Method for efficiently cyclizing single-stranded RNA (Ribonucleic Acid)

Abstract

The invention discloses a method for efficiently cyclizing single-stranded RNA (Ribonucleic Acid), which is characterized in that a DNA (Deoxyribose Nucleic Acid) bridging fragment in a synthesis process has the following characteristics; two ends of the DNA single-chain bridge are respectively and completely complementary with 5'and 3 'ends of target RNA to be cyclized, hybrid double strands of DNA and RNA are formed after complementation, and the difference between the melting temperature of the double strands formed by complementation with the 5' end of the RNA and the melting temperature of the double strands formed by complementation with the 3 'end of the RNA is more than 5 DEG C, so that a DNA and RNA hybrid strand with asymmetric melting temperature is formed; the DNA bridge is heterozygous through gradient cooling, so that the efficiency can be improved, and the cyclization efficiency is increased by 50-1000 times compared with that of a common DNA bridge synthesis symbol.

Description

Technical Field

[0001] This invention belongs to the field of molecular biology applications, specifically relating to a method for efficiently linking single-stranded RNA fragments and a DNA single-stranded fragment adapted to this method. This method can efficiently synthesize circRNA single-stranded fragments in vitro, providing a solid foundation for the application of circRNA in drugs and vaccines. Background Technology

[0002] Since the first use of the smallpox vaccine in 1796, vaccines have been used to prevent various diseases for over two centuries. As one of the most outstanding achievements in human medical history, vaccines are the most economical and effective means of preventing and controlling disease, saving millions of lives each year. Thanks to the widespread use of vaccines, smallpox has been completely eradicated, and the incidence of polio, measles, and other childhood diseases has been significantly reduced worldwide.

[0003] Traditional vaccination methods, including inactivated vaccines, live attenuated vaccines, recombinant protein vaccines, and vector vaccines, have effectively controlled at least 30 infectious diseases globally, providing long-lasting protection against a variety of dangerous infectious diseases. Currently, there are over 40 types of vaccines available. Meanwhile, new multivalent vaccines are constantly emerging to improve accessibility and reduce the number of doses. Despite these successes, significant obstacles remain in vaccine development against various infectious pathogens, especially those that can better evade adaptive immune responses. For example, viruses such as dengue virus (DENV) and Zika virus (ZIKV) exhibit antibody-dependent enhancement, which hinders the efficacy of classic vaccines. Furthermore, the Ebola and Zika virus outbreaks demonstrate that the slow pace of commercial vaccine development and approval based on traditional vaccines is insufficient to address rapidly emerging acute viral diseases. Therefore, developing more effective, faster, and more universal vaccine platforms is crucial.

[0004] Against the backdrop of the COVID-19 pandemic, SARS-CoV-2 mRNA vaccines mRNA-1273 (Moderna) and BNT162b2 (Pfizer) have achieved significant success, receiving FDA Emergency Use Authorization, demonstrating substantial progress in mRNA vaccines. However, their single-stranded structure and sensitivity to RNase digestion make mRNA highly unstable. Furthermore, the modification and delivery technologies for mRNA vaccines originate from foreign institutions, hindering the development and application of mRNA vaccines and their therapeutic applications in my country. Therefore, there is an urgent need to develop novel and efficient vaccine technologies. Unlike linear mRNA, circular RNA molecules have a covalently closed circular structure, lacking 5' and 3' ends, and do not require the introduction of modified bases. Their unique covalent circular structure endows circRNA with higher drug and biological stability, protecting them from exonuclease degradation. Current research on circRNA has revealed several functional properties, including acting as a molecular sponge, regulating cellular activity, and influencing protein translation. In addition, the association of circRNA with specific human diseases makes it a potential new disease biomarker and therapeutic target. Synthesizing circRNAs has become a promising approach for developing preventative and therapeutic vaccines, bringing enormous potential for future medical applications. Despite the significant advantages of circular RNAs, industrialization faces numerous challenges. Currently, the efficiency of in vivo overexpression synthesis of circular RNAs is already high, but the difficulty in purifying the target RNA from various intracellular RNAs and proteins greatly hinders its application. In vitro synthesis of circular RNAs is a hot topic, currently employing two main methods: chemical synthesis and enzymatic methods. Chemical synthesis of long RNAs presents difficulties, while enzymatic methods include RNA catalysis as one approach, and protease ligation as another. Enzymatic methods for the in vitro circularization of long RNAs involve the use of ligases, such as T4 ligase. However, the ligation efficiency remains a significant challenge. Summary of the Invention

[0005] The purpose of this invention is to provide a method for efficiently ligating single-stranded RNA to form circular RNA in vitro. This method allows for easy purification after ligation, and the product can be used for circRNA vaccines and circular RNA drugs.

[0006] A method for efficiently circularizing single-stranded RNA is characterized by comprising a single-stranded DNA fragment, the two ends of which are perfectly complementary to the 5' and 3' ends of the target RNA to be circularized, respectively. After complementarity, a DNA-RNA double strand is formed. The melting temperature of the double strand formed by complementarity with the RNA 5' end differs from that of the double strand formed by complementarity with the RNA 3' end by more than 5 degrees Celsius, forming a DNA-RNA hybrid strand with asymmetric melting temperature. The melting temperature of both the double strand formed by complementarity with the RNA 5' end and the double strand formed by complementarity with the RNA 3' end cannot be lower than 45 degrees Celsius. More preferably, the melting temperature of the double strand formed by complementarity with the RNA 5' end and the double strand formed by complementarity with the RNA 3' end differs from that of complementarity with the RNA 3' end by more than or equal to 10 degrees Celsius, forming a DNA-RNA hybrid strand with asymmetric melting temperature. The optimal temperature for melting is greater than or equal to 15 degrees Celsius between the melting temperature of the double strand formed by complementation at the 5' end of RNA and the melting temperature of the double strand formed by complementation at the 3' end of RNA, resulting in a DNA-RNA hybrid strand with asymmetrical melting temperature. The temperature program is as follows: 75℃-70℃-65℃-60℃-58℃-56℃-54℃-52℃-50℃-48℃-45℃-42℃-35℃-30℃-25℃-20℃-15℃-10℃. The ligase used is T4 RNA Ligase 1. Advantages: Rapid ligation of single-stranded RNA is achieved through asymmetric DNA bridging and gradient cooling without adding the ligation RNA step. DNA bridge removal can be performed using exonucleases, and non-circular RNA can be removed simultaneously.

[0007] Example 1

[0008] I. DNA Preparation 1. Extraction of total RNA from cells using the Trizol method (1) Discard the culture medium in the culture dish, add 2 mL of PBS to each well and wash twice. Aspirate the liquid in the culture dish, then add 3 mL of RNA isolater (Novozymes). Gently shake the culture dish from side to side to fully cover the surface of the cells. Place it in a 4°C refrigerator and let it stand for 10-15 min to allow the cells to fully lyse. (2) Use a cell scraper to peel the cells from the dish, then transfer them to three 1.5 mL centrifuge tubes, add 200 μL of chloroform (Comeo Chemical Reagent Co., Ltd.) to each centrifuge tube, shake vigorously 30 times to form an emulsion, let stand at room temperature for 3 min, and centrifuge for 15 min (12000×g, 4℃). (3) Carefully remove the centrifuge tube. The cell lysate after centrifugation is divided into three layers: colorless aqueous phase (upper layer), white middle layer, and red organic layer (lower layer). Transfer 510 μL of the upper supernatant to a new 1.5 mL centrifuge tube and add the same volume of isopropanol (Comeo Chemical Reagent Co., Ltd.). Invert and mix well. Let stand at 4℃ for 15 min and centrifuge for 10 min (12000×g, 4℃). (4) Discard the supernatant, add 1 mL of 75% ethanol to each centrifuge tube, invert and mix again, and centrifuge for 8 min (12000×g, 4℃). (5) Discard the supernatant, invert the centrifuge tube onto absorbent paper, and dry at room temperature for 30 min; (6) Add 35 μL of RNase Free Water to each centrifuge tube, let stand at room temperature for 30 min until the RNA is fully dissolved, vortex mix well, take a small amount of RNA for purity and concentration detection, and store the remaining RNA solution at -80℃. After it is qualified, perform reverse transcription experiment.

[0009] 2. RNA is reverse transcribed into cDNA (1) Take the SuperRT cDNA first strand synthesis kit (Kangwei Century Biotechnology Co., Ltd.) out of the refrigerator and prepare the reverse transcription reaction system. Add dNTP (10 mM), 5×RT-Buffer, Primer Mix, DTT, HiFiscript enzyme and RNA template to the EP tube in volumes of 20 μL, 20 μL, 10 μL, 10 μL, 5 μL and 35 μL respectively, and then vortex to make a total volume of 100 μL of reverse transcription mixture; (2) The reverse transcription program was run using a PCR instrument manufactured by Bio-Rad. The program was as follows: preheat at 26℃ for 5 min; incubate at 42℃ for 45 min; incubate at 85℃ for 5 min; cool at 10℃ for 2 min; (3) After the procedure is completed, take out the sample and mark it accurately, and store it at -20℃.

[0010] 3. PCR reaction (1) Primer design The primer sequences are F: TAATACGACTCACTATAGGTTCAGCCGTCTGTATATCT (SEQ ID NO. 1), and primer R: TCGGTCCCAGAGGCTGGCT (SEQ ID NO. 2); (2) Prepare a 50 μL PCR system. Add 5 μL of pre-diluted and mixed 5 μM upstream and downstream primers, 23 μL of 2×SuperPfx MasterMix, and 6 μL of cDNA template to a final volume of 50 μL with RNase-Free water. Mix well, place in a PCR instrument, and run the program. The PCR reaction conditions are: 98℃ for 3 min; 98℃ for 10 s, 64℃ for 90 s, 72℃ for 1 min, for a total of 35 cycles; 72℃ for 5 min, 16℃ for 5 min.

[0011] II. DNA Testing 1. Preparation of agarose gel (1) Weigh 1.5 g of agarose powder into an Erlenmeyer flask, add 100 mL of electrophoresis buffer (1×TAE) to dissolve, shake well, heat in a microwave oven, and add 3.5 μL of DNA green dye after the agarose powder has completely dissolved. (2) Shake the melted agar solution to mix well, pour it into the electrophoresis tank, insert the comb, and wait for it to solidify; (3) After solidifying at room temperature for about 1 hour, remove the comb, take out the solidified gel and put it into the electrophoresis tank to prepare for sample loading; (4) Pour electrophoresis buffer (1×TAE) into the electrophoresis tank to cover the gel surface and remove air bubbles from the gel wells; (5) Loading: Add 2 μL of loading buffer (6× loading buffer) to 7 μL of DNA sample, mix well and add to the gel well; (6) After electrophoresis at 120 V for 40 min, the DNA sample size was determined by comparing the marker (2000bp).

[0012] III. DNA Purification 1. DNA purification was performed using a DNA product purification kit (Kangwei Century). (1) Estimate the volume of the DNA reaction solution, add 5 times the volume of Buffer PB, and mix thoroughly; (2) Column equilibration: Add 200 μL of Buffer PS to the adsorption column that has been loaded into the collection tube, centrifuge at 13,000 rpm for 1 min, discard the waste liquid in the collection tube, and put the adsorption column back into the collection tube; (3) Add the solution obtained in step 1 to the adsorption column that has been loaded into the collection tube, let it stand at room temperature for 1 min, centrifuge at 13,000 rpm for 60 s, discard the waste liquid in the collection tube, and put the adsorption column back into the collection tube. Note: The volume of the adsorption column is 750 μL. If the sample volume is greater than 750 μL, it can be added in batches. (4) Add 500 μL of Buffer PW (pre-added with anhydrous ethanol) to the adsorption column, let stand for 2 min, centrifuge at 13,000 rpm for 60 s, discard the waste liquid in the collection tube, and put the adsorption column back into the collection tube. (5) Centrifuge at 13,000 rpm for 1 min, and discard the waste liquid in the collection tube. Place the adsorption column at room temperature for 30 min to allow it to dry completely; (6) Place the adsorption column into a new centrifuge tube, add 50 μL of BufferEB dropwise to the center of the adsorption membrane, and incubate at room temperature for 1 min. Centrifuge at 13,000 rpm for 1 min and collect the DNA solution. Store the DNA at -20℃.

[0013] 2. DNA concentration determination Use Buffer EB as a blank and use a spectrophotometer to detect the purity and concentration of DNA. If the ratio of OD260 / OD280 is between 1.8 and 2.0, it indicates that the DNA purity is high and subsequent experiments can be carried out.

[0014] IV. T7 Amplification (Example 2 begins with this step) Prepare a 50 μL T7 amplification reaction mixture. Add RNAPol Reaction Buffer (10×), NTP (0.5 mM each), RNase Inhibitor (40 U / μL), DTT (0.1 mM), T7 RNA Polymerase, and DNA template to an EP tube in volumes of 5 μL, 5 μL, 2 μL, 1 μL, 4 μL, and 2 μL, respectively. Make up the volume to 50 μL with RNase-free water. Mix well and incubate at 37°C for 5 h in a PCR instrument.

[0015] V. DNA Removal Add 1 μL DNase I (50 U / μL) and 2 μL RNase Inhibitor (40 U / μL) to each T7 amplification product, mix well, and run in a PCR instrument at 37℃ for 1.5 h.

[0016] VI. RNA Purification and Concentration Determination 1. RNA purification was performed using an RNA product purification kit (Magen). (1) Briefly centrifuge the RNA product and adjust the sample volume to 100 μL with RNase Free Water; (2) Add 300 μL Buffer RP, vortex mix for 10 s, and let stand at room temperature for 5 min; (3) Add 250 μL of anhydrous ethanol and vortex mix for 15 s; (4) Attach the HiPure RNA column to the collection tube. Transfer the solution obtained in step 3 to the column. Centrifuge at 10000× g for 60 s. Transfer a maximum of 700 μL to the column at a time; any excess can be added in multiple portions. (5) Discard the filtrate and put the column back into the collection tube. Add 500 μL of Buffer RW2 (diluted with anhydrous ethanol) to the column, let stand for 2 min, and centrifuge at 10000 × g for 60 s; (6) Discard the filtrate and put the column back into the collection tube. Add 500 μL of Buffer RW2 (diluted with anhydrous ethanol) to the column. Centrifuge at 10000 × g for 60 s; (7) Discard the filtrate and put the column back into the collection tube. Centrifuge at 13000 × g for 2 min; (8) Place the column into a 1.5 mL centrifuge tube and add 43 μL of RNase-free water to the center of the column membrane. Incubate for 1 min. Centrifuge at 13000 × g for 1 min. Discard the column and store the RNA at -20℃.

[0017] 2. RNA purity and concentration were detected using a spectrophotometer.

[0018] VII. Dephosphoric acid The 5' phosphate group of RNA was removed using Antarctic Phosphatase (Thermosensitive) produced by Beyotime. 5 μL of Antarctic Phosphatase Reaction Buffer (10×) and 4 μL of Antarctic Phosphatase (5 U / μL) were added to each purified sample, along with a small amount of RNase Inhibitor (40 U / μL). The mixture was then incubated in a PCR instrument at 37°C for 30 min.

[0019] 8. Column purification (1) The order of steps is the same as (1)-(4) in the RNA purification steps; (2) Discard the filtrate and put the column back into the collection tube. Add 300 μL of Buffer RW2 (diluted with anhydrous ethanol) to the column, let stand for 2 min, and centrifuge at 10000 × g for 60 s; (3) Discard the filtrate and put the column back into the collection tube. Add 300 μL of Buffer RW2 (diluted with anhydrous ethanol) to the column. Centrifuge at 10000 × g for 60 s; (4) Discard the filtrate and put the column back into the collection tube. Add 400 μL of Buffer RW2 (diluted with anhydrous ethanol) to the column. Centrifuge at 10000 × g for 60 s; (5) Discard the filtrate and put the column back into the collection tube. Centrifuge at 13000 × g for 2 min; (6) Place the column into a 1.5 mL centrifuge tube and add 43 μL of RNase-free water to the center of the column membrane. Incubate for 1 min. Centrifuge at 13000 × g for 1 min. Discard the column and store the RNA at -20℃.

[0020] 9. Add monoadenosine and phosphate to the 5' end T4 Polynucleotide Kinase (Beyotime) phosphorylates the 5' end of RNA, ensuring successful subsequent ligation reactions. Add 5 μL Reaction Buffer A (10×), 0.5 μL NTP (0.5 mM each), 3 μL T4 Polynucleotide Kinase (10 U / μL), and a small amount of RNase Inhibitor (40 U / μL) to each sample. Mix well and run in a PCR instrument at 37°C for 30 min.

[0021] 10. Precipitation (1) Add 1 mL of 75% ethanol to each sample, mix by inverting, and centrifuge for 8 min (12000 × g, 4℃). (2) Discard the liquid, dry it on absorbent paper for 15 min, add 50 μL RNase Free Water, and dissolve it at 4℃ for 15 min; (3) Take three 1.5 mL centrifuge tubes and label them as "no bridge", "bridge", and "sample retention" respectively. Add 20 μL, 20 μL, and 10 μL of the completely dissolved sample from the previous step to each of the three 1.5 mL centrifuge tubes. (4) Store the centrifuge tubes containing the retained samples at -20°C, and continue the subsequent operations for the other centrifuge tubes.

[0022] 11. Add a bridge (1) The DNA sequences for the bridges are designed as follows: Bridge A: TACAGACGGCTGAACCTCGGTCCCAGAGGC (SEQ ID NO.3) The first 16 nucleotides have a TM value of 46 degrees Celsius, and the last 14 nucleotides have a TM value of 46 degrees Celsius; Bridge B: TACAGACGGCTGAACCTCGGTCCCAGAGGCTG (SEQ ID NO.4) The first 16 nucleotides have a TM value of 46 degrees Celsius, and the last 16 nucleotides have a TM value of 51 degrees Celsius; Bridge C: TACAGACGGCTGAACCTCGGTCCCAGAGGCTGGC (SEQ ID NO.5) The first 16 nucleotides have a TM value of 46 degrees Celsius, and the last 18 nucleotides have a TM value of 57 degrees Celsius; Bridge D: TATACAGACGGCTGAACCTCGGTCCCAGAGGCTGGCTTGTAATGCTCTC (SEQ ID NO.5) .6) The first 16 nucleotides have a TM value of 46 degrees Celsius, and the last 30 nucleotides have a TM value of 66 degrees Celsius. Bridge E: AGATATACAGACGGCTGAACCTCGGTCCCAGAGGCTGGCTTGTAATGCTCTC (SEQ ID NO. 7). The first 21 nucleotides have a TM value of 52 degrees Celsius, and the last 30 nucleotides have a TM value of 66 degrees Celsius. Bridge F: ACGGCTGAACCTCGGTCCCAGAGGCTGGCTTGTAATGCTCTC (SEQ ID NO. 8). The first 11 nucleotides have a TM value of 36 degrees Celsius, and the last 30 nucleotides have a TM value of 66 degrees Celsius. The first nucleotides are connected to one end of the linear target, and the last nucleotides are connected to the other end of the linear target. The calculation software is Oligo Calculator. Website: https: / / mcb.berkeley.edu / labs / krantz / tools / oligocalc.html (2) Dilute the bridging primers to a concentration of 5 μM; (3) Add 1 μL of diluted bridge primer to every 10 μL of sample.

[0023] 12. Variable Temperature Centrifuge tubes labeled with no bridge and those with different bridges were placed in a PCR instrument for programmed temperature changes, with each temperature change lasting 4 seconds. The temperature change program was as follows: 75℃-70℃-65℃-60℃-58℃-56℃-54℃-52℃-50℃-48℃-45℃-42℃-35℃-30℃-25℃-20℃-15℃-10℃ (programmed temperature group). Another group did not use a programmed temperature change, starting at 75℃ for 4 seconds and then directly settling to 10℃ (non-programmed temperature group).

[0024] 13. T4 Connection T4 RNA Ligase1 (ssRNA Ligase) produced by Beyotime is an ATP-dependent enzyme that catalyzes the formation of phosphodiester bonds between or within the 5'-P-terminus and 3'-OH-terminus of single-stranded RNA, single-stranded DNA, or single nucleotide molecules.

[0025] (1) Prepare a 20 μL T4 ligation reaction system. The system components include 10×Reaction Buffe, ATP (10 mM), T4 RNA Ligase 1 (10 U / μL), and RNase Inhibitor (40 U / μL), with volumes of 3 μL, 1.5 μL, 3 μL, and 0.5 μL, respectively, and bring the volume to 20 μL with RNase Free Water; (2) Add 20 μL of the prepared T4 RNA Ligase1 system to each of the labeled unbridged and bridged centrifuge tubes, mix well, and incubate at 37°C for 30 min; (3) After incubation, place the sample at 4°C overnight for ligation.

[0026] XIV. Re-incubation Connection After ligation at 4℃ for 24 h, the sample was incubated again at 37℃ for 30 min. After incubation, the sample was placed at 4℃ for overnight ligation.

[0027] 15. Repeat the reverse transcription step.

[0028] XVI. Real-time quantitative PCR (Q-PCR) analysis of cyclization rate (1) Reverse transcribe the labeled unbridged and bridged RNA into cDNA. Add 7 μL of reverse transcription reaction mixture to every 3 μL of sample, for a total volume of 10 μL. The reverse transcription reaction system should be prepared and the required amounts calculated according to the DNA preparation steps. The reverse transcription procedure is the same as the DNA preparation steps; (2) Quantitative fluorescence detection was performed on labeled unbridged cDNA, bridged cDNA, retained RNA, and untreated A549 cDNA. The sequences of the detection primers were: total primer F: GACTTCAAAAGGAGCTGTGCTG (SEQ ID NO. 9), total linear primer R: ACAAGTTCGACCCAACAAGC (SEQ ID NO. 10), circular primer F: TGACACGTACACAGCAGGAC (SEQ ID NO. 11), and circular primer R: CTCCGTTGCATGGCCAGATA (SEQ ID NO. 12). The Q-PCR reaction system was prepared with a total volume of 15 μL. The system components included 7 μL of SYBR Green qPCR Mix (2×), 0.5 μL each of the forward and reverse primers, and 1 μL of cDNA template, and was made up to 15 μL with RNase-free water. After vortexing, the mixture was added to 96-well plates, with 3 replicates. (3) Centrifuge the 96-well plate appropriately to mix the liquid thoroughly, place it in the LightCycler® 96 real-time fluorescence quantitative PCR instrument, run the program, and the PCR reaction conditions are: 95℃ pre-denaturation for 520 s, 95℃ denaturation for 10 s, 60℃ annealing for 10 s, 72℃ extension for 10 s, for a total of 40 cycles; (4) PCR result analysis: The difference between the Ct values ​​of circular RNA and total RNA is calculated using the formula 2. The circularization ratio is the proportion of total RNA. {-（Ct环-Ct线）} The following uses -(Ct ring - Ct line) to represent the ratio, and repeats the process for three sets of holes.

[0029] result: Program cooling: The difference in Ct between bridges is: 14.32±0.56; between bridge A and bridge B is: 10.87±0.55; between bridge B and bridge C is: 8.67±0.84; between bridge C and bridge D is: 6.51±0.52; between bridge D and bridge E is: 2.12±0.35; between bridge E and bridge F is: 2.34±0.54; and between bridge F and bridge C is: 9.32±0.99. Non-programmed cooling: The difference in Ct between bridges is: 14.78±0.78; the difference in Ct between bridge A and bridge B is: 10.61±0.88; the difference in Ct between bridge B and bridge C is: 8.06±0.45; the difference in Ct between bridge C and bridge D is: 7.54±0.51; the difference in Ct between bridge D and bridge E is: 5.92±0.65; and the difference in Ct between bridge F and bridge F is: 10.35±0.82. Based on the data, 5' and 3' need a certain difference in TM values. Generally, the greater the difference, the better, as it can increase the circumduction efficiency. The lowest TM value at both ends cannot be too low. Although the TM values ​​of the bridge E differ greatly, the effect is not good if one end is too low.

[0030] Example 2

[0031] The method was used to synthesize the previously patented "An artificially modified AKT3 circular RNA and its application in a COVID-19 vaccine," with authorization announcement number CN 112725378 B. Synthesis and amplification of DNA template fragments First, a DNA template with the sequence shown in SEQ ID NO. 13 (Sequence 3 of the patent) was synthesized using whole-genome synthesis technology. This template included an artificially modified AKT3 circular RNA sequence and the spike protein sequence of the SARS-CoV-2 virus. PCR amplification of the DNA template fragment was performed using primers with the sequences F:gtcaacttcagataccactgg (SEQ ID NO. 14, Sequence 4 of the patent) and R:gtctgctgcaggttgttc (SEQ ID NO. 15, Sequence 5 of the patent). This yielded a large amount of double-stranded DNA template. High-fidelity enzymes were used for amplification. After amplification, the PCR products were purified. The subsequent steps are the same as those after the "four T7 amplification" step in Example 1, namely, T7 amplification to DNA removal, followed by RNA purification and concentration determination, dephosphorylation, column purification, addition of monoadenosine to the 5' end, phosphate addition, precipitation, bridging, temperature variation, T4 ligation, re-incubation ligation, repeating the reverse transcription steps, and real-time quantitative PCR to analyze the circularization rate. The bridging sequence is the designed DNA sequence of bridge A: CACTTCTTCCTTTGCAATAATGACTTCTTTCTTCAGAATCGTCTGCTGCAGG (SEQ ID NO. 16), with a TM value of 62 degrees Celsius for the first 40 nucleotides and 40 degrees Celsius for the last 12 nucleotides. Bridge B: TTCTTCCTTTGCAATAATGACTTCTTTCTTCAGAATCGTCTGCTGCAGGTTG (SEQ ID NO. 16). Bridge C: TTCTTCCTTTGCAATAATGACTTCTTTCTTCAGAATCGTCTGCTGCAGGTTG, (SEQ ID NO. 17) has a TM value of 60 degrees Celsius for the first 37 nucleotides and 45 degrees Celsius for the last 15 nucleotides. Bridge D: CACTTCTTCCTTTGCAATAATGACTTCTTTCTTCAGAATCGTCTGCTGCAGGTTG, (SEQ ID NO. 19) has a TM value of 62 degrees Celsius for the first 40 nucleotides and 45 degrees Celsius for the last 15 nucleotides. Bridge E: CTTTGCAATAATGACTTCTTTCTTCAGAATCGTCTGCTGCAGGTTGT, (SEQ ID NO. 20) has a TM value of 56 degrees Celsius for the first 31 nucleotides and 46 degrees Celsius for the last 17 nucleotides.

[0032] The sequences of the detection primers are as follows: total detection primer F: CTTCACAACTGCTCCTGCCA (SEQ ID NO. 21), total detection primer R: ACCAGTGTGTGCCATTTGAA (SEQ ID NO. 22), which contains a cyclic linear product and a cyclic product, cyclic detection primer F: AGCCAGTGCTCAAAGGAGTC (SEQ ID NO. 23), and cyclic detection primer R: TGTGCCACTTCTTCCTTTGC (SEQ ID NO. 24).

[0033] result Programmed cooling: The difference in Ct is 15.58±0.95 for bridge-free, 10.56±0.48 for bridge-ACt, 8.90±0.82 for bridge-BCt, 3.35±0.56 for bridge-CCt, 2.56±0.58 for bridge-DCt, and 3.15±0.58 for bridge-ECt.

[0034] Non-programmed cooling: The difference in Ct for bridgeless bridge is 14.88±0.82, the difference for bridge A is 12.48±0.89, the difference for bridge BCT is 9.87±0.85, the difference for bridge CCT is 6.25±0.53, the difference for bridge DCt is 5.56±0.34, and the difference for bridge ECt is 5.98±0.35.

Claims

1. A method for efficiently circularizing single-stranded RNA, characterized in that... The process includes a single-stranded DNA fragment as a bridge, with its two ends being perfectly complementary to the 5' and 3' ends of the target RNA to be circularized, respectively. After complementation, a double-stranded DNA and RNA are formed. The melting temperature of the double-stranded RNA complementary to the 5' end and the double-stranded RNA complementary to the 3' end is greater than or equal to 45 degrees Celsius, forming a DNA-RNA hybrid strand with asymmetrical melting temperature. The melting temperature of the double-stranded RNA complementary to the 5' end and the double-stranded RNA complementary to the 3' end must not be lower than 45 degrees Celsius. The single-stranded RNA is ligated using an enzyme.

2. The method for efficiently circularizing single-stranded RNA according to claim 1, characterized in that... The melting temperature of the double strand formed by complementarity with the 5' end of RNA differs from that of the double strand formed by complementarity with the 3' end of RNA by a difference of 10 degrees Celsius or more, forming a DNA-RNA hybrid strand with asymmetrical melting temperature.

3. The method for efficiently circularizing single-stranded RNA according to claim 2, characterized in that... The melting temperature of the double strand formed by complementarity with the 5' end of RNA differs from that of the double strand formed by complementarity with the 3' end of RNA by a difference of 15 degrees Celsius or more, forming a DNA-RNA hybrid strand with asymmetrical melting temperature.

4. The method for efficiently circularizing single-stranded RNA according to claim 3, characterized in that... The melting temperature of the double strand formed by complementarity with the 5' end of RNA differs from that of the double strand formed by complementarity with the 3' end of RNA by more than 20 degrees Celsius, forming a DNA-RNA hybrid strand with asymmetrical melting temperature.

5. The method for efficiently circularizing single-stranded RNA according to claim 1, characterized in that... After adding the DNA single-stranded fragment, the temperature program is a gradient cooling.

6. The method for efficiently circularizing single-stranded RNA according to claim 5, characterized in that... The gradient temperature decrease is as follows: 75℃-70℃-65℃-60℃-58℃-56℃-54℃-52℃-50℃-48℃-45℃-42℃-35℃-30℃-25℃-20℃-15℃-10℃.

7. The method for efficiently circularizing single-stranded RNA according to claim 1, characterized in that the ligase is T4 RNA Ligase 1.