV-based gene therapy drugs in clinical practice, significantly reducing the cost of gene therapy and demonstrating great development potential.

[0018] This invention discovers that the host factor TEAD1 can inhibit AAV2 replication by binding to the AAV2 p5, p19, and p40 promoters, and that knocking down TEAD1 gene expression can improve the efficiency of the HBoV1 helper system in assisting AAV replication and packaging. Based on the identification of the specific binding sites of TEAD1 on the p5, p19, and p40 promoters, this invention provides two novel modified pIAAV2 plasmids, which can improve the efficiency of the HBoV1 helper system in assisting AAV replication and packaging by 1.75-fold and 1.45-fold, respectively. Therefore, this invention develops a specific method to improve AAV vector yield in practical applications and overcomes the drawback of low efficiency in AAV replication assisted by the HBoV1 helper gene. Attached Figure Description

[0019] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0020] Figure 1 The results of transfecting AAV, NP1, NS2, and BocaSR into TEAD1 knockdown cells are shown. Among them, A represents the detection of AAV2 Rep and Cap protein expression in TEAD1 knockdown cells, B represents the detection of AAV2 genome replication in TEAD1 knockdown cells, C and D represent the quantitative results of AAV2 genome replication in B, and E represents the detection of AAV2 progeny virus particle yield in TEAD1 knockdown cells using Q-PCR technology.

[0021] Figure 2 To identify the binding sites of TEAD1 on the p5, p19, and p40 promoters; where A represents the binding of TEAD1 to the AAV2 p5, p19, and p40 promoters detected by ChIP-qPCR; B represents the predicted TEAD1 binding sites on the AAV2 p5, p19, and p40 promoters; C represents in vitro DNA pull-down assays demonstrating that TEAD1 can bind to the predicted sites; and D, E, and F represent in vitro DNA pull-down assays demonstrating that after mutation of the binding site, TEAD1 no longer binds.

[0022] Figure 3 To demonstrate that mutations in the TEAD1 binding sites on the p5 and p40 promoters enhance AAV2 replication assisted by the HBoV1 helper gene; A represents co-transfection of pBocaHelper and wild-type or mutant pIAAV2 plasmids into HEK293T cells. 48 hours after transfection, cells were collected and Western blots were performed to analyze AAV2 protein expression; B represents co-transfection of pBocaHelper and wild-type or mutant pIAAV2 plasmids into HEK293T cells. 48 hours after transfection, cells were collected and Southern blots were performed to analyze AAV2 genome replication; C and D show the quantitative results of AAV2 genome replication in B; E represents co-transfection of pBocaHelper and wild-type or mutant pIAAV2 plasmids into HEK293T cells. 48 hours after transfection, cells were collected and the yield of AAV2 progeny viral particles was detected using Q-PCR. Detailed Implementation

[0023] The technical solution of the present invention will be clearly and completely described below with reference to the embodiments of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative effort are within the scope of protection of the present invention.

[0024] Unless otherwise specified, the experimental methods used in the following experimental examples are conventional methods; the materials and reagents used are commercially available unless otherwise specified.

[0025] This invention screens host cytokines to regulate the efficiency of the HBoV1 helper system in assisting AAV replication, discovering that TEAD1 can regulate it. By constructing shRNA in the pLKO.1 plasmid using a lentiviral knockdown system, two HEK293T cell lines with TEAD1 knockdown were constructed. Figure 1 A) After discovering that the TEAD1 gene was knocked down, the pBocaHelper plasmid containing the HBoV1 helper genes NP1, NS2, and BocaSR, and the pIAAV2 plasmid containing the AAV2 genome were co-transfected into knockdown cells. Western blot, Southern blot, and Q-PCR techniques detected increased expression of AAV2 Rep and Cap proteins, enhanced genome replication, and increased progeny virus yield. Figure 1 AE).

[0026] shTEAD1-1:5'-GCTCAAACACTTACCAGAGAA-3' shTEAD1-2:5'-CCAGAAGGAAATCTCGTGATT-3' Since TEAD1 is a transcription factor, it is highly likely that it has binding sites on all three promoters of AAV2. Analysis of the sequences of the three AAV2 promoters using the JASPAR website confirmed this (binding sites are underlined).

[0027] (1) The p5 startup sequence is: 5'-ggaggggtggagtcgtgacgtgaattacgtcatagggttagggaggtcctgtattagaggtcacgtgagtgttttgcgacattttgcgacaccatgtggtcacgc tgggtattta agcccgagtgagcacgcagggtctccattttgaagcgggaggtttgaacgcgcagccgcc-3' (2) The p19 promoter sequence is: 5'-gtcacaaagaccagaaatggcgccggaggcgggaacaaggtggtggatgagtgc tacatcccca attacttgctccccaaaacccagcctgagctccagtgggcgtggactaatatgga acagtattta agcgcctgtttgaatctcacggagcgtaaacggttggtggcgcagcatctg-3' (3) The p40 startup sequence is: 5'-ggtcaccaag caggaagtca aagactttttccggtgggcaaaggatcacgtggttgaggtggagca tgaattctac gtcaaaaagggtggagccaagaaaagacccgcccccagtgacgcagatataagtgagcccaaacgggtgcgcgagtcagttgcgcagccatcgacgtcagacgc-3' After performing chromatin immunoprecipitation and Q-PCR experiments, it was confirmed that TEAD1 can indeed bind to the three promoters of AAV2 ( Figure 2 A). After mutating the TEAD1 site on these three promoters, it was found that TEAD1 no longer binds to the three promoters of AAV2 ( Figure 2 BF). The above results can strongly identify the specific binding site of TEAD1 on the AAV2 promoter.

[0028] We then introduced mutations into the p5 and p40 promoters of the AAV2 genome, preventing it from binding to TEAD1. These mutant AAV2 cells were then co-transfected with the HBoV1 helper gene into HEK293T cells to observe whether AAV2 replication was enhanced. Figure 3 The p5 and p40 promoter sequences of these mutant AAV2s are as follows: (1) p5-Mut1 is: 5'-ggaggggtggagtcgtgacgtgaattacgtcatagggttagggaggtcctgtattagaggtcacgtgagtgttttgcgacattttgc gacaccatgtggtcacgctggCtGtttaagcccgagtgagcacgcagggtctccattttgaagcgggaggtttgaacgcgcagccgcc-3' (2) p40-Mut1-Mut2 is: 5'-ggtcaccaagcaAgaGgtcaaagactttttccggtgggcaaaggatcacgtggttgaggtggagcatgaGttTtacgtcaaaaagggtgg agccaagaaaagacccgcccccagtgacgcagatataagtgagcccaaacgggtgcgcgagtcagttgcgcagccatcgacgtcagacgc-3' (3) p40-Mut2 is: 5'-ggtcaccaagcaggaagtcaaagactttttccggtgggcaaaggatcacgtggttgaggtggagcatgaGttTtacgtcaaaaagggtgg agccaagaaaagacccgcccccagtgacgcagatataagtgagcccaaacgggtgcgcgagtcagttgcgcagccatcgacgtcagacgc-3' The solution of this application will be described below with reference to specific embodiments: Example 1: Construction of a lentiviral knockdown system for the TEAD1 gene (1) The cells used were HEK293T (2) The shRNA sequence used to knock down the TEAD1 gene: 1) 5'-GCTCAAACACTTACCAGAGAA-3' 2) 5'-CCAGAAGGAAATCTCGTGATT-3' (3) Design shRNA oligo sequences based on shRNA sequences, as follows: shTEAD1-1-F: 5'-CCGGGCTCAAACACTTACCAGAGAACTCGAGTTCTCTGGTAAGTGTTTGAGCTTTTTG-3' shTEAD1-1-R: 5'-AATTCAAAAAGCTCAAACACTTACCAGAGAACTCGAGTTCTCTGGTAAGTGTTTGAGC-3' shTEAD1-2-F: 5'-CCGGCCAGAAGGAAATCTCGTGATTCTCGAGAATCACGAGATTTCCTTCTGGTTTTTG-3' shTEAD1-2-R: 5'-AATTCAAAAACCAGAAGGAAATCTCGTGATTCTCGAGAATCACGAGATTTCCTTCTGG-3' (4) Insert the shRNA oligos sequence from (3) into the pLKO.1 vector, using AgeI and EcoRI restriction enzyme sites. (5) Packaging of shTEAD1 lentivirus: 1) Taking medium-sized dish cells as an example, prepare a medium-sized dish of 293T cells in good condition with a density of approximately 80%, and package them with lentivirus using the three-plasmid co-transfection method. The ratio of target plasmid: packaging plasmid pSPAX2: envelope plasmid pMD2.G is 4:3:1 (5µg : 3.75µg : 1.25µg). The transfection reagent is PEIMAX, and the volume is 30µl. Dilute the plasmid and transfection reagent separately with 500µl of pure DMEM, mix thoroughly, and incubate in the dark for 25 min before evenly adding them to the cell culture dish.

[0029] 2) Collect cell supernatants at 48 h and 72 h, centrifuge at 5000 rpm for 10 min, and then filter with a 0.45 µm filter.

[0030] 3) Aliquot the filtered lentivirus into 1.5 mL imported centrifuge tubes and store them in a -80 ℃ refrigerator.

[0031] (6) shTEAD1 lentivirus infection of HEK293T cells: 1) Taking small dish cells as an example, under a microscope, infection can be carried out when the cell density reaches about 80%.

[0032] 2) Take about 1 mL of lentivirus from a -80 ℃ freezer, wait for it to thaw completely, add 1 mL of complete culture medium, and then add 2 μL of polybrane to mix the above solution evenly.

[0033] 3) Aspirate the culture medium from the dish and add the above mixture into the dish. Place in an incubator for infection for approximately 12 hours.

[0034] (7) Screening for TEAD1 gene knockdown-stable HEK293T cell lines: 1) Cells infected with lentivirus were screened using puromycin at a final concentration of 5 µg / ml.

[0035] 2) After screening two cell lines containing the dapoxetine resistance gene, the cells were collected and analyzed by Western blot (using rabbit anti-TEAD1, HUABIO) to detect the expression level of TEAD1 protein. If the expression level of TEAD1 protein in the knockdown cells was significantly lower than that in the control cells, it indicated that a stable gene knockdown cell line had been successfully screened.

[0036] Example 2: Construction of pIAAV2 plasmid containing the AAV2 genome and pBocaHelper plasmid containing helper genes NP1, NS2 and BocaSR The construction steps of the pIAAV2 plasmid were carried out in accordance with the article "Human Bocavirus 1 NP1 acts as an ssDNA-binding protein to help AAV2 DNA replication and cooperates with RPAtoregulateAAV2capsid expression".

[0037] The construction steps of the pBocaHelper plasmid were carried out in accordance with the article "Human Bocavirus 1 NP1 acts as an ssDNA-binding protein to help AAV2 DNA replication and cooperates with RPAtoregulateAAV2capsid expression".

[0038] Example 3: Detection of AAV2 replication level in shTEAD1 cells (1) Cell transfection: 1) Taking a six-well plate as an example, under a microscope, transfection is performed when the cell density reaches about 80%.

[0039] 2) The transfection plasmid mass is 2 μg, of which pIAAV2 plasmid is 0.5 μg and pBocaHelper plasmid is 1.5 μg. The transfection reagent PEIMAX is used in a volume of 6 μl.

[0040] 3) Prepare two 1.5 mL imported centrifuge tubes, and add 200 μL of pure DMEM to each. Add 2 μg of plasmid to one tube and 6 μL of transfection reagent to the other tube. Mix well in each tube, then add the pure DMEM containing the transfection reagent to the pure DMEM containing the plasmid and mix again.

[0041] 4) Let it stand in the dark for 25 minutes, then add it evenly to the cells in the six-well plate, gently shake it to make it more even, and transfer it to an incubator for 48 hours.

[0042] (2) Western blot was used to detect the expression level of AAV2 protein: 1) Sample preparation: After transfection and culturing for 48 h, the supernatant of the cells was aspirated with a pipette, and an appropriate amount of 2×SDSLoading Buffer was added to fully lyse the cells. The cells were then transferred to a 1.5 mL centrifuge tube and boiled at 100 °C for 10 min.

[0043] 2) SDS-PAGE gel electrophoresis: Prepare a 12% protein gel according to the size of the target protein. Taking one protein gel as an example, clamp the prepared protein gel onto the electrophoresis clamp, pour in the electrophoresis buffer, mix the prepared protein sample, centrifuge, and add 10 μL of the sample to the wells of the protein gel. Add an appropriate amount of protein marker to one of the wells. Perform SDS-PAGE protein electrophoresis at a current of 14 mAh for 1 h 40 min. Stop electrophoresis when the loading reaches the bottom of the gel.

[0044] 3) Transfer: Prepare the transfer apparatus. Use tweezers to place the cut membrane into the freshly prepared transfer buffer. Then, gently cut the protein gel with a scraper and place it into the freshly prepared transfer buffer. Prepare the transfer sponge pads: place the black sponge pad as the first layer, the white sponge pad as the second layer, and then transfer the membrane to the white sponge pad while it is under the gel, ensuring there are no air bubbles between the gel and the membrane. Place another layer of white sponge pad on top of the protein gel, and then place a black sponge pad on top of that, forming a "sandwich" structure. The outermost transfer clamp corresponds to "black gel, white membrane," and all are placed in the final black and red clamp, maintaining a "black-to-black" arrangement. Perform the transfer at a current of 300 mAh for 1 hour.

[0045] 4) Blocking: After the transfer is complete, remove the membrane and you should see clear protein markers, indicating successful transfer. Place it in the washing container and add PBST to wash for 2 minutes. During this time, recover the solution and arrange the items neatly. Then discard the PBST in the washing container and add 5% skim milk to block for about 2 hours.

[0046] 5) Antibody Incubation: After blocking, apply primary antibodies mouse anti-AAV2 Rep (American Research Products) and mouse anti-AAV2 VP (American Research Products). Incubate with the primary antibodies for 3 hours or overnight at 4°C. After primary antibody incubation, wash the membrane three times with PBST for 10 minutes each time. Add the secondary antibody HRP-conjugated anti-mouse IgG (Jackson Immuno Research), the same source as the primary antibody, and incubate at room temperature for 2 hours. Wash the membrane three times with PBST for 10 minutes each time.

[0047] 6) Luminescence: Prepare chemiluminescence solution in a 1:1 ratio, then take an appropriate amount of the luminescence solution and use a chemiluminescence analyzer to develop and photograph the washed membrane, and store the image.

[0048] (3) Southern blot was used to detect the AAV2 genome replication level: 1) Taking a six-well plate as an example, remove the six-well plate from the incubator and aspirate the culture medium from each well. Add 500 μL of Hirt buffer (50mM Tris-HCl pH7.5, 6% SDS) to each well and shake on a shaker for 5-10 min.

[0049] 2) Use a 1 mL syringe to repeatedly aspirate the cell lysate until it is no longer viscous and can fall in droplets.

[0050] 3) Collect the contents into a 1.5 mL centrifuge tube. Centrifuge at 12000 rpm for 5 min.

[0051] 4) Take 80 μL of cell lysis buffer from each sample, mix it with 80 μL of 2×SDS-loading buffer, and boil it at 100 °C for 10 min to obtain a protein sample for subsequent experiments.

[0052] 5) Add 250 μL of 5M NaCl solution to the remaining system and mix well for 5 min. Place the sample in an ice box and incubate overnight at 4 °C.

[0053] 6) Remove the overnight sample and centrifuge (14000 rpm, 15 min, 4 ℃). Add 34 μL of proteinase K to 500 μL of the supernatant and incubate at 37 ℃ for about 2 h.

[0054] 7) Add 1.5 mL of Buffer QG to the incubated sample, collect the DNA in the sample into the column using a plasmid adsorption column, and elute the column with 1 mL of PE buffer.

[0055] 8) Centrifuge at 12000 rpm for 3 min.

[0056] 9) Add 100 μL of 5Mm Tris solution to the surface of the adsorption column. After centrifugation again, store the sample at -20 ℃.

[0057] 10) Digest Hirt DNA. The reaction system is as follows: 3 μL 10×CutSmart Buffer, 26 μL Hirt DNA, 0.5 μL DpnI. Mix the above system thoroughly and digest at 37 °C for at least 4 hours.

[0058] 11) Add the digested Hirt DNA to 10 μL of 10× laoding, and add 20 μL of the sample to a prepared 1% agarose gel (without dye). Mix 5 μL of homemade marker and 10 μL of 10× laoding and load the sample as an indicator. Run at 40 V for about 10 h.

[0059] 12) Remove the runnated gel and place it in the washing box. In the following steps, all solutions added must completely cover the gel surface, and the process should be slow and gentle. Wash with ddH₂O for 2 min, discard the solution, and then add solution I and wash for 30 min. Discard solution I, add ddH₂O and wash for 2 min, discard the solution, and then add solution II and wash for 30 min. Discard solution II, add ddH₂O and wash for 2 min, discard the solution, and then add solution III and wash for 30 min, repeating this process twice. Discard solution III and add 20×SSC.

[0060] 13) Prepare the transfer equipment. Soak the membrane in ddH2O for a few minutes, then soak it in 20×SSC. Prepare the transfer apparatus, rinse it once, and arrange the membranes in order. Keep the yellow pad moist, place the membrane on it, ensuring there are no air bubbles, then place the green plastic film on top, then place the adhesive on top, secure the slot, pour in the 20×SSC, and turn on the pump to transfer the membrane for approximately 2 hours.

[0061] 14) After the transfer is complete, prepare 200 mL of 6×SSC and turn on the hybridization oven to a temperature of 55 ℃. Cut off the lower right corner of the transferred membrane as a mark, place it in the tank, add 6×SSC, and wash for 5 min. Place the washed membrane on filter paper and transfer it to a UV crosslinker for UV crosslinking.

[0062] 15) Fill the hybridization tube with ddH2O, place the membrane inside, avoiding air bubbles, and pour out the ddH2O after bonding. Add 6 mL of hybridization solution and pre-hybridize at 55 ℃ for 2 h.

[0063] 16) Place the homemade probe on ice, add 20 μL of TE-EF buffer, boil at 100 °C for 5 min, and place on ice for 5 min. Add it vertically to the hybridization tube. Hybridize overnight at 55 °C.

[0064] 17) The next day, preheat the high and low sensitivity solutions in the hybridization furnace. Discard the solution in the hybridization tube, add 30 mL of low sensitivity solution, and wash in the hybridization furnace for 20 min. Repeat this process twice. Then add the high sensitivity solution and repeat the above steps.

[0065] 18) Set the hybridization furnace temperature to 19 ℃. Prepare 50 mL of 2×SSC, discard the high-strength solution, add 25 mL of 2×SSC, and mix in a room temperature mixer for 10 min, washing twice.

[0066] 19) Prepare 50 mL of 1×MAB, discard 2×SSC and add 25 mL of 1×MAB, rotate at room temperature for 10 min, repeat twice. Discard 1×MAB and add 6 mL of blocking solution, block at 19 ℃ for at least 2 h.

[0067] 20) Add 1 μL of Dig antibody vertically to the hybridization tube and incubate at 19 °C for about 2 h.

[0068] 21) Discard the blocking solution and add 25 mL of Southern wash buffer. Wash for 25 min, twice. Discard the Southern wash buffer, add 25 mL of 1×detection buffer, and wash for 10 min, twice.

[0069] 22) Prepare the luminescent solution by diluting 300 μL of the stock solution to 3 mL and mixing well. Attach plastic wrap to the dark box and secure it with tape. Blot the membrane dry on filter paper, then place the membrane on the plastic wrap. Add the luminescent solution evenly, and then cover the membrane with the plastic wrap again, ready to luminescent.

[0070] (4) Use Q-PCR to detect the production level of AAV2 progeny virus particles: 1) Remove the six-well plate from the incubator, discard the culture medium, add 500 μL of 1×PBS to each well to wash the cells, discard the PBS, then add 500 μL of AAV lysis buffer (25 mM Tris-HCl pH 8.0, 150 mM NaCl, 2 mM MgCl2, 0.5% sodium deoxycholate), place on a shaker and shake for 5 min, then add 10 μL of DNase I (10 mg / mL) to each well and continue shaking until the solution is no longer viscous.

[0071] 2) Take 100 μL of lysis buffer from each well, add an equal volume of 2×loading, heat at 100 ℃ for 10 min, and then freeze at -20 ℃ for Western blot sample.

[0072] 3) Transfer the remaining solution to a 1.5 mL centrifuge tube and incubate in a 37°C water bath for 1 hour.

[0073] 4) Centrifuge at 6000 g for 5 min, take 10 μL of supernatant and add it to 200 μL of AAVlysis buffer containing Benzonase (final concentration of 50 U / mL), mix well by pipetting and incubate in a 37℃ water bath for 1 h.

[0074] 5) Remove the sample, add 4 μL of 0.5 M EDTA to terminate the lysis reaction, then add 200 μL of Buffer AL and 10 μL of proteinase K (25 mg / mL), and place in a 55°C water bath for 15-25 minutes.

[0075] 6) Add 200 μL of anhydrous ethanol, mix well, and then add it to the adsorption column. After the sample has flowed out, add 500 μL of AW1 and AW2, and centrifuge at 15000g for 3 min.

[0076] 7) Finally, add 100 μL of 5 mM Tris-HCl to the column, centrifuge and elute, and store at -20℃ for later use.

[0077] 8) Perform Q-PCR quantification using the following primers: forward primer 5'-TCTGCAGCTCCCACTCGA T-3' and reverse primer 5'-TTTGCTTCCTTCATCACACAGTACT-3'.

[0078] Knocking down TEAD1 enhances AAV2 replication assisted by the HBoV1 helper gene, as shown in the following figure. Figure 1 As shown, Figure 1 Western blot analysis in A showed that, compared with shScramble cells, TEAD1 knockdown cells had significantly increased levels of AAV2 Rep and capsid protein. Figure 1 B. Hirt DNA extracted from shScramble or shTEAD1 cells was digested with DpnI, and Southern blot analysis was performed on AAV2 genome replication. The size markers of dRF, mRF, ssDNA, and AAV2 DNA are labeled in the figure. Figure 1 C uses ImageJ software for measurement. Figure 1The levels of mRF DNA in cells B indicated that the levels of AAV2 mRF in shTEAD1 cells were increased by 1.2-fold and 1.3-fold, respectively, compared to shScramble cells. **, P<0.01; ***, P<0.001. Figure 1 D used ImageJ software to measure at Figure 1 The viral single-stranded DNA levels detected in lanes 2 to 4 of sample B indicate that the viral single-stranded DNA content in shTEAD1 cells was increased by 1.2-fold and 1.4-fold, respectively, compared to shScramble cells. * indicates a P-value less than 0.05; ** indicates a P-value less than 0.01. Figure 1 Quantitative analysis of progeny AAV2 viral particle levels in E cells showed that the content of progeny AAV2 viral particles in shTEAD1 cells was 3.3-fold and 3.4-fold higher, respectively, compared to shScramble cells. Viral yield was expressed as DRP per cell. ***, P < 0.001.

[0079] Example 4: Using ChIP-qPCR technology to demonstrate that TEAD1 can bind to the p5, p19 and p40 promoters (1) Construction of FLAG-TEAD1 plasmid: First, the TEAD1 gene was amplified from cDNA using forward primer 5'-GGGAGACCCAAGCTGGCTAGCGCCACCATgGAGCCCAGCAGCTGG-3' and reverse primers 5'-AACGGGCCCTCTAGACTCGAGTTAAACCTTATCGTCGTCATCCTTG-3' and 5'-ATCGTCGTCATCCTTGTAATCGGCGCCGTCCTTTACAAGCCTG-3'; then, the amplified product was inserted into the pcDNA3.1 vector through one-step cloning via NheI and XhoI sites.

[0080] (2) Perform chromatin immunoprecipitation experiment: 1) Taking the medium-sized dish as an example, when the cell density is about 80%, FLAG-TEAD1, pBocaHelper and pIAAV2 plasmids are transfected into HEK293T cells.

[0081] 2) Sample collection was performed 48 h after transfection. 135 μL of 37% formaldehyde solution was added to the cell culture dish, mixed well, and incubated at 37 ℃ for 10 min.

[0082] 3) Add 0.55 mL of Glycine Solution (10×) to the petri dish, mix well, and let stand at room temperature for 5 min.

[0083] 4) Discard the culture medium, place the culture dish on ice, add 5 mL of PBS (containing 1 mM PMSF) to the culture dish, shake gently, and then discard the liquid. Repeat this operation twice.

[0084] 5) After lysing the cells with 1 mL of PBS (containing 1 mM PMSF), collect the cells using a cell scraper and place them in centrifuge tubes. Then, use a cell counter to divide the cells into approximately 1 million cells per tube.

[0085] 6) Centrifuge the separated cells (4 ºC / 1000 g / 2 min) and discard the cell supernatant after centrifugation.

[0086] 7) Add 0.2 mL of SDS Lysis Buffer (containing 1 mM PMSF) to a centrifuge tube and resuspend 1 million cells. Place the resuspended cells on ice for 10 min.

[0087] 8) Sonication to cut genomic DNA. Use a non-contact sonicator, sonicating for 30 seconds, then pausing for 30 seconds. Repeat 40 cycles.

[0088] 9) Add 8 μL of 5M NaCl to the ultrasonicated sample and heat it (65 ºC / 4 h).

[0089] 10) Add an equal volume of Tris-equilibrated phenol, centrifuge (4 ºC / 12000 g / 5 min), and collect the supernatant.

[0090] 11) Add an equal volume of chloroform to (10), mix well, and centrifuge (4 ºC / 12000 g / 5 min). Collect the supernatant into another centrifuge tube.

[0091] 12) Add 5 μL of phenol-chloroform extract and observe the cleavage effect of genomic DNA by agarose gel electrophoresis.

[0092] 13) Centrifuge the sample treated in step (8) (4 ºC / 12000 g / 5 min). Collect the supernatant and add 1.8 mL of ChIP Dilution Buffer (containing 1 mM PMSF).

[0093] 14) Divide the above solution into two portions and add mouse anti-FLAG antibody and IgG control antibody to each portion. Incubate them overnight on a 4 ℃ mixer.

[0094] 15) The next day, add 40 μL of magnetic beads and incubate at 4 °C for about 2 hours by rotation. Discard the liquid to wash the precipitate, adding 1 mL of washing solution each time, and then incubate at 4 °C for 5 minutes. Add the washing solution to the precipitate sequentially and then discard it.

[0095] 16) The liquid was then removed very carefully using a magnetic rack. After the washing step was completed, 250 μL of solution buffer was added to the cell pellet. Mix thoroughly and incubate at room temperature for 5 min.

[0096] 17) Collect the liquid using a magnetic rack. Add 250 μL of Elution buffer to the precipitate and rotate at room temperature for 5 min.

[0097] 18) Mix the two collected liquids, then add 20 μL of 5M NaCl and heat (65 ºC / 4 h).

[0098] 19) Add 10 μL of 0.5M EDTA, 20 μL of 1M Tris pH 6.5, and 1 μL of 20 mg / mL PK to the heated sample. Mix the liquid thoroughly and incubate at 45 ºC for 60 min.

[0099] 20) Add an equal volume of Tris to equilibrate the phenol, and centrifuge (4 ºC / 12000 g / 5 min). Collect the supernatant. Add an equal volume of chloroform, and centrifuge again (4 ºC / 12000 g / 5 min).

[0100] 21) Collect the supernatant, and add 20 μg yeast tRNA, 1 / 10 volume of 3 M NaAc (pH 5.2), and 2.5 volumes of anhydrous ethanol in sequence. Freeze at -80 ºC for about 2 hours.

[0101] 22) After removing the centrifuge tubes from the -80 ºC freezer, centrifuge them (4 ºC / 12000 g / 10 min) and discard the supernatant.

[0102] 23) Take 1 mL of 70% ethanol to wash the above precipitate and centrifuge (4 ºC / 12000 g / 10 min), and discard the supernatant.

[0103] 24) Resuspend the DNA precipitate in 30 μL of water and then detect it using qPCR.

[0104] (3) Perform Q-PCR experiments to detect whether TEAD1 binds to the p5, p19 and p40 promoters: 1) Use the DNA mentioned above as a template.

[0105] 2) The primers used to amplify the p5 promoter sequence were 5'-GGAGGGGTGGAGTCGTGACG-3' and 5'-GGCGGCTGCGCGTTCAAACC-3'; 3) The primers used to amplify the p5 promoter sequence were 5'-GTCACAAAGACCAGAAATGG-3' and 5'-CAGATGCTGCGCCACCAACC-3'; 4) The primers used to amplify the p5 promoter sequence are 5'-GGTCACCAAGCAGGAAGTCA-3' and 5'-GCGTCTGACGTCGATGGCTG-3'.

[0106] (4) Use the JASPAR website (https: / / jaspar.elixir.no / analysis) to predict whether there are TEAD1 binding sites on the p5, p19 and p40 promoters (underlined). The p5 startup sequence is: 5'-ggaggggtggagtcgtgacgtgaattacgtcatagggttagggaggtcctgtattagaggtcacgtgagtgttttgcgacattttgcgacaccatgtggtcacgc tgggtattta agcccgagtgagcacgcagggtctccattttgaagcgggaggtttgaacgcgcagccgcc-3'; The p19 startup sequence is: 5'-gtcacaaagaccagaaatggcgccggaggcgggaacaaggtggtggatgagtgc tacatcccca attacttgctccccaaaacccagcctgagctccagtgggcgtggactaatatgga acagtattta agcgcctgtttgaatctcacggagcgtaaacggttggtggcgcagcatctg-3'; The p40 startup sequence is: 5'-ggtcaccaag caggaagtca aagactttttccggtgggcaaaggatcacgtggttgaggtggagca tgaattctacgtcaaaaagggtggagccaagaaaagacccgcccccagtgacgcagatataagtgagcccaaacgggtgcgcgagtcagttgcgcagccatcgacgtcagacgc-3'.

[0107] (5) In vitro DNA pull-down experiments demonstrated that TEAD1 can bind to the predicted binding sites on the p5, p19 and p40 promoters. (6) dsDNA with 5'-biotin modification that meets the experimental requirements was obtained through commercial synthesis and annealing. The sequence is as follows: p5-TBS-F: 5'-accatgtggtcacgctgggtatttaagcccgagtgagcac-3'; p5-TBS-R: 5'-accatgtggtcacgctgggtatttaagcccgagtgagcac-3'; p19-TBS-1-F: 5'-gtggtggatgagtgctacatccccaattacttgctcccca-3'; p19-TBS-1-R: 5'-tggggagcaagtaattggggatgtagcactcatccaccac-3'; p19-TBS-2-F: 5'-gtggactaatatggaacagtatttaagcgcctgtttgaat-3'; p19-TBS-2-R: 5'-attcaaacaggcgcttaaatactgttccatattagtccac-3'; p40-TBS-1-F:5'-gggaaggtcaccaagcaggaagtcaaagactttttccggt-3'; p40-TBS-1-R: 5'-accggaaaaagtctttgacttcctgcttggtgaccttccc-3'; p40-TBS-2-F: 5'-ggttgaggtggagcatgaattctacgtcaaaaagggtgga-3'; p40-TBS-2-R: 5'-tccaccctttttgacgtagaattcatgctccacctcaacc-3'; Dissolve 10 µM each of the synthesized F and R dsDNA in 50 µl of water, boil at 100 °C for 5 min, and then slowly cool to room temperature to obtain dsDNA.

[0108] (2) Expression and purification of TEAD1 protein: 1) The TEAD1 gene was inserted into the pMBP-His vector through the NdeI and XhoI sites, so that its N-terminus was tagged with MBP- and its C-terminus with His-.

[0109] 2) Transform the MBP-TEAD1-His plasmid into BL21(DE3) competent cells.

[0110] 3) After picking a single clone, inoculate it into 10 ml of LB medium containing kanamycin and incubate overnight at 37°C.

[0111] 4) Inoculate the overnight culture into 1L of LB medium containing kanamycin and incubate at 37°C until OD. 600nm =0.6-0.8.

[0112] 5) Add IPTG to a final concentration of 0.3 mM and continue culturing for 4 hours.

[0113] 6) Collect the bacterial cells by centrifugation at 4℃ for 15 minutes with 5000g of the solution.

[0114] 7) Use 20 ml buffer A (25 mM Tris-HCl pH8.0, 150 mM NaCl, 10 mMimidazole, 1 mM PMSF) to resuspend the cells.

[0115] 8) Ultrasonic disruption of cells.

[0116] 9) Centrifuge at 15000g, 4℃ for 30 min, and collect the supernatant.

[0117] 10) After passing the supernatant through the Ni column, rinse the column sequentially with buffer A containing 20 mM and 50 mM imidazole to remove impurities and proteins.

[0118] 11) The target protein was eluted using buffer A containing 300 mM imidazole and verified by SDS-PAGE electrophoresis.

[0119] (3) The in vitro DNA pull-down experiment is as follows: 1) Streptavidin beads were pre-bound with biotin-dsDNA to a final concentration of 1 μM in binding buffer (12 mM HEPEs-Na pH 7.9, 4 mM Tris-HCl pH 7.9, 150 mM NaCl, 60 mM KCl, 1 mM EDTA, 1 mM DTT, 12% glycerol and 0.01% NP-40).

[0120] 2) Add TEAD1 protein to a final concentration of 10 μM.

[0121] 3) After incubating at 4℃ for 2 h, wash the centrifuged Beads-dsDNA-protein complex with binding buffer to remove non-specific binding.

[0122] 4) The binding of the final biotin-dsDNA to the TEAD1 protein was detected by SDS-PAGE electrophoresis and Western blot experiments.

[0123] This embodiment identified the binding sites of TEAD1 on the p5, p19 and p40 promoters. Figure 2 A shows that HEK293T cells were co-transfected with pIAAV2, pBocaHelper, and FLAG-TEAD1 expression vectors, or pIAAV2, pBocaHelper, and a control vector. Forty-eight hours later, ChIP experiments were performed using anti-FLAG antibody or control IgG. The binding of FLAG-TEAD1 to the p5, p19, and p40 promoters was quantified by qPCR.

[0124] Example 5: After mutating the TEAD1 binding sites on the p5, p19, and p40 promoters, in vitro DNA pull-down experiments demonstrated that they no longer bind to TEAD1. (1) dsDNA with a TEAD1 binding site mutation was obtained through commercial synthesis and annealing. The sequence is as follows: p5-Mut-F:5'-accatgtggtcacgctggCtGtttaagcccgagtgagcac-3' p5-Mut-R:5'-gtgctcactcgggcttaaaCaGccagcgtgaccacatggt-3' p19-Mut-1-F:5'-gtggtggatgagtgctaTatccccaattacttgctcccca-3' p19-Mut-1-R:5'-tggggagcaagtaattggggatAtagcactcatccaccac-3' p19-Mut-2-F:5'-gtggactaatatggaacaAtaCttaagcgcctgtttgaat-3' p19-Mut-2-R:5'-attcaaacaggcgcttaaGtaTtgttccatattagtccac-3' p40-Mut-1-F:5'-gggaaggtcaccaagcaAgaGgtcaaagactttttccggt-3' p40-Mut-1-R: 5'-accggaaaaagtctttgacCtcTtgcttggtgaccttccc-3' p40-Mut-2-F:5'-ggttgaggtggagcatgaGttTtacgtcaaaaagggtgga-3' p40-Mut-2-R:5'-tccaccctttttgacgtaAaaCtcatgctccacctcaacc-3' Dissolve 10 µM each of the synthesized F and R dsDNA in 50 µl of water, boil at 100 °C for 5 min, and then slowly cool to room temperature to obtain dsDNA.

[0125] (2) Expression and purification of TEAD1 protein: 1) The TEAD1 gene was inserted into the pMBP-His vector through the NdeI and XhoI sites, so that its N-terminus was tagged with MBP- and its C-terminus with His-.

[0126] 2) Transform the MBP-TEAD1-His plasmid into BL21(DE3) competent cells.

[0127] 3) After picking a single clone, inoculate it into 10 ml of LB medium containing kanamycin and incubate overnight at 37°C.

[0128] 4) Inoculate the overnight culture into 1L of LB medium containing kanamycin and incubate at 37°C until OD. 600nm =0.6-0.8.

[0129] 5) Add IPTG to a final concentration of 0.3 mM and continue culturing for 4 hours.

[0130] 6) Collect the bacterial cells by centrifugation at 4℃ for 15 minutes with 5000g of the solution.

[0131] 7) Use 20 ml buffer A (25 mM Tris-HCl pH8.0, 150 mM NaCl, 10 mMimidazole, 1 mM PMSF) to resuspend the cells.

[0132] 8) Ultrasonic disruption of cells.

[0133] 9) Centrifuge at 15000g, 4℃ for 30 min, and collect the supernatant.

[0134] 10) After passing the supernatant through the Ni column, rinse the column sequentially with buffer A containing 20 mM and 50 mM imidazole to remove impurities and proteins.

[0135] 11) The target protein was eluted using buffer A containing 300 mM imidazole and verified by SDS-PAGE electrophoresis.

[0136] (3) The in vitro DNA pull-down experiment is as follows: 1) Streptavidin beads were pre-bound with biotin-dsDNA to a final concentration of 1 μM in binding buffer (12 mM HEPEs-Na pH 7.9, 4 mM Tris-HCl pH 7.9, 150 mM NaCl, 60 mM KCl, 1 mM EDTA, 1 mM DTT, 12% glycerol and 0.01% NP-40).

[0137] 2) Add TEAD1 protein to a final concentration of 10 μM.

[0138] 3) After incubating at 4℃ for 2 h, wash the centrifuged Beads-dsDNA-protein complex with binding buffer to remove non-specific binding.

[0139] 4) The binding of the final biotin-dsDNA to the TEAD1 protein was detected by SDS-PAGE electrophoresis and Western blot experiments.

[0140] Figure 2 B uses the JASPAR website to predict the TEAD1 binding sites on the p5, p19, and p40 promoters. Figure 2 In vitro DNA pull-down experiments demonstrated that TEAD1 can bind to the predicted binding site. Figure 2 In vitro DNA pull-down experiments (D, E, and F) demonstrated that TEAD1 does not bind to the mutated binding site. Figure 3 Mutating the TEAD1 binding sites on the p5 and p40 promoters enhances AAV2 replication assisted by the HBoV1 helper gene. (A, B, C, D, E) HEK293T cells were co-transfected with pBocaHelper and wild-type or mutant pIAAV2. Forty-eight hours after transfection, cells were collected and analyzed by Western blot, Southern blot, and Q-PCR to assess AAV2 protein expression, genome replication, and progeny virus generation. Figure 3 A. Western blot analysis showed that when the TEAD1 binding site was mutated at the p5 and p40 promoters, the levels of AAV2 Rep52 and capsid protein were significantly increased. Figure 3 B represents a Southern blot experiment performed using Hirt DNA extraction, DpnI enzyme treatment, and DIG-labeled AAV2 probe hybridization. The obtained bands were compared and analyzed with molecular weight standards for dRF DNA, mRF DNA, single-stranded DNA, DpnI-digested DNA, and AAV2 DNA. Figure 3 C used ImageJ software to measure Figure 3 The mRF DNA intensity in lanes 1 to 3 of swim bladder B indicates that the mRF content of the two mutant AAV2s was increased by 1.5-fold and 1.5-fold, respectively, compared to wild-type AAV2. *, P<0.05. Figure 3 D measured using ImageJ software. Figure 3 The viral ssDNA content in lanes 1 to 3 of swim bladder B indicates that the ssDNA content of the two mutant AAV2 strains was increased by 1.4-fold and 1.3-fold, respectively, compared to wild-type AAV2. *, P<0.05. Figure 3 Quantification of AAV2 progeny yields showed that the progeny viral particle content of the two mutant AAV2 strains was increased by 1.8-fold and 1.5-fold, respectively, compared to wild-type AAV2. Virus yield is expressed as DRP (DNA-releasing particles) per cell. Error bars represent the standard deviation of three independent experiments. ***, P < 0.001; ****, P < 0.0001.

[0141] Example 6: Mutating the TEAD1 binding sites on the p5 and p40 promoters using site-directed mutagenesis PCR. The primers used for the p5 promoter mutation were: 5'-gtcacgctggCtGtttaagc-3' and 5'-gcttaaaCaGccagcgtgac-3'; The primers used for p40 promoter mutation are: 5'-caccaagcaAgaGgtcaaag-3' and 5'-ctttgacCtcTtgcttggtg-3'; 5'-gacgtaAaaCtcatgctccac-3' and 5'-gacgtaAaaCtcaTtgctccac-3'; All of the above mutation primers were synthesized by Beijing Qingke Biotechnology Co., Ltd.

[0142] The PCR reaction system consisted of: 10 µl ddH2O, 10 µl 5×PS buffer, 4 µl dNTP, 1 µl 10 µM forward primer, 1 µl 10 µM reverse primer, 50 ng pIAAV2 plasmid, and 0.5 µl DNA polymerase.

[0143] The PCR reaction conditions were: 98℃ for 2 min, 98℃ for 10 s, 50℃ for 15 s, 72℃ for 7 min and 42 s, 72℃ for 5 min, for 35 cycles.

[0144] The promoter sequences obtained after mutation are as follows: p5-Mut1, p40-Mut1-Mut2, and p40-Mut2 (1) p5-Mut1 is: 5'-ggaggggtggagtcgtgacgtgaattacgtcatagggttagggaggtcctgtattagaggtcacgtgagtgttttgcgacattttgcg acaccatgtggtcacgctggCtGtttaagcccgagtgagcacgcagggtctccattttgaagcgggaggtttgaacgcgcagccgcc-3'; (2) p40-Mut1-Mut2 is: 5'-ggtcaccaagcaAgaGgtcaaagactttttccggtgggcaaaggatcacgtggttgaggtggagcatgaGttTtacgtcaaaaagggtgg agccaagaaaagacccgcccccagtgacgcagatataagtgagcccaaacgggtgcgcgagtcagttgcgcagccatcgacgtcagacgc-3'; (3) p40-Mut2 is: 5'-ggtcaccaagcaggaagtcaaagactttttccggtgggcaaaggatcacgtggttgaggtggagcatgaGttTtacgtcaaaaagggtgg agccaagaaaagacccgcccccagtgacgcagatataagtgagcccaaacgggtgcgcgagtcagttgcgcagccatcgacgtcagacgc-3'.

[0145] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A method for constructing a modified HEK293T cell line, characterized in that, The steps are as follows: By constructing shRNA targeting the TEAD1 gene in a lentiviral vector, a modified HEK293T cell line with knocked-down TEAD1 is constructed using a lentiviral knockdown system.

2. The method for preparing the modified HEK293T cell line according to claim 1, characterized in that: The shRNA includes a forward sequence as shown in SEQ ID No. 1 and a reverse sequence as shown in SEQ ID No.

2.

3. The method for preparing the modified HEK293T cell line according to claim 1 or 2, characterized in that: The lentiviral vector is pLKO.1, pLKO.1-Puro, or pLKO.1-TRC vector.

4. A modified pIAAV2 plasmid, characterized in that: The promoter sequence of the modified pIAAV2 plasmid includes the p5-Mut1 promoter sequence shown in SEQ ID No. 3, and the p40-Mut2 promoter sequence shown in SEQ ID No. 4 or the p40-Mut1-Mut2 promoter sequence shown in SEQ ID No.

5.

5. An HBoV1 auxiliary system, characterized in that, Choose from any of the following: (1) Includes the modified HEK293T cell line constructed according to claim 1, the pIAAV2 plasmid, and the plasmid containing the HBoV1 helper gene; (2) HEK293T cell line, the modified pIAAV2 plasmid as described in claim 4, and plasmid containing the HBoV1 helper gene; (3) Includes the modified HEK293T cell line constructed according to claim 1, the modified pIAAV2 plasmid described in claim 4, and the plasmid containing the HBoV1 helper gene.

6. The application of the HBoV1 assist system according to claim 5 in improving the expression levels of AAV2 Rep and Cap proteins.

7. The application of the HBoV1 auxiliary system according to claim 5 in improving the AAV2 genome replication efficiency.

8. The application of the HBoV1 auxiliary system according to claim 5 in increasing the yield of AAV2 progeny viruses.

9. The application according to any one of claims 6-8, characterized in that, The steps are as follows: The modified pIAAV2 plasmid as described in claim 4 and the plasmid containing the HBoV1 helper gene are co-transfected into HEK293T cells for at least 48 hours.

10. The application according to claim 9, characterized in that: The HEK293T cells can also be replaced with the modified HEK293T cell line constructed according to claim 1.

Citation Information

Patent Citations

  • Cell line for enhancing functions of HBoV1 auxiliary system, improved HBoV1 auxiliary system and application of improved HBoV1 auxiliary system in efficient auxiliary AAV replication

    CN118931844A