Method for eliminating ribosomal RNA in chicken total RNA sample

By using primer sequence amplification and RNase H digestion, single-stranded DNA probes can be prepared directly using chicken ribosomal RNA as a template, which solves the problems of high cost and low efficiency in existing technologies and achieves efficient and low-cost ribosomal RNA elimination.

CN120945007APending Publication Date: 2025-11-14INSTITUTE OF ANIMAL SCIENCES OF CHINESE ACADEMY OF AGRICULTURAL SCIENCES
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510986295.2
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-07-17
Publication Date
2025-11-14

AI Technical Summary

Technical Problem

Existing technologies are costly and inefficient in eliminating ribosomal RNA from chicken total RNA samples. Traditional methods require the artificial synthesis of multiple antisense DNA probes and are time-consuming, resulting in expensive kits.

Method used

A low-cost method for preparing long single-stranded antisense DNA probes was adopted. cDNA was amplified by primer sequence set, and RNase H digestion and DNase I digestion were combined to optimize reaction conditions. Single-stranded DNA probes were prepared directly using chicken ribosomal RNA as a template, and ribosomal RNA was precisely eliminated.

Benefits of technology

This method enables rapid and low-cost elimination of ribosomal RNA from chicken total RNA samples, improving reduction efficiency, lowering probe preparation costs, and achieving greater precision in sequence matching.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120945007A_ABST
    Figure CN120945007A_ABST
Patent Text Reader

Abstract

The invention provides a method for eliminating ribosomal RNA in a chicken total RNA sample, which comprises the following steps: carrying out reverse transcription on the total RNA in the chicken sample to obtain cDNA, and amplifying the cDNA by adopting a primer sequence group to obtain a DNA fragment covering all sequences of the chicken ribosomal RNA; carrying out amplification by taking the DNA fragment as a template and adopting a single primer in the primer sequence group to obtain a single-stranded DNA probe; hybridizing the total RNA of the chicken sample by adopting a single-stranded DNA probe, and performing RNase H digestion to obtain a digestion product; sequentially carrying out DNase I digestion and RNA purification on the digestion product to obtain a target product; wherein the primer sequence group comprises first to seventeenth upstream primers and first to seventeenth downstream primers, and the primer sequence group has the characteristics of low cost, stable performance and high reduction efficiency.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the technical field of biological detection, specifically relating to a method for eliminating ribosomal RNA from chicken total RNA samples. Background Technology

[0002] RNA sequencing (RNA-seq) is a high-throughput sequencing technology for quantitative analysis of cellular transcriptional data. Initially focused on eukaryotic mRNA sequencing, it has evolved into whole transcriptome analysis (WTA), accurately reflecting the transcriptional levels of messenger RNA (mRNA), various small RNAs, and non-coding RNAs. It is widely used in almost all biologically related fields, including agricultural breeding, germplasm resources, nutrition and metabolism, and medicine. Metatranscriptome, similar to WTA, sequences the total RNA in a sample, including mRNA and various non-coding RNAs, as well as potential bacterial mRNAs, non-coding RNAs, and viral RNAs.

[0003] Both transcriptome and metatranscriptome sequencing include three important parts: RNA extraction and processing, library construction and sequencing, and data analysis. In prokaryotic and eukaryotic cells, ribosomal RNA (rRNA) usually accounts for more than 80% of the total RNA in the cell. When directly constructing a library and sequencing a total RNA sample, more than 90% of the sequencing data obtained comes from rRNA, and information from various low-abundance RNAs is not easily detected.

[0004] In eukaryotic cells, rRNA typically accounts for 80%–90% of the total RNA mass, tRNA for 10%–15%, mRNA for 1%–5%, and other ncRNAs for only 1%–5%. The proportions of different RNA types vary among different eukaryotic species, growth stages, and sites. In prokaryotes, such as bacteria, rRNA accounts for approximately 80%–85%, tRNA for approximately 10%–15%, mRNA for approximately 2%–5%, and other small RNAs and non-coding RNAs for approximately 1%–2%, with slight variations depending on bacterial species and growth conditions. Most researchers are not interested in rRNA and tRNA, considering them redundant in RNA-seq. Furthermore, the abundant base modifications and stable, compact secondary and tertiary structures of tRNA make it difficult to sequence using common sequencing protocols. Therefore, reducing rRNA from total RNA has become an important part of transcriptome and metagenomic sequencing library construction.

[0005] RRNA reduction can significantly increase the proportion of mRNA, regulatory RNA, and other types of RNA, thereby increasing their sequencing coverage and greatly improving detection efficiency and sensitivity. An ideal rRNA reduction method should be simple, efficient, reliable, and cost-effective. Currently, there are many ribosomal RNA reduction strategies, mainly including: Olig dT magnetic bead capture, the "pull-out" method, RNase H selective reduction, and DSN selective reduction, with the first three being the most commonly used. Olig dT magnetic bead capture based on polyA tails can only capture eukaryotic mRNA and cannot capture transcripts without polyA tails (non-polyA, NPA), such as miRNAs, enhancer RNAs (eRNAs), and various lncRNAs, as well as bacterial and viral RNAs in the sample. DSN selective reduction also has some systemic problems in practical applications, and its reduction efficiency is not as expected.

[0006] RNase H selective reduction of rRNA is currently the most popular strategy. The principle involves the artificial synthesis of 50–80 bp antisense DNA probes. These probe sequences are complementary to the sequence to be reduced and cover the entire rRNA, forming an RNA:DNA hybrid. RNase H is used to reduce the hybrid double strand, followed by DNase I treatment to reduce any remaining DNA probes. Chicken ribosomal rRNA includes 5S rRNA, 5.8S rRNA, 18S rRNA, and 28S rRNA, as well as mitochondrial rRNA (12S and 16S), with a total length of up to 9130 bp. Therefore, more than 100 antisense DNA probes need to be artificially synthesized, resulting in high costs, long processing times, and a very limited total amount of antisense DNA probes obtained. This is the main reason why current ribosomal rRNA reduction kits are very expensive.

[0007] Therefore, there is a need for a method that is low-cost, stable in performance, and highly efficient in eliminating ribosomal RNA from chicken total RNA samples. Summary of the Invention

[0008] To address the aforementioned technical problems, this invention provides a method for eliminating ribosomal RNA from chicken total RNA samples, thereby resolving the issues in the background art. This includes the preparation of a low-cost long single-stranded antisense DNA probe and the optimization of its supporting reagents and reaction conditions, providing a method for eliminating ribosomal RNA from chicken total RNA samples that is low in preparation cost, stable in performance, and highly efficient in reduction.

[0009] On the one hand, the invention provides the following technical solution: a method for eliminating ribosomal RNA from chicken total RNA samples, comprising: Total RNA from chicken samples was reverse transcribed into cDNA, and the cDNA was amplified using a primer sequence set to obtain a DNA fragment covering the entire sequence of chicken ribosomal RNA. Using the DNA fragment as a template and a single primer from the primer sequence set for amplification, a single-stranded DNA probe is obtained; The total RNA of the chicken sample was hybridized using the single-stranded DNA probe and then digested with RNase H to obtain the digestion product; The digestion products were sequentially digested with DNase I and purified with RNA to obtain the target product; The primer sequence set includes first to seventeenth upstream primers and first to seventeenth downstream primers. The sequences of the first to seventeenth upstream primers are shown in SEQ ID NO.1 to SEQ ID NO.17, and the sequences of the first to seventeenth downstream primers are shown in SEQ ID NO.18 to SEQ ID NO.34.

[0010] The method for eliminating ribosomal RNA in chicken total RNA samples according to the present invention has the following advantages: This invention enables the rapid and large-scale preparation of single-stranded antisense DNA probes that cover the entire sequence of chicken ribosomal RNA. It requires only a small number of primers, eliminating the need for extensive artificial synthesis of 50-80 bp antisense DNA probes, thus significantly reducing probe preparation costs. Using chicken ribosomal RNA as a template, the probes prepared via PCR amplification exhibit more precise sequence matching. After optimization of reaction conditions, the single-stranded DNA probes obtained from chicken ribosomal RNA prepared by this invention demonstrate a higher ribosomal RNA removal efficiency than traditional methods of the same type.

[0011] In addition, the method for eliminating ribosomal RNA from chicken total RNA samples provided by the present invention may also have the following additional technical features: Preferably, the step of reverse transcribing total RNA from chicken samples into cDNA includes: Chicken embryo tissue was obtained, and total RNA was extracted from the chicken embryo tissue using an RNA extraction kit. The total RNA was then reverse transcribed using a reverse transcription kit to obtain cDNA.

[0012] Preferably, in the step of reverse transcribing total RNA from chicken samples into cDNA, the reaction system includes RNase-free ddH2O, 4 × All-in-One Ultra qRT SuperMix, and template RNA.

[0013] Preferably, in the step of amplifying cDNA using primer sequence sets to obtain a DNA fragment covering the entire sequence of chicken ribosomal RNA, the reaction system includes ddH2O, 2 × Taq Plus Master Mix, template cDNA, first to seventeenth upstream primers, and first to seventeenth downstream primers.

[0014] Preferably, in the step of amplification using the DNA fragment as a template and a single primer from the primer sequence set, the reaction system includes: ddH2O, 2 × Taq Plus Master Mix, template DNA fragment, and first to seventeenth downstream primers.

[0015] Preferably, the step of hybridizing the total RNA of the chicken sample with the single-stranded DNA probe and then digesting it with RNase H to obtain the digestion product includes: Take a nuclease-free PCR tube, add ddH2O and total RNA from the chicken sample to the PCR tube, and place it on ice for later use. Add a single-stranded DNA probe and Probe Buffer to the PCR tube, then gently pipette to mix thoroughly. After a brief centrifugation, collect the sample to the bottom of the tube. Place the sample at the bottom of the tube in a PCR instrument for RNase H digestion to obtain the digested product. Add RNase H Buffer and RNase H digestion reagent to the digested product, then gently pipette to mix thoroughly. After a brief centrifugation, collect the sample to be digested to the bottom of the tube. Place the sample to be digested at the bottom of the tube in a PCR instrument for RNase H digestion to obtain the digested product.

[0016] Preferably, the step of sequentially digesting the digested product with DNase I and purifying RNA to obtain the target product includes: The digestion product was digested with DNase I to obtain a second digestion product. Hieff NGS® RNA Cleaner magnetic beads were added to the second digestion product, and the mixture was thoroughly mixed by pipetting and incubated at room temperature. Then, the magnetic beads and liquid were separated in a magnetic rack. After the solution became clear, the supernatant was removed to obtain the product to be determined. The product to be determined was then washed, eluted, and quantified sequentially to obtain the target product. Attached Figure Description

[0017] To more clearly illustrate the technical solutions in the embodiments of the present invention, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0018] Figure 1 The image shows the reverse transcription PCR amplification results of ribosomal RNA in chicken total RNA using different primer pairs provided in the embodiments of the present invention. Figure 2 Electrophoresis diagram of single-stranded DNA probe preparation provided in the embodiments of the present invention (taking one probe of chicken ribosomal 28S rRNA as an example); Figure 3 This is a graph showing the results of real-time quantitative PCR of different amounts of chicken total RNA in Example 4 of the present invention; Figure 4 This is a graph showing the results of quantitative real-time PCR of chicken total RNA before and after ribosomal RNA removal in Example 4 of the present invention.

[0019] The present invention will be further described below with reference to the accompanying drawings and description. Detailed Implementation

[0020] Embodiments of the present invention are described in detail below, examples of which are illustrated in the accompanying drawings, wherein the same or similar reference numerals denote the same or similar elements or elements having the same or similar functions throughout. The embodiments described below with reference to the accompanying drawings are exemplary and intended to explain embodiments of the present invention, and should not be construed as limiting the present invention.

[0021] This invention provides a method for eliminating ribosomal RNA from chicken total RNA samples. Those skilled in the art can refer to this document and appropriately modify the process parameters to achieve the desired result. It should be particularly noted that all similar substitutions and modifications are obvious to those skilled in the art and are considered to be included in this invention. The method and application of this invention have been described through preferred embodiments; those skilled in the art can obviously make modifications or appropriate alterations and combinations to the method and application described herein without departing from the content, spirit, and scope of this invention to implement and apply the technology of this invention.

[0022] The method for eliminating ribosomal RNA from chicken total RNA samples according to the present invention includes: S1. The total RNA in the chicken sample was reverse transcribed into cDNA, and the cDNA was amplified using a primer sequence set to obtain a DNA fragment covering the entire sequence of chicken ribosomal RNA. S2. Using the DNA fragment as a template and a single primer from the primer sequence set for amplification, a single-stranded DNA probe is obtained. S3. The total RNA of the chicken sample is hybridized using the single-stranded DNA probe and then digested with RNase H to obtain the digestion product; S4. The digestion product is sequentially digested with DNase I and purified with RNA to obtain the target product; The primer sequence set includes first to seventeenth upstream primers and first to seventeenth downstream primers. The sequences of the first to seventeenth upstream primers are shown in SEQ ID NO.1 to SEQ ID NO.17, and the sequences of the first to seventeenth downstream primers are shown in SEQ ID NO.18 to SEQ ID NO.34.

[0023] The step of reverse transcribing total RNA from chicken samples into cDNA includes: Chicken embryo tissue was obtained, and total RNA was extracted from the chicken embryo tissue using an RNA extraction kit. The total RNA was then reverse transcribed using a reverse transcription kit to obtain cDNA.

[0024] In the step of reverse transcribing total RNA from chicken samples into cDNA, the reaction system includes RNase-free ddH2O, 4 × All-in-One Ultra qRT SuperMix, and template RNA.

[0025] Among them, RNase-free ddH2O is nuclease-free water, and 4 × All-in-One Ultra qRT SuperMix is ​​a reverse transcription kit for real-time PCR (manufactured by Nanjing Vazyme Co., Ltd., catalog number R433).

[0026] In the step of amplifying cDNA using primer sequence sets to obtain a DNA fragment covering the entire sequence of chicken ribosomal RNA, the reaction system includes ddH2O, 2 × Taq Plus Master Mix, template cDNA, first to seventeenth upstream primers, and first to seventeenth downstream primers.

[0027] Among them, 2 × Taq Plus Master Mix is ​​a high-fidelity polymerase premix (vazyme, P213).

[0028] In the step of amplifying the DNA fragment using a single primer from the primer sequence set, the reaction system includes: ddH2O, 2 × Taq Plus Master Mix, template DNA fragment, and first to seventeenth downstream primers.

[0029] The step of hybridizing the total RNA of the chicken sample with the single-stranded DNA probe and then digesting it with RNase H to obtain the digestion product includes: Take a nuclease-free PCR tube, add ddH2O and total RNA from the chicken sample to the PCR tube, and place it on ice for later use. Add a single-stranded DNA probe and Probe Buffer to the PCR tube, then gently pipette to mix thoroughly. After a brief centrifugation, collect the sample to the bottom of the tube. Place the sample at the bottom of the tube in a PCR instrument for RNase H digestion to obtain the digested product. Add RNase H Buffer and RNase H digestion reagent to the digested product, then gently pipette to mix thoroughly. After a brief centrifugation, collect the sample to be digested to the bottom of the tube. Place the sample to be digested at the bottom of the tube in a PCR instrument for RNase H digestion to obtain the digested product.

[0030] The Probe Buffer is a probe hybridization buffer, and the RNase H Buffer is an RNase H buffer.

[0031] The step of sequentially digesting the digested product with DNase I and purifying RNA to obtain the target product includes: The digestion product was digested with DNase I to obtain a second digestion product. Hieff NGS® RNA Cleaner magnetic beads were added to the second digestion product, and the mixture was thoroughly mixed by pipetting and incubated at room temperature. Then, the magnetic beads and liquid were separated in a magnetic rack. After the solution became clear, the supernatant was removed to obtain the product to be determined. The product to be determined was then washed, eluted, and quantified sequentially to obtain the target product.

[0032] Among them, Hieff NGS® RNA Cleaner magnetic beads are RNA purification magnetic beads (yeasen, 12600ES).

[0033] It should be noted that the present invention also provides a kit comprising the reagents and consumables required in the above-described method for eliminating ribosomal RNA from chicken total RNA samples.

[0034] The reagents and consumables used in this invention are all commercially available products. The invention is further illustrated below with reference to the embodiments: Example 1 Primer sequence construction The primer sequence set in this application specifically includes the first to seventeenth upstream primers and the first to seventeenth downstream primers. The sequences of the first to seventeenth upstream primers are shown in SEQ ID NO.1 to SEQ ID NO.17, and the sequences of the first to seventeenth downstream primers are shown in SEQ ID NO.18 to SEQ ID NO.34. Meanwhile, the primer sequence set mentioned above is a primer design that covers the entire sequence of chicken rRNA. Chicken ribosomal rRNA includes 6 types, such as 5S rRNA, 5.8S rRNA, 18S rRNA, 28S rRNA, and mitochondrial rRNA (12S and 16S). A total of 17 pairs of primer sequences were designed. The primer annealing temperature was controlled between 58 and 62°C, and the amplification fragment of each primer pair was controlled between 100bp and 1000bp. Therefore, the first upstream primer and the first downstream primer are amplification primers for chicken ribosomal 5S rRNA, and their sequences are shown in SEQ ID NO.1 and SEQ ID NO.18. It should be noted that all the following primers are connected to both ends with 5' and 3' adapters, and the first to seventeenth upstream primers and the first to seventeenth downstream primers have a one-to-one upstream-downstream correspondence, as follows: SEQ ID NO.1: GCCTACGGCCATCCCAC; SEQ ID NO.18: AGCCTACAGCACCCGGTATTC; The second upstream primer and the second downstream primer are amplification primers for chicken ribosomal 5.8S rRNA, and their sequences are shown in SEQ ID NO.2 and SEQ ID NO.19, respectively: SEQ ID NO.2: AACTCTTAGCGGTGGATCACTCG; SEQ ID NO.19: GCCGCAAGTGCGTTCGAAGTGT; The third to fifth upstream primers and the third to fifth downstream primers are amplification primers for chicken ribosomal 18S rRNA, and their sequences are shown in SEQ ID NO.3~SEQ ID NO.5 and SEQ ID NO.20~SEQ ID NO.22, respectively: SEQ ID NO.3: TACCTGGGTTGATCCTGCCAGT; SEQ ID NO.4: GGCCCTGTAATTGGAATGAGTCCA; SEQ ID NO.5: TAACTAGTTACCGACCCCCG; SEQ ID NO.20: TCGAAAGAGTCCTGTATTGTTATTTTTCG; SEQ ID NO.21: GTTAGCATGCCAGAGTCTCGTTC; SEQ ID NO.22: TAATGATCCTTCCGCAGGTTCAC; The sixth to twelfth upstream primers and the sixth to twelfth downstream primers are amplification primers for chicken ribosomal 28S rRNA, and their sequences are shown in SEQ ID NO.6~SEQ ID NO.12 and SEQ ID NO.23~SEQ ID NO.29, respectively: SEQ ID NO.6: CGACCTCAGGTCAGACGTG; SEQ ID NO.7: AATCCCGGGGCCGAG; SEQ ID NO.8: GAGGTCCGTAGCGGTCCT; SEQ ID NO.9: AAGGCCGAAGTGGAGCAG; SEQ ID NO.10: GGCTCTAAGGCTGGGTC; SEQ ID NO.11: GGCCGTGTAAGAGACATGA; SEQ ID NO.12: GTAGCGATACCGCAGCGC; SEQ ID NO.23: ATTCGGCGACGATCCGG; SEQ ID NO.24: CACCAGAGTTTCCTCTGGCTT; SEQ ID NO.25: TTCAAAGCTCTCGTTTGAATAGTTGCTACTAC; SEQ ID NO.26: AATCCTTATCCCGAAGTTACGGATCC; SEQ ID NO.27: AGACTAGAGTCAAGCTCAACAGGG; SEQ ID NO.28: TACGTTTAGGGGGGATTCTGACTTAG; SEQ ID NO.29: ACAAAAGCTTTGTGTCGAGGGC; The thirteenth and fourteenth upstream primers and the thirteenth and fourteenth downstream primers are amplification primers for chicken mitochondrial 12S S rRNA, and their sequences are shown in SEQ ID NO.13~SEQ ID NO.14 and SEQ ID NO.30~SEQ ID NO.31, respectively: SEQ ID NO.13: GACTTAGTCCTAACCTTTCTATTGGTTT; SEQ ID NO.14: GTATCCGCCTGAGAACTACGAG; SEQ ID NO.30: TGTGATGGGAGGTATCTAGATTTAGG; SEQ ID NO.31: GTAGTCTAAGTGCACCTTCCGGT; The fifteenth to seventeenth upstream primers and the fifteenth to seventeenth downstream primers are amplification primers for chicken mitochondrial 16S S rRNA, and their sequences are shown in SEQ ID NO.15~SEQ ID NO.17 and SEQ ID NO.32~SEQ ID NO.34, respectively: SEQ ID NO.15: CTTGCCCCCCCTCTAGC; SEQ ID NO.16: AACACAACCTCCTCCAGCG; SEQ ID NO.17: AATGGCTAAACGAGGTCTTAACTGT; SEQ ID NO.32: CTTTTTCGATGGAGCTGTACCCC; SEQ ID NO.33: TTCATACAAGTCTCAATTTACGGGACAATT; SEQ ID NO. 34: TGGATCCTTTTCTAGGAGTTCGGG.

[0035] Example 2: Determination of Single-Stranded DNA Probes Chicken embryo tissue was collected, and total RNA was extracted using a commercially available RNA extraction kit suitable for animal tissues (e.g., Novizan FastPureCell / Tissue Total RNA Isolation Kit, RC101-01). Then, reverse transcription was performed using a reverse transcription kit (e.g., Novizan HiScript IV All-in-One Ultra RT SuperMix for qPCR, R433-01) to convert the RNA into cDNA.

[0036] The reaction system for cDNA synthesis is as follows: RNase-free ddH2O 5μl 4 × All-in-One Ultra qRT SuperMix 5μl, Template RNA 1 pg to 1 μg; RNase-free ddH2O was added to the reaction system to a total volume of 20 μl. The reaction conditions were: 50°C for 5 to 10 min, 85°C for 5 sec. After the reaction was completed, cDNA was obtained.

[0037] The first round of PCR amplification was used to prepare a DNA fragment covering the entire sequence of chicken ribosomal RNA: The first round of PCR amplification was performed using cDNA as a template, and the reaction system is as follows: ddH2O 5μl, 2 × Taq Plus Master Mix 2μl, 1 μl of template cDNA 0.25 μl of the first to seventeenth upstream primers, 0.25 μl of the first to seventeenth downstream primers; Add ddH2O to a total volume of 20 μl. Reaction conditions: 95°C / 5 min; 95°C / 1 min, 55°C / 15 sec, 72°C / 1 min, 40 cycles; 72°C / 2 min; 4°C, hold.

[0038] The DNA fragments amplified by the 17 primers were subjected to electrophoresis to confirm that the product size met expectations. The amplification products were then purified using a DNA purification kit for use in the second round of PCR amplification.

[0039] The second round of PCR preparation of single-stranded DNA probes uses the following reaction system: ddH2O 5 μl, 2 × Taq Plus Master Mix 2 μl, 1 μl of template DNA fragment 3 μl of the first to seventeenth downstream primers; Add ddH2O to a total volume of 20 μl. Reaction conditions: 95°C / 5 min; 95°C / 1 min, 55°C / 15 sec, 72°C / 1 min, 50 cycles; 4°C, hold. After the reaction, a probe DNA sequence containing a large number of single strands was obtained. The amplification product was purified using a DNA purification kit, and its single-stranded DNA content was determined to obtain a single-stranded DNA probe. It should be noted that, in practice, primers can be designed according to specific needs to prepare single-stranded DNA probes of different lengths. Furthermore, by changing the single primer used in the second round of amplification, positive DNA single strands (using only the upstream primer) or antisense DNA single strands (using only the downstream primer) can be prepared. Meanwhile, the reverse transcription PCR amplification results of ribosomal RNA in chicken total RNA using 17 primer pairs are as follows: Figure 1 As shown, in Figure 1In the image, from left to right, are markers; 5S rRNA - 118bp, 5.8S rRNA - 153bp, 18S rRNA - 506bp, 855bp, 466bp; 28S rRNA - 752bp, 745bp, 642bp, 500bp, 774bp, 757bp, 277bp; mitochondrial 12S rRNA - 493bp, 483bp; mitochondrial 16S rRNA - 501bp, 496bp, 626bp.

[0040] The electrophoresis pattern of the single-stranded DNA probe is as follows: Figure 2 As shown, in this application, a probe of chicken ribosomal 28S rRNA is used as an example. From left to right, the probe is a marker, and the single-stranded DNA prepared using 4 μl, 1 μl, and 0.25 μl of primers are shown.

[0041] Example 3 Removal of Ribosomal RNA 1. Pre-processing In a nuclease-free PCR tube, adjust the total RNA concentration to 500 ng / μl using nuclease-free ddH2O and place on ice. Remove the components needed for the next step from -30 to -15°C and place on ice. Prepare the reaction solution: 2 μl total RNA, 3 μl Probe Buffer, 1.5 μl single-stranded DNA probe obtained in the previous step, and add ddH2O to a total volume of 20 μl. Gently pipette 10 times to mix thoroughly. Briefly centrifuge to collect the sample to the bottom of the tube. Place the sample in the PCR instrument and follow the procedure: 95°C for 2 min, slowly cool from 95°C to 37°C at 0.1°C / sec, and incubate at 37°C for 5 min, for a total time of approximately 10-15 min. Briefly centrifuge again to collect the sample to the bottom of the tube and place on ice to obtain the processed product, then proceed to the next step.

[0042] 2. RNase H digestion Remove the RNase H digestion reagent from -20℃, thaw and mix well, then place on ice for later use. Prepare the RNase H digestion reaction system: 3 μl RNase H Buffer, 2 μl RNase H digestion reagent, and 15 μl of the digested product, for a total of 20 μl. RNase H Buffer and RNase H digestion reagent should be added separately. If a large sample volume requires additional preparation, prepare fresh for each use. Gently mix using a pipette, then centrifuge briefly to the bottom of the tube to obtain the sample to be digested. Place the PCR tube containing the sample to be digested in a PCR instrument and set the reaction program: 50℃ (heat capped); 37℃, 30 min; 4℃, hold, to perform the RNase H digestion reaction and obtain the digested product.

[0043] 3. DNase I digestion Remove the DNase I digestion reagent from -20°C, thaw and mix well, then place on ice for later use. Prepare the DNase I digestion reaction system: 27.5 μl DNase I Buffer, 2.5 μl DNase I digestion reagent, and 20 μl digestion product, for a total of 50 μl. Gently mix with a pipette, briefly transfer to the bottom of the tube, and place the PCR tube in a PCR instrument. Set the reaction program: 50°C with hot cap; 37°C, 30 min; 4°C, hold, to perform the DNase I digestion reaction to obtain the second digestion product.

[0044] 4. RNA purification Preparation: Remove the Hieff NGS® RNA Cleaner beads from the refrigerator and allow them to equilibrate at room temperature for at least 30 minutes. Prepare 80% ethanol using nuclease-free H2O.

[0045] Adsorption: Vortex or thoroughly invert the magnetic beads to mix them. Add 110 μL of Hieff NGS® RNA Cleaner magnetic beads to the second digestion product. Mix thoroughly by pipetting and incubate at room temperature for 5 min. The ratio of magnetic beads to the second digestion product is 2.2:1.

[0046] Place the PCR tube in a magnetic rack to separate the magnetic beads and liquid. After the solution becomes clear (about 3 minutes), carefully remove the supernatant.

[0047] Rinsing: Keep the PCR tube in the magnetic rack at all times, add 200 μl of Nuclease-free H2O and freshly prepared 80% ethanol to rinse the magnetic beads, incubate at room temperature for 30 sec, carefully remove the supernatant, repeat the rinsing once, and rinse twice in total. Use a 10 μL pipette to remove any remaining liquid.

[0048] Keep the PCR tubes in the magnetic rack at all times, and open the caps to dry the magnetic beads at room temperature (5-10 min).

[0049] Elution: Remove the PCR tube from the magnetic rack, add 11 μl of Nuclease-free H2O (or elution buffer), gently pipette until fully mixed, and let stand at room temperature for 5 min. Nuclease-free H2O is nuclease-free water.

[0050] Briefly centrifuge the PCR tube and place it on a magnetic rack to stand until the solution becomes clear (about 3 min). Carefully transfer 10 μl of supernatant (adjust according to the actual elution volume) into a new Nuclease-free PCR tube.

[0051] Quantitative analysis: The concentration of the eluted nucleic acid sample is determined to obtain the corresponding target product.

[0052] Example 4 Evaluation of Ribosomal RNA Removal Efficacy 1. Take freshly extracted chicken total RNA and dilute it to 1 μg / μl and 10 μl concentrations, respectively. -1 μg / μl, 10 -2 μg / μl, 10 -3 μg / μl, 10 -4 μg / μl, 10 -5 μg / μl, 10 -6 μg / μl, 10 -7 μg / μl of total RNA was added, and 1 μl was used as a template. The method for eliminating ribosomal RNA in chicken total RNA samples provided in this invention was used for RT-qPCR. The reaction conditions were: 50℃ for 15 min; 95℃ for 30 sec; 95℃ for 10 sec; 60℃ for 30 sec, for 45 cycles. The results are as follows: Figure 3 As shown.

[0053] 2. Samples before and after ribosomal RNA removal were subjected to quantitative real-time PCR (qPCR). A blank control group without single-stranded DNA probe treatment and a negative control group with ddH2O as the qPCR template were added. The CT values ​​were compared to determine the ribosomal RNA removal efficiency. For the untreated sample group, 1 μg of chicken total RNA was added as the qPCR template. For the rRNA-removed sample group, 1 μg of chicken total RNA was added as the qPCR template, followed by the sample treated with a single-stranded DNA probe. For the blank control group, 1 μg of chicken total RNA was added as the qPCR template, followed by the sample without single-stranded DNA probe treatment. For the negative control group, ddH2O was added as the qPCR template. The results are as follows: Figure 4 As shown; according to Figure 3 and Figure 4 It can be seen that the CT value of the rRNA-deactivated sample is 17.08; the positive sample diluted to 10... -2 At μg, the CT value was 15.95; positive samples diluted to 10 μg... -3 At μg, the CT value was 18.12; this indicates that the content of the target 28S rRNA in the sample after rRNA removal treatment was reduced to between 0.1% and 1%, with an rRNA removal efficiency of over 99%, which is quite significant and far exceeds the level of commercially available kits.

[0054] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention are equivalent substitutions and are included within the protection scope of the present invention.

Claims

1. A method for eliminating ribosomal RNA from chicken total RNA samples, characterized in that, include: Total RNA from chicken samples was reverse transcribed into cDNA, and the cDNA was amplified using a primer sequence set to obtain a DNA fragment covering the entire sequence of chicken ribosomal RNA. Using the DNA fragment as a template and a single primer from the primer sequence set for amplification, a single-stranded DNA probe is obtained; The total RNA of the chicken sample was hybridized using the single-stranded DNA probe and then digested with RNase H to obtain the digestion product; The digestion products were sequentially digested with DNase I and purified with RNA to obtain the target product; The primer sequence set includes first to seventeenth upstream primers and first to seventeenth downstream primers. The sequences of the first to seventeenth upstream primers are shown in SEQ ID NO.1 to SEQ ID NO.17, and the sequences of the first to seventeenth downstream primers are shown in SEQ ID NO.18 to SEQ ID NO.

34.

2. The method for eliminating ribosomal RNA from chicken total RNA samples according to claim 1, characterized in that, The step of reverse transcribing total RNA from chicken samples into cDNA includes: Chicken embryo tissue was obtained, and total RNA was extracted from the chicken embryo tissue using an RNA extraction kit. The total RNA was then reverse transcribed using a reverse transcription kit to obtain cDNA.

3. The method for eliminating ribosomal RNA from chicken total RNA samples according to claim 1, characterized in that, In the step of reverse transcribing total RNA from chicken samples into cDNA, the reaction system includes RNase-free ddH2O, 4 × All-in-One Ultra qRT SuperMix, and template RNA.

4. The method for eliminating ribosomal RNA from chicken total RNA samples according to claim 1, characterized in that, In the step of amplifying cDNA using primer sequence sets to obtain a DNA fragment covering the entire sequence of chicken ribosomal RNA, the reaction system includes ddH2O, 2 × Taq Plus Master Mix, template cDNA, first to seventeenth upstream primers, and first to seventeenth downstream primers.

5. The method for eliminating ribosomal RNA from chicken total RNA samples according to claim 1, characterized in that, In the step of amplification using the DNA fragment as a template and a single primer from the primer sequence set, the reaction system includes: ddH2O, 2 × Taq Plus Master Mix, template DNA fragment, and first to seventeenth downstream primers.

6. The method for eliminating ribosomal RNA from chicken total RNA samples according to claim 1, characterized in that, The steps of hybridizing the total RNA of the chicken sample with the single-stranded DNA probe and then digesting it with RNase H to obtain the digestion product include: Take a nuclease-free PCR tube, add ddH2O and total RNA from the chicken sample to the PCR tube, and place it on ice for later use. Add a single-stranded DNA probe and Probe Buffer to the PCR tube, then gently pipette to mix thoroughly. After a brief centrifugation, collect the sample to the bottom of the tube. Place the sample at the bottom of the tube in a PCR instrument for RNase H digestion to obtain the digested product. Add RNase H Buffer and RNase H digestion reagent to the digested product, then gently pipette to mix thoroughly. After a brief centrifugation, collect the sample to be digested to the bottom of the tube. Place the sample to be digested at the bottom of the tube in a PCR instrument for RNase H digestion to obtain the digested product.

7. The method for eliminating ribosomal RNA from chicken total RNA samples according to claim 1, characterized in that, The steps of sequentially digesting the digested product with DNase I and purifying RNA to obtain the target product include: The digestion product was digested with DNase I to obtain a second digestion product. Hieff NGS® RNA Cleaner magnetic beads were added to the second digestion product, and the mixture was thoroughly mixed by pipetting and incubated at room temperature. Then, the magnetic beads and liquid were separated in a magnetic rack. After the solution became clear, the supernatant was removed to obtain the product to be determined. The product to be determined was then washed, eluted, and quantified sequentially to obtain the target product.