Genetically modified pluripotent stem cell and derived natural killer cell and preparation method thereof

Abstract

Genetically modified cells, such as pluripotent stem cells and derived NK cells, and methods of making the same are provided. The gene editing strategy disclosed by the invention can realize higher expression of transgenes.

Description

Technical Field

[0001] This disclosure generally relates to genetically modified pluripotent stem cells (PSCs) and their derived natural killer cells (NK cells) and methods for their preparation.

[0002] background

[0003] Adoptive cell therapy typically involves administering immune cells to patients with cancer, tumors, or infections. As one of the lymphocytes that plays a crucial role in the immune response, NK cells have become one of the most promising drugs in adoptive cell therapy. In particular, NK cells derived from pluripotent stem cells (PSCs) (also known as induced NK or iNK cells) have attracted considerable attention due to their potent cytotoxicity, high safety profile, and ease of cell acquisition. However, the application of iNK cells in cell therapy remains challenging, and there are several unmet needs for improvement. For example, current iNK cells require enhanced cellular function (e.g., cytotoxicity) to meet various clinical applications. To enhance the function or cytotoxicity of iNK cells in cell therapy, various gene-editing strategies have been developed to produce genetically modified or engineered iNK cells. However, current gene-editing strategies targeting iNK cells often encounter serious problems during iNK cell generation (e.g., differentiation), such as gene silencing or reduced gene expression.

[0004] Therefore, there is still a need to improve genome editing strategies for genetically modified or engineered iNK cells.

[0005] Overview

[0006] Gene silencing has always been an unavoidable issue in gene therapy and cell therapy related to gene editing. The causes of gene silencing are diverse and complex, and may be related to epigenetic alterations (DNA methylation and histone modifications) of certain specific sequences (e.g., repetitive sequences, viral sequences, and bacterial-associated sequences). The inventors have discovered that selecting appropriate gene editing target sites is crucial for preventing gene silencing. Due to high methylation, many loci in PSCs are silenced, and the expression of target genes integrated into these loci cannot be observed or detected. Furthermore, gene editing at certain loci can adversely affect the pluripotency and differentiation potential of PSCs. In addition, during the differentiation of PSCs into functional cells such as iNK cells, some loci may be silenced, leading to reduced or absent target gene expression. Therefore, systematic research on various gene editing target sites is still needed to achieve stable expression of exogenous genes while maintaining the characteristics and differentiation potential of PSCs.

[0007] In one aspect, genetically modified pluripotent stem cells (PSCs) are provided, comprising an expression cassette of a selected locus integrated into the PSC genome, the expression cassette containing one or more exogenous target polynucleotides, and one or more promoters operatively linked to said one or more exogenous target polynucleotides, wherein said selected locus is CISH and / or Rosa26, and wherein said genetically modified PSCs, compared with PSCs genetically modified under the same conditions except for integration into a locus different from CISH and / or Rosa26, are capable of differentiating into genetically modified induced iNK cells with higher expression levels and uniformity of said one or more exogenous target polynucleotides.

[0008] On the other hand, genetically modified iNK cells are provided, comprising an expression cassette integrated into a selected locus, the expression cassette containing one or more exogenous target polynucleotides, and one or more promoters operatively linked to said one or more exogenous target polynucleotides, wherein said selected locus is CISH and / or Rosa26, and wherein said genetically modified iNK cells have higher expression levels and uniformity of said one or more exogenous target polynucleotides compared to iNK cells genetically modified under the same conditions except for integration into a locus different from CISH and / or Rosa26.

[0009] In another aspect, a method for preparing genetically modified pluripotent stem cells (PSCs) is provided, the method comprising: introducing into the PSCs a construct comprising a site-specific endonuclease capable of introducing double-strand breaks at a selected locus in the PSCs genome and a construct comprising an expression cassette and a pair of homologous arms specific to the selected locus and located flanking the expression cassette, the expression cassette comprising one or more exogenous target polynucleotides and one or more promoters operatively linked to the one or more exogenous target polynucleotides; and integrating, via homologous recombination, the expression cassette comprising the one or more exogenous target polynucleotides and the one or more promoters into the selected locus in the PSCs genome by the endonuclease to obtain genetically modified PSCs, wherein the selected locus is CISH and / or Rosa26; wherein the genetically modified PSCs, compared with PSCs genetically modified under the same conditions except for integration into a locus different from CISH and / or Rosa26, are capable of differentiating into genetically modified iNK cells with higher expression levels and uniformity of the one or more exogenous target polynucleotides.

[0010] In another aspect, a method for preparing genetically modified iNK cells is provided, the method comprising: preparing genetically modified PSCs according to the method described herein; and then differentiating the genetically modified PSCs into NK cells to prepare genetically modified iNK cells, wherein the genetically modified iNK cells have a higher expression level and uniformity of the one or more exogenous target polynucleotides compared with iNK cells genetically modified under the same conditions except for integration into a locus different from CISH and / or Rosa26.

[0011] The various objects and advantages of the aspects provided herein will become apparent from the following description taken in conjunction with the accompanying drawings, in which certain embodiments of the disclosure are illustrated by way of example and illustration. Attached Figure Description

[0012] Figure 1 This is a schematic diagram of Antares2 being knocked into different loci Rosa26, CISH, AAVS1, CD38 and NKG2A in the genome of human induced pluripotent stem cells (hiPSCs) according to Embodiment 1 of this disclosure.

[0013] Figure 2A The percentage of iNK cells (CD56+%) engineered at different loci Rosa26, CISH, AAVS1, CD38 and NKG2A, according to Example 1 of this disclosure, is shown, where WT represents wild type.

[0014] Figure 2B The results of luciferase detection of Antares2 expression in hiPSC and iNK cells engineered at different loci Rosa26, CISH, AAVS1, CD38 and NKG2A, according to Example 1 of this disclosure, are shown.

[0015] Figure 2C The results of flow cytometry analysis of Antares2 expression in hiPSC and iNK cells engineered at different loci Rosa26, CISH, AAVS1, CD38 and NKG2A, according to Example 1 of this disclosure, are shown, where WT represents wild type.

[0016] Figure 3AThe figure shows the percentage (CD16+%) of NK92 cells expanded with or without exogenous IL-15 after randomly integrating different expression cassettes according to Embodiment 2 of this disclosure, where #1-#8 represent expression cassettes CD16A-T2A-NeoIL2, CD16A-T2A-IL15RAsu, CD16A-T2A-IL15RLI, CD16A-T2A-IL15ILR, CD16A-T2A-IL15-TPA, CD16A-T2A-mbIL15, CD16A-T2A-mbIL15RLI, and CD16A-T2A-mbIL21-mbIL15, respectively.

[0017] Figure 3B The diagram shows the total number of CD16+ cells after expansion of NK92 cells with or without exogenous IL-15, randomly integrated with different expression cassettes according to Embodiment 2 of this disclosure, where #1-#8 represent expression cassettes CD16A-T2A-NeoIL2, CD16A-T2A-IL15RAsu, CD16A-T2A-IL15RLI, CD16A-T2A-IL15ILR, CD16A-T2A-IL15-TPA, CD16A-T2A-mbIL15, CD16A-T2A-mbIL15RLI, and CD16A-T2A-mbIL21-mbIL15, respectively.

[0018] Figure 3C The results of flow cytometry analysis of CD16A or CD64 / CD16A expression in NK92 cells randomly integrated with different expression cassettes according to Embodiment 3 of this disclosure are shown, where #1-#8 represent expression cassettes CD16A-T2A-NeoIL2, CD16A-T2A-IL15-TPA, CD16A-T2A-IL15RLI, CD16A-T2A-mbIL15RLI, CD64 / 16A-T2A-NeoIL2, CD64 / 16A-T2A-IL15-TPA, CD64 / 16A-T2A-IL15RLI, and CD64 / 16A-T2A-mbIL15RLI, respectively.

[0019] Figure 3DThe illustration shows the antibody-dependent cell-mediated cytotoxicity (ADCC) function of NK92 cells with randomly integrated different expression cassettes against SK-OV-2 cells according to Embodiment 3 of this disclosure, wherein #1-#8 represent expression cassettes CD16A-T2A-NeoIL2, CD16A-T2A-IL15-TPA, CD16A-T2A-IL15RLI, CD16A-T2A-mbIL15RLI, CD64 / 16A-T2A-NeoIL2, CD64 / 16A-T2A-IL15-TPA, CD64 / 16A-T2A-IL15RLI, and CD64 / 16A-T2A-mbIL15RLI, respectively.

[0020] Figure 3E The illustration shows the ADCC function of NK92 cells randomly integrated with different expression cassettes against Raji cells according to Embodiment 3 of this disclosure, wherein #1-#8 represent expression cassettes CD16A-T2A-NeolL2, CD16A-T2A-IL15-TPA, CD16A-T2A-IL15RLI, CD16A-T2A-mbIL15RLI, CD64 / 16A-T2A-NeoIL2, CD64 / 16A-T2A-IL15-TPA, CD64 / 16A-T2A-IL15RLI, and CD64 / 16A-T2A-mbIL15RLI, respectively.

[0021] Figure 4 The results of flow cytometry analysis of GFP expression in hiPSCs and iNK cells engineered with different promoters (EF1α, CMV, and CLP) according to Example 4 of this disclosure, as well as the cell percentage (CD56+%) of iNK cells, are shown.

[0022] Figure 5 The effect of engineered hiPSC persistent amplification according to Example 5 of this disclosure on CD64 expression and cell percentage (CD56+%) of derived iNK cells is shown.

[0023] Figure 6A This illustrates the effect of different versions of the UCOE anti-silencing element on the expression of membrane-bound anti-PD-L1 nanobody (mbPDL1 Nb) randomly inserted into hiPSCs, according to Example 6 of this disclosure.

[0024] Figure 6B The diagram shows a comparison of the anti-silencing effects of two UCOE elements, 1550F and SRF6-3F, in a hiPSC with random insertion of mbPDL1 Nb after persistent amplification, according to Embodiment 7 of this disclosure.

[0025] Figure 6CThe effect of cHS4 insulators on mbPDL1 Nb expression in hiPSCs with random insertion of mbPDL1 Nb after persistent amplification is shown in Embodiment 8 of this disclosure.

[0026] Figure 7A The results of flow cytometry analysis of GFP expression driven by different promoters (EF1α and CMV) with or without a 1550FUCOE element in randomly inserted iNK cells, according to Example 9 of this disclosure, are shown.

[0027] Figure 7B The average GFP fluorescence analysis results are shown for GFP expression driven by different promoters (EF1α and CMV) with or without a 1550F UCOE element in randomly inserted iNK cells according to Example 9 of this disclosure.

[0028] Figure 8 This demonstrates the anti-silencing effect of the 1550F UCOE element on CD64 / CD16A expression in persistently expanded engineered hiPSC-differentiated iNK cells according to Embodiment 10 of this disclosure.

[0029] Figure 9 This illustrates the anti-silencing effect of different promoters (EF1α and CMV) combined with the 1550F UCOE element on CD64 / CD16A expression in immature (D24 iNK) and mature (D32 iNK) engineered iNK cells according to Example 11 of this disclosure, where WT represents wild type.

[0030] Figure 10A The results of flow cytometry analysis of CD16A expression in engineered hiPSCs inserted according to Example 12 of this disclosure are shown, with WTiPSCs used as a control.

[0031] Figure 10B The results of flow cytometry analysis of CD16A expression in engineered iNK cells inserted according to Example 12 of this disclosure are shown, with WT iNK as a control.

[0032] Detailed description

[0033] It should be understood that certain aspects, patterns, implementations, variations and features of this disclosure are described below with varying degrees of detail in order to provide a substantive understanding of the technology.

[0034] The use of “first,” “second,” “third,” “fourth,” “fifth,” “sixth,” etc., throughout this specification does not imply an order or sequence of features, structures, or characteristics described in connection with that reference, but is used only for distinguishing purposes.

[0035] Throughout this specification, references to "first aspect," "second aspect," "third aspect," "fourth aspect," "fifth aspect," "sixth aspect," etc., indicate that a specific feature, structure, or characteristic associated with that aspect is included in at least one or more aspects of this disclosure. Furthermore, one or more specific features, structures, characteristics, or embodiments of an aspect may be combined in any suitable manner with specific features, structures, characteristics, or embodiments of one or more other aspects.

[0036] Throughout this specification, references to "an embodiment," "some embodiments," "preferred embodiments," "certain embodiments," or "a particular embodiment" indicate that a specific feature, structure, or characteristic described in connection with these embodiments is included in at least one or more embodiments of this disclosure. Furthermore, one or more specific features, structures, or characteristics in one embodiment may be combined with features, structures, or characteristics in one or more other embodiments in any suitable manner.

[0037] It should be understood that this disclosure is not limited to specific uses, methods, reagents, compounds, compositions, or biological systems, which are of course subject to variation. It should also be understood that the terminology used herein is for describing particular embodiments only and is not intended to limit this disclosure.

[0038] definition

[0039] Unless otherwise defined, all technical and scientific terms used herein have the meanings commonly understood by one of ordinary skill in the art to which this disclosure pertains. The following references provide general definitions for many of the terms used herein: Singleton et al., *Dictionary of Microbiology and Molecular Biology* (2nd edition, 1994); *The Cambridge Dictionary of Science and Technology* (Walker, ed., 1988); *The Glossary of Genetics*, 5th edition, R. Rieger et al. (eds.), Springer Verlag (1991); and Hale & Marham, *The Harper Collins Dictionary of Biology* (1991). As used herein, unless otherwise stated, the following terms have the meanings assigned to them below. The terminology used herein is for describing particular embodiments only and is not intended to limit this disclosure.

[0040] Unless otherwise stated, “a / an” or “an / a type of” means “one or more”.

[0041] Unless otherwise specified, the use of alternatives (e.g., "and / or") shall be understood as one, two, or any combination thereof.

[0042] As used in this article, “about” means plus or minus 10%, or plus or minus 5%, or plus or minus 4%, or plus or minus 3%, or plus or minus 2%, or plus or minus 1%, and a specified number.

[0043] As used herein, the terms "substantially" or "essentially" refer to a quantity, level, value, quantity, frequency, percentage, size, volume, weight, or length that is about or at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or more of a reference quantity, level, value, quantity, frequency, percentage, size, volume, weight, or length. In some embodiments, the terms "substantially identical" or "essentially identical" refer to a range of quantities, levels, values, quantities, frequencies, percentages, sizes, volumes, weights, or lengths that are substantially the same as a reference quantity, level, value, quantity, frequency, percentage, size, volume, weight, or length.

[0044] As used herein, the term "comprising" is intended to indicate that a composition and method comprises the stated elements, but does not exclude other elements. When used to define a composition and method, "consistently made of" should mean excluding other elements that are essential to the composition or method. "Constituted of" should mean excluding other components in the claimed composition and substantial method steps in amounts exceeding trace amounts. Embodiments defined by these transitional terms are all within the scope of this disclosure. Therefore, methods and compositions are intended to include additional steps and components (comprising), or alternatively include insignificant steps and compositions (consistently made of), or alternatively intend to include only the stated method steps or compositions (consistently made of). Furthermore, in each instance herein, each of the terms "comprising," "consistently made of," and "consistently made of" may be replaced by any of the other two terms.

[0045] As used herein, the term "pluripotent stem cell" (PSC) refers to cells derived from the inner cell mass of the embryonic blastocyst. Pluripotent stem cells can be pluripotent and, during development, produce all derivatives of the three major germ layers (ectoderm, endoderm, and mesoderm). Pluripotent stem cells can be derived from humans (e.g., human PSCs or hPSCs). Pluripotent stem cells can be induced pluripotent stem cells (iPSCs) or embryonic stem cells (ESCs). ESCs (e.g., hESCs) and iPSCs (e.g., hiPSCs) are known in the art and are readily available using conventional methods (e.g., methods described in the prior art) or commercially available products. PSCs obtained through various types of genetic engineering (e.g., genome site-specific transgene knock-in) may also be used herein.

[0046] As used herein, the term "induced pluripotent stem cell" or iPSC refers to stem cells derived from differentiated adult, neonatal, or fetal cells that have been induced or altered, i.e., reprogrammed to differentiate into tissues of all three germ layers or the dermis (mesoderm, endoderm, and ectoderm). The iPSCs derived are not those found in nature. Suitable methods for generating iPSCs from somatic cells or pluripotent stem cells are well known to those skilled in the art. For example, iPSCs can be reliably generated from somatic cells using conventional reprogramming techniques.

[0047] As used in this article, the term "reprogramming" refers to methods that enhance cell potential or dedifferentiate cells to a less differentiated state. For example, cells with enhanced cell potential can have greater developmental plasticity (i.e., they can differentiate into more cell types) compared to the same cells in their unreprogrammed state. In other words, reprogrammed cells are cells that are less differentiated than the same cells in their unreprogrammed state. "Reprogramming" can also refer to the dedifferentiation of somatic cells or pluripotent stem cells into pluripotent stem cells, also known as induced pluripotent stem cells or iPSCs.

[0048] As used herein, the term "embryonic stem cell" or ESC refers to a pluripotent stem cell naturally present in the inner cell mass of the embryonic blastocyst. Embryonic stem cells are pluripotent and, during development, produce all derivatives of the three major germ layers (ectoderm, endoderm, and mesoderm). They do not contribute to the extraembryonic membranes or placenta, i.e., they are not totipotent. When used in this disclosure, embryonic stem cells or ESCs are derived from commercially established human embryonic stem cell lines or human embryonic stem cells within 14 days of fertilization that have not undergone in vivo development.

[0049] As used herein, the term "pluripotency" or "pluripotent" refers to the developmental potential of a cell to differentiate into cells of all three germ layers (ectoderm, mesoderm, and endoderm). Pluripotency can be determined, at least in part, by assessing the pluripotency characteristics of a cell. Pluripotency characteristics include, but are not limited to: (i) pluripotent stem cell morphology; (ii) unlimited self-renewal potential; (iii) expression of pluripotent stem cell markers, including but not limited to SSEA1 (mouse only), SSEA3 / 4, SSEA5, TRA1-60 / 81, TRA1-85, TRA2-54, GCTM-2, TG343, TG30, CD9, CD29, CD133 / prominin, CD140a, CD56, CD73, CD90, CD105, OCT4, NANOG, SOX2, CD30 and / or CD50; (iv) ability to differentiate into all three somatic cell lineages (ectoderm, mesoderm and endoderm); (v) teratoma formation composed of the three somatic cell lineages; and (vi) embryoid formation composed of cells from the three somatic cell lineages.

[0050] As used herein, the term "genetically modified pluripotent stem cells" (PSCs) refers to pluripotent stem cells whose genome has been modified to contain at least one exogenous gene. Within the scope of this disclosure, genetically modified PSCs are used interchangeably with genetically engineered PSCs or gene-edited PSCs.

[0051] As used herein, “natural killer cells” or NK cells refer to lymphoid cells defined based on their marker expression and function / activity. For example, in humans, NK cells express CD56. Such NK cells can be CD56+CD3- cells, for example. NK cells can express varying levels of CD56. NK cells can include primary NK cells or induced NK (iNK) cells.

[0052] As used herein, “primary NK cells” refers to naturally occurring natural killer cells that may be derived from, for example, blood (e.g., cord blood or peripheral blood collected via apheresis), bone marrow, or frozen primary NK cells (e.g., commercially available). Examples of primary NK cells include PBNK (peripherally blood-derived NK) and CBNK (cord blood-derived NK) cells.

[0053] As used herein, the term "iNK cell" refers to a natural killer cell derived from pluripotent stem cells (e.g., hPSCs). iNK cells can include immature iNK cells or mature iNK cells.

[0054] As used in this article, "immature iNK cells" refers to natural killer cells that are directly differentiated from pluripotent cells (e.g., hPSCs) and have not yet undergone expansion and maturation. Compared with mature iNK cells, immature iNK cells have lower expression of specific markers (e.g., CD56) and lower cytokine release and cytotoxicity.

[0055] As used herein, the term "mature iNK cell" or "mature iNK cell" refers to a natural killer cell that has differentiated from pluripotent cells (e.g., hPSCs) and has undergone expansion and maturation. Mature iNK cells express high levels of specific markers such as CD56 and possess cytokine release and cytotoxicity similar to primary NK cells.

[0056] As used herein, the term "genetically modified iNK cell" refers to an iNK cell that has been modified to include at least one foreign gene in its genome. Within the scope of this disclosure, "genetically modified iNK cell" may be used interchangeably with genetically engineered iNK cells or gene-edited iNK cells.

[0057] As used herein, the term "differentiation" refers to the process by which undifferentiated ("undifferentiated") or poorly differentiated cells acquire the characteristics of specialized cells (such as, for example, blood cells or immune cells). In some embodiments, differentiated cells or differentiation-inducing cells refer to cells that occupy a more specialized ("differentiated") position in a cell lineage. For example, human pluripotent stem cells (hPSCs), when treated with appropriate differentiation factors in cell culture media, can differentiate into a variety of more differentiated cell types, such as neural or hematopoietic progenitor cells, lymphocytes, cardiomyocytes, immune cells (such as natural killer cells), and other cell types. In some embodiments, the term "differentiated" is applied to the differentiation process to refer to a point in time when a cell, through the differentiation pathway, would normally differentiate into or continue to differentiate into a specific cell type or subset of cell types, and cannot normally differentiate into different cell types (other than the specific cell type or subset of cell types), nor revert to a poorly differentiated cell type.

[0058] As used herein, the term "lymphocyte" refers to all immature, mature, undifferentiated, and differentiated leukocyte populations derived from lymphoprogenitor cells, including tissue-specific and specialized types, and includes, as non-limiting examples, B cells, T cells, NKT cells, and NK cells. In some embodiments, lymphocytes include all B cell lineages, including pre-B cells, progenitor B cells, early pro-B cells, late pro-B cells, large pre-B cells, small pre-B cells, immature B cells, mature B cells, plasma B cells, memory B cells, B-1 cells, B-2 cells, and the unresponsive AN1 / T3 cell population.

[0059] As used herein, the term "immune cell" refers to any cell that plays a role in the immune response of a subject. Immune cells are of hematopoietic origin and include lymphocytes, such as B cells and T cells; natural killer cells; and myeloid cells, such as monocytes, macrophages, dendritic cells, eosinophils, neutrophils, mast cells, basophils, and granulocytes.

[0060] As used in this article, the term “expression cassette” refers to the complete elements required to express a gene, including an operable promoter and gene coding sequence.

[0061] As used herein, the term "coding sequence" refers to the portion of a nucleic acid sequence that directly determines the amino acid sequence of its protein product. The boundaries of a coding sequence are typically determined by the ribosome binding site (for prokaryotic cells) immediately upstream of the mRNA 5′ open reading frame and the transcription termination sequence immediately downstream of the mRNA 3′ open reading frame.

[0062] As used herein, the terms "one or more target genes" or "one or more target polynucleotides" refer to DNA sequences that, when placed under the control of appropriate regulatory sequences, are transcribed into RNA in vivo and, in some cases, translated into polypeptides. Target genes or polynucleotides can include, but are not limited to, prokaryotic sequences, cDNA of eukaryotic mRNA, genomic DNA sequences of eukaryotic (e.g., mammalian) DNA, and synthetic DNA sequences. For example, a target gene can encode mRNA, shRNA, a natural polypeptide (i.e., a polypeptide found in nature) or a fragment thereof; a variant polypeptide (i.e., a mutant of a natural polypeptide with less than 100% sequence identity to the natural polypeptide) or a fragment thereof; engineered polypeptides or peptide fragments, therapeutic peptides or polypeptides, imaging markers, selection markers, etc.

[0063] As used herein, the term "polynucleotide" refers to a polymer of nucleotides (deoxyribonucleotides, ribonucleotides, or analogues thereof) of any length. Polynucleotides can include genes or gene fragments (e.g., probes, primers, EST or SAGE tags), exons, introns, messenger RNA (mRNA), transfer RNA, ribosomal RNA, ribozymes, cDNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, isolated DNA of any sequence, isolated RNA of any sequence, nucleic acid probes, and primers. Polynucleotides also refer to double-stranded and single-stranded molecules.

[0064] As used herein, the terms “peptide,” “polypeptide,” and “protein” are used interchangeably and refer to a molecule having amino acid residues covalently linked by peptide bonds. A polypeptide must contain at least two amino acids, and there is no limit to the maximum number of amino acids in a polypeptide. As used herein, the term refers both to short chains, such as peptides, oligopeptides, and oligomers commonly referred to in the art, and to long chains, such as polypeptides or proteins commonly referred to in the art. “Polypeptide” includes, for example, biologically active fragments, substantially homologous polypeptides, oligopeptides, homodimers, heterodimers, polypeptide variants, modified polypeptides, derivatives, analogs, fusion proteins, etc. Polypeptides include natural polypeptides, recombinant polypeptides, synthetic polypeptides, or combinations thereof.

[0065] As used herein, the term “exogenous” is intended to mean that the mentioned molecule or activity is introduced into a host cell. This introduction can be achieved, for example, by introducing the coding nucleic acid into the host genetic material (e.g., by integration into the host chromosome) or as non-chromosomal genetic material (e.g., plasmids). Therefore, when used to refer to the expression of the coding nucleic acid, the term means the introduction of the coding nucleic acid into the cell in an expressible form.

[0066] As used herein, the term "endogenous" refers to the molecules or activities mentioned that are present in the host cells. Similarly, when the term is used to refer to the expression of nucleic acid encoding, it refers to the expression of nucleic acid encoding that is present in the cell, rather than that introduced from outside.

[0067] As used herein, the term "operably linked" or "operatively linked" refers to the binding of nucleic acid sequences to a single nucleic acid fragment such that the function of one is influenced by the other. For example, when a promoter can affect the expression of a coding sequence or functional RNA (i.e., the coding sequence or functional RNA is transcribedly regulated by the promoter), then the promoter is operatively linked to that coding sequence or functional RNA. The coding sequence can be operatively linked to the regulatory sequence in a sense or antisense direction.

[0068] "Site-directed integration" refers to the insertion of one or more nucleotides of a construct into a pre-selected site or "integration site" in cellular chromosomes or mitochondrial DNA. As used herein, the term "integration" also refers to the process of inserting one or more exogenous sequences or nucleotides into the construct, wherein an endogenous sequence or nucleotide may or may not be deleted at the integration site. Where deletion is present at the insertion site, "integration" may also include replacing the deleted endogenous sequence or nucleotide with one or more inserted nucleotides.

[0069] As used herein, the term "construct" refers to a large molecule or molecular complex containing polynucleotides delivered to a host cell in vitro or in vivo. As used herein, the term "vector" refers to any nucleic acid construct capable of guiding the delivery or transfer of foreign genetic material to a target cell, where the genetic material can be replicated and / or expressed. As used herein, the term "vector" includes the construct to be delivered. Vectors can be linear or circular molecules. Major types of vectors include, but are not limited to, plasmids, free vectors, viral vectors, granules, and artificial chromosomes. Viral vectors include, but are not limited to, adenovirus vectors, adeno-associated virus vectors, retroviral vectors, lentiviral vectors, Sendai virus vectors, etc.

[0070] As used herein, the term "continuous amplification" refers to the long-term amplification of cells, in which cells undergo multiple passages. Within the scope of this disclosure, continuous amplification may be used interchangeably with persistent amplification.

[0071] As used herein, the term "effective dose" refers to a dose of medicine sufficient to achieve a beneficial or intended outcome. The dose administered to a subject may depend on individual characteristics such as general health status, age, sex, weight, effective concentration of the cells administered (e.g., iNK cells), and tolerance to the drug. Those skilled in the art will be able to determine an appropriate dose based on these and other factors. An effective dose may be administered to the subject in a single or multiple-dose manner.

[0072] As used herein, the terms “subject,” “individual,” or “patient” are used interchangeably and refer to an individual organism, vertebrate, or mammal, and may include humans, non-human primates, rodents, etc. (e.g., recipients of a particular medical intervention, or cell collectors). In some embodiments, the individual, patient, or subject is a human.

[0073] As used herein, the terms “treatment,” “treat,” and “treating” refer to a clinical intervention aimed at reversing a disease, symptom, and / or condition or one or more symptoms thereof; alleviating a disease, symptom, and / or condition or one or more symptoms thereof; delaying the onset of a disease, symptom, and / or condition or one or more symptoms thereof; or inhibiting the progression of a disease, symptom, and / or condition or one or more symptoms thereof; improving a disease, symptom, and / or condition or one or more symptoms thereof; reducing the severity of a disease, symptom, and / or condition or one or more symptoms thereof; preventing or delaying the recurrence of a disease, symptom, and / or condition or one or more symptoms thereof; and / or improving one or more symptoms of a disease, symptom, and / or condition as described herein. Treatment, for example, in the form of edited PSCs or iNK cells or edited PSCs or iNK cell populations as described herein, may be administered to a subject after the onset of one or more symptoms and / or after a disease has been diagnosed. Treatment may be administered asymptomatically, for example, to prevent or delay the onset of symptoms, or to inhibit the onset or progression of disease. For example, treatment may be administered to susceptible individuals before the onset of symptoms (e.g., taking into account genetic or other susceptibility factors). Treatment may continue after symptoms subside, for example, to prevent or delay their recurrence. Treatment can lead to improvement and / or resolution of one or more symptoms of the disease, condition, and / or status.

[0074] As used herein, the terms “prevent,” “preventing,” or “prevention” refer to reducing the likelihood that a subject who does not have but is at risk of developing or developing a disease, condition, or condition will develop such a disease, condition, or condition.

[0075] Genetically modified cells

[0076] Gene editing strategies for obtaining engineered iNK cells from engineered PSCs require that the developmental potential of engineered PSCs for directed differentiation is not adversely affected by the engineered form in the PSCs, and that the engineered form can be efficiently expressed in the derived NK cells to perform the intended function. As disclosed herein, the genetically engineered PSCs and iNK cells contain one or more gene modifications at selected loci in their genomes. These specific loci include Rosa 26 and / or CISH. Genetically engineered PSCs generated through site-specific integration of Rosa 26 and / or CISH are able to differentiate into NK cells with higher levels and uniformity of the one or more exogenous target polynucleotides compared to PSCs genetically modified under the same conditions except for integration at loci different from CISH and / or Rosa 26. Furthermore, this strategy overcomes current engineering barriers to primary NK cells obtained from peripheral blood, umbilical cord blood, or any other donor tissue, as these cells are limited in supply, difficult to engineer, and their engineering often lacks reproducibility and uniformity.

[0077] Genome editing (or genome editing or gene editing, used interchangeably in this article) is a form of genetic engineering that inserts, deletes, and / or replaces DNA in the genome of a target cell. Site-specific genome editing (used interchangeably with "site-specific genome editing" or "site-specific gene modification") enables insertion, deletion, and / or replacement at pre-selected sites in the genome. During site-specific editing, when an endogenous sequence is inserted, deleted, and / or replaced at a pre-selected site, the endogenous gene containing the affected sequence can be knocked out or knocked down. Therefore, site-specific editing can also be used to interfere with the expression of endogenous genes.

[0078] The term "site-directed integration," used similarly in this article, refers to a process involving the insertion of one or more exogenous sequences, with or without deletion of endogenous sequences at the insertion site. In contrast, random integration or gene editing (e.g., using transposon systems) is susceptible to positional effects and silencing, leading to unreliable and unpredictable expression. Furthermore, random integration may activate proto-oncogenes, raising safety concerns.

[0079] In one aspect, genetically modified pluripotent stem cells (PSCs) are provided, comprising an expression cassette of a selected locus integrated into the PSC genome, the expression cassette containing one or more exogenous target polynucleotides, and one or more promoters operatively linked to said one or more exogenous target polynucleotides, wherein said selected locus is CISH and / or Rosa26, and wherein said genetically modified PSCs, compared with PSCs genetically modified under the same conditions except for integration into a locus different from CISH and / or Rosa26, are capable of differentiating into genetically modified iNK cells with higher expression levels and uniformity of said one or more exogenous target polynucleotides.

[0080] In some embodiments, the genetically modified PSCs can differentiate into iNK cells with an efficiency of at least 90%, such as, for example, 91% or more, 92% or more, 93% or more, 94% or more, or 95% or more. In some embodiments, the genetically modified PSCs can differentiate into iNK cells with an efficiency of at least 96%. In some embodiments, the genetically modified PSCs can differentiate into iNK cells with an efficiency of at least 97%. In some embodiments, the genetically modified PSCs can differentiate into iNK cells with an efficiency of at least 98%. In some embodiments, the genetically modified PSCs can differentiate into iNK cells with an efficiency of at least 99%. In some embodiments, the genetically modified PSCs can differentiate into iNK cells with an efficiency of 100%.

[0081] According to this disclosure, the genetically modified PSCs, compared with PSCs genetically modified under the same conditions except for integration at a locus different from CISH and / or Rosa26, are capable of differentiating into genetically modified iNK cells with a level of expression of the one or more exogenous target polynucleotides that is at least 5-fold higher. In some embodiments, the genetically modified PSCs, compared with PSCs genetically modified under the same conditions except for integration at a locus different from CISH and / or Rosa26, are capable of differentiating into genetically modified iNK cells with a level of expression of the one or more exogenous target polynucleotides that is at least 6, 7, 8, 9, or 10-fold higher. In some embodiments, the genetically modified PSCs, compared with PSCs genetically modified under the same conditions except for integration at a locus different from CISH and / or Rosa26, are capable of differentiating into genetically modified iNK cells with a level of expression of the one or more exogenous target polynucleotides that is at least 11, 12, 13, 14, or 15-fold higher. In some embodiments, the genetically modified PSCs are capable of differentiating into genetically modified iNK cells with at least 16, 17, 18, 19, or 20-fold higher expression levels of the one or more exogenous target polynucleotides compared to PSCs genetically modified under the same conditions except for integration into a locus different from CISH and / or Rosa26. In some embodiments, the genetically modified PSCs are capable of differentiating into genetically modified iNK cells with at least 21, 22, 23, 24, or 25-fold higher expression levels of the one or more exogenous target polynucleotides compared to PSCs genetically modified under the same conditions except for integration into a locus different from CISH and / or Rosa26. In some embodiments, the genetically modified PSCs are capable of differentiating into genetically modified iNK cells with at least 26, 27, 28, 29, or 30-fold higher expression levels of the one or more exogenous target polynucleotides compared to PSCs genetically modified under the same conditions except for integration into a locus different from CISH and / or Rosa26.

[0082] According to this disclosure, the genetically modified PSCs, compared with PSCs genetically modified under the same conditions except for integration at a locus different from CISH and / or Rosa26, are capable of differentiating into genetically modified iNK cells with at least 1-fold higher uniformity of expression of the one or more exogenous target polynucleotides. In some embodiments, the genetically modified PSCs, compared with PSCs genetically modified under the same conditions except for integration at a locus different from CISH and / or Rosa26, are capable of differentiating into genetically modified iNK cells with at least 2-fold higher uniformity of expression of the one or more exogenous target polynucleotides. In some embodiments, the genetically modified PSCs, compared with PSCs genetically modified under the same conditions except for integration at a locus different from CISH and / or Rosa26, are capable of differentiating into genetically modified iNK cells with at least 3-fold higher uniformity of expression of the one or more exogenous target polynucleotides. In some embodiments, the genetically modified PSCs, compared with PSCs genetically modified under the same conditions except for integration at a locus different from CISH and / or Rosa26, are capable of differentiating into genetically modified iNK cells with at least 4-fold higher uniformity of expression of the one or more exogenous target polynucleotides. In some embodiments, the genetically modified PSCs, compared with PSCs genetically modified under the same conditions except for integration at a locus different from CISH and / or Rosa26, are capable of differentiating into genetically modified iNK cells with at least 5-fold higher uniformity of expression of the one or more exogenous target polynucleotides.

[0083] According to this disclosure, the genetically modified PSCs are capable of differentiating into iNK cells with a homogeneity of expression of one or more exogenous target polynucleotides of at least 90%, such as, for example, 91% or more, 92% or more, 93% or more, 94% or more, or 95% or more. In some embodiments, the genetically modified PSCs are capable of differentiating into iNK cells with a homogeneity of expression of one or more exogenous target polynucleotides of at least 96%. In some embodiments, the genetically modified PSCs are capable of differentiating into iNK cells with a homogeneity of expression of one or more exogenous target polynucleotides of at least 97%. In some embodiments, the genetically modified PSCs are capable of differentiating into iNK cells with a homogeneity of expression of one or more exogenous target polynucleotides of at least 98%. In some embodiments, the genetically modified PSCs are capable of differentiating into iNK cells with a homogeneity of expression of one or more exogenous target polynucleotides of at least 99%. In some embodiments, the genetically modified PSCs are capable of differentiating into iNK cells with 100% uniformity of expression of one or more exogenous target polynucleotides.

[0084] In some embodiments, the genetically modified PSCs can differentiate in vitro into hematopoietic lineages or any other non-pluripotent cell type, wherein the derived non-pluripotent cells retain the functional genetic modifications of the PSCs. In some embodiments, the genetically modified PSC-derived cells include, but are not limited to, mesodermal cells, hematopoietic endothelial (HE) cells, and CD34 cells. + Hematopoietic cells, hematopoietic stem cells and progenitor cells, hematopoietic pluripotent progenitor cells (MPP), T cell progenitor cells, NK cell progenitor cells, myeloid cells, neutrophil progenitor cells, T cells, NKT cells, NK cells and B cells, among which these cells derived from genetically modified PSCs retain functional genetic modifications at the desired sites.

[0085] On the other hand, genetically modified iNK cells are provided, comprising an expression cassette integrated into a selected locus, the expression cassette containing one or more exogenous target polynucleotides, and one or more promoters operatively linked to said one or more exogenous target polynucleotides, wherein said selected locus is CISH and / or Rosa26, and wherein said genetically modified iNK cells have higher expression levels and uniformity of said one or more exogenous target polynucleotides compared to iNK cells genetically modified under the same conditions except for integration into a locus different from CISH and / or Rosa26.

[0086] According to this disclosure, one or more exogenous target polynucleotides can be highly uniformly expressed in the gene-modified iNK cells described herein.

[0087] For example, the genetically modified iNK cells exhibit at least 1-fold higher expression homogeneity of the one or more exogenous target polynucleotides compared to iNK cells genetically modified under the same conditions except for integration at a locus different from CISH and / or Rosa26. In some embodiments, the genetically modified iNK cells exhibit at least 2-fold higher expression homogeneity of the one or more exogenous target polynucleotides compared to iNK cells genetically modified under the same conditions except for integration at a locus different from CISH and / or Rosa26. In some embodiments, the genetically modified iNK cells exhibit at least 3-fold higher expression homogeneity of the one or more exogenous target polynucleotides compared to iNK cells genetically modified under the same conditions except for integration at a locus different from CISH and / or Rosa26. In some embodiments, the genetically modified iNK cells exhibit at least 4-fold higher expression homogeneity of the one or more exogenous target polynucleotides compared to iNK cells genetically modified under the same conditions except for integration at a locus different from CISH and / or Rosa26. In some embodiments, the genetically modified iNK cells exhibit at least 5-fold higher expression homogeneity of the one or more exogenous target polynucleotides compared to iNK cells genetically modified under the same conditions except for integration at a locus different from CISH and / or Rosa26.

[0088] According to this disclosure, the one or more exogenous target polynucleotides can be expressed in at least 90%, such as, for example, 91% or more, 92% or more, 93% or more, 94% or more, or 95% or more of genetically modified iNK cells. In some embodiments, the one or more exogenous target polynucleotides can be expressed in at least 96% of genetically modified iNK cells. In some embodiments, the one or more exogenous target polynucleotides can be expressed in at least 97% of genetically modified iNK cells. In some embodiments, the one or more exogenous target polynucleotides can be expressed in at least 98% of genetically modified iNK cells. In some embodiments, the one or more exogenous target polynucleotides can be expressed in at least 99% of genetically modified iNK cells. In some embodiments, the one or more exogenous target polynucleotides can be expressed in 100% of genetically modified iNK cells.

[0089] According to this disclosure, gene modification in CISH does not affect the expression level and uniformity of transgenes in terminally differentiated cells (e.g., iNK cells), but it does affect them in PSCs. Surprisingly, transgene expression in CISH is silenced in a pluripotent state but is restored after iNK cell differentiation.

[0090] According to this disclosure, gene modification of Rosa26 does not affect the expression level and uniformity of the transgene in both PSCs and ultimately differentiated cells (e.g., iNK cells). In some embodiments, the one or more exogenous target polynucleotides may be expressed in at least 50%, such as, for example, 60% or more, or 70% or more of the gene-modified PSCs. In some embodiments, the one or more exogenous target polynucleotides may be expressed in at least 80%, such as, for example, 81% or more, 82% or more, 83% or more, 84% or more, 85% or more, 86% or more, 87% or more, 88% or more, or 89% or more of the gene-modified PSCs. In some embodiments, one or more exogenous target polynucleotides may be expressed in at least 90%, such as 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, 99% or more, or 100% of genetically modified PSCs.

[0091] locus

[0092] In this disclosure, CISH and Rosa26 are disclosed as genetic engineering targets in PSCs and their derived iNK cells.

[0093] CISH

[0094] Cytokine-inducible SH2-containing protein (CISH) is a human protein encoded by the CISH gene. Orthologs of CISH have been identified in most mammals with sequenced genomes. CISH controls T-cell receptor (TCR) signaling, and CISH variants with certain SNPs are associated with susceptibility to bacteremia, tuberculosis, and malaria (e.g., see Uchida K et al., March 1998, “Molecular cloning of CISH, 3p21.3 chromosome allocation and expression analysis in fetal and adult tissues.” Cytogenetics and Cell Genetics, 78(3-4): 209-12; Yoshimura A et al., June 1995, “A novel cytokine-inducible gene CIS encodes an SH2-containing protein that binds to tyrosine-phosphorylated interleukin-3 and erythropoietin receptors.” The EMBO journal, 14(12): 2816-26; and Khor CC et al., June 2010, “CISH and susceptibility to infectious diseases.” The New England Journal of Medicine. Medicine). 362(22):2092-101).

[0095] According to GRCh38.p14, human CISH is located on chromosome 3 at positions 50606489 to 50611774. It has 4 exons and 3 introns. The gene ID for human CISH is 1154. More detailed information about this gene can be found in the NCBI database, which is incorporated herein by reference in its entirety.

[0096] Any site within the human CISH locus can be selected as a target site. For example, target sequences for the CISH locus can be selected from GenBank NM_013324.7. Examples of target sequences for the CISH locus may include exon 1 (1..144), exon 2 (145..301), exon 3 (302..522), and exon 4 (523..2176).

[0097] Rosa26

[0098] ROSA26 is a constitutive, ubiquitous gene locus in mice. It was initially isolated in gene capture mutagenesis screening of embryonic stem cells (ESCs) (see, e.g., Friedrich, G; Soriano, P (1991). “Promoter capture in embryonic stem cells: a genetic screening for identifying and mutating a mouse developmental gene.” Genes & Development. 5(9): 1513-23). ​​The human ROSA26 locus has been identified (Irion, Stefan; Luche, Hervé; Gadue, Paul; Fehling, Hans Joerg; Kennedy, Marion; Keller, Gordon (2007). “Identification and targeting of the ROSA26 locus in human embryonic stem cells.” Nature Biotechnology. 25(12): 1477-82). ROSA stands for reverse directional splice acceptor and is named after lentiviral gene capture vectors. More details about ROSA26 can be found in the NCBI database, and its full text is incorporated into this article for reference.

[0099] Any site within the human Rosa26 locus can be selected as a target site. For example, the target sequence for the Rosa26 locus can be selected from Chr3:9432781..9440914.

[0100] In some implementations, the loci that differ from CISH and / or Rosa26 are selected from AAVS1, CD38, and / or NKG2A.

[0101] AAVS1

[0102] Adeno-associated virus integration site 1 (AAVS1) is a viral integration site encoded in humans by the AAVS1 gene located on chromosome 19 (see, for example, Ward et al., Virology. 25 Nov 2012; 433(2): 356-66. doi: 10.1016 / j.virol.2012.08.015.Epub 13 Sep 2012; and Kotin et al., EMBO J. 11 Dec 1992; 11(13): 5071-8. doi: 10.1002 / j.1460-2075.1992.tb05614.x.). More detailed information about the AAVS1 locus is available in the NCBI database, which is incorporated herein by reference in its entirety.

[0103] Any site within the human AAVS1 locus can be selected as a target site. For example, a target sequence for the AAVS1 locus can be selected from GenBank: AC010327.8 (7774..11429).

[0104] CD38

[0105] CD38 (Cluster 38), also known as cyclic ADP-ribose hydrolase, is a glycoprotein found on the surface of various immune cells (leukocytes), including CD4+, CD8+, B lymphocytes, and natural killer cells. CD38 also plays a role in cell adhesion, signal transduction, and calcium signaling (e.g., see Orciani M, Trubiani O, Guarnieri S, Ferrero E, DiPrimio R (October 2008). "Constraintive expression of CD38 in the nucleus of human hematopoietic cells." Journal of Cellular Biochemistry, 105(3): 905-12; and "Entrez Gene: CD38 molecule"). In humans, the CD38 protein is encoded by the CD38 gene located on chromosome 4. CD38 is a paralog of CD157, which is also located on human chromosome 4 (4p15). More detailed information about the CD38 locus can be found in the NCBI database, which is included in this article for reference.

[0106] The CD38 locus has 8 exons and 7 introns. Any site within the CD38 locus can be selected as a target site. For example, target sequences for the CD38 locus can be selected from GenBank NM_001775.4. Examples of target sequences for the CD38 locus may include exon 1 (1..320), exon 2 (321..450), exon 3 (451..586), exon 4 (587..672), exon 5 (673..746), exon 6 (747..839), exon 7 (840..926), and exon 8 (927..5620).

[0107] NKG2A

[0108] NKG2, also known as CD159 (differentiation cluster 159), is the receptor for natural killer cells (NK cells). There are seven types of NKG2: A, B, C, D, E, F, and H. NKG2A dimerizes with CD94 to form an inhibitory receptor (CD94 / NKG2). According to GRCh38.p14, human NKG2A is located on chromosome 12 from positions 10442264 to 10454685. The gene ID for human NKG2A is 3821. More information about this gene can be found in the NCBI database, which is included in its entirety in this article for reference.

[0109] The NKG2A locus has 9 exons and 8 introns. Any site within the NKG2A locus can be selected as a target site. For example, target sequences for the NKG2A locus can be selected from GenBank NM_001304448.1. Examples of target sequences for the NKG2A locus may include exon 1 (1..354), exon 2 (355..426), exon 3 (427..644), exon 4 (645..740), exon 5 (741..794), exon 6 (795..946), exon 7 (947..1047), exon 8 (1048..1142), and exon 9 (1143..1179).

[0110] The following sections will describe in detail the various implementation plans for the two aspects mentioned above, as well as other aspects.

[0111] PSCs include embryonic stem cells (ESCs) and / or induced pluripotent stem cells (iPSCs). Since iPSCs represent an unlimited source of cells for cell-based therapies, iPSCs are preferred PSCs. ESCs (e.g., hESCs) and iPSCs (e.g., hiPSCs) are known in the art and are readily available by conventional methods (e.g., methods described in the prior art) or commercially available products. For example, the CytoTuneiPS2.0 Sendai Virus Reprogramming Kit (ThermoFisher Scientific) can be used to reliably generate induced pluripotent stem cells (iPSCs) from somatic cells, including PBMCs and T cells.

[0112] Genetically modified PSCs and iNK cells contain an expression cassette containing one or more exogenous target polynucleotides. Any suitable exogenous polynucleotide can be used in the genetically modified PSCs and iNK cells described herein. The one or more exogenous target polynucleotides include, but are not limited to, polynucleotides encoding luciferase or fluorescent proteins, polynucleotides encoding Fc receptors, polynucleotides encoding antibodies, polynucleotides encoding cytokines, polynucleotides encoding proteins with safety switch functions, or any combination thereof. Therefore, the gene editing strategies described herein provide an efficient, reliable, and site-specific method for stably generating genetically modified cells with desired functions.

[0113] In some embodiments, the one or more exogenous target polynucleotides comprise a polynucleotide encoding a luciferase or a fluorescent protein. Examples of the luciferase or fluorescent protein include, but are not limited to, luciferase, Antares2, and green fluorescent protein (GFP). In some embodiments, the luciferase or fluorescent protein is a luciferase. In some embodiments, the luciferase is Antares2 (SEQ ID NO.: 1). In some embodiments, the luciferase is GFP (SEQ ID NO.: 2). Furthermore, the luciferase or fluorescent protein also includes proteins encoded by other reporter genes. Examples of other reporter genes include, but are not limited to, the chloramphenicol acetyltransferase (Cat) gene, the luciferase (Luc) gene, the β-glucosidase (Gus) gene, and the secretory alkaline phosphatase (Seap) gene.

[0114] In some embodiments, the iNK cells described herein exhibit enhanced antibody-dependent cell-mediated cytotoxicity (ADCC). In some embodiments, the one or more exogenous target polynucleotides include a polynucleotide encoding an Fc receptor. In some embodiments, the Fc receptor includes CD16, CD64, or variants thereof. In some embodiments, the Fc receptor includes an uncleavable CD16A, or a CD64 / 16A fusion protein comprising a CD64 extracellular domain, a CD16A transmembrane domain, and a CD16A cytoplasmic domain.

[0115] Humans express three classes of FcγRs: FcγRI (CD64), FcγRII (CD32), and FcγRIII (CD16). Human NK cells mediate ADCC solely through the Fcγ receptor CD16A (FcγRIIIA), which binds to IgG1 and IgG3. CD16A binds to the FcRγ and / or CD3ζ chains and is a potent activating receptor. CD16A binding alone triggers NK cell degranulation, while other NK cell activating receptors typically require a combination of signaling events to induce degranulation. CD16A is tightly regulated, including rapid downregulation during NK cell activation via a proteolytic process called extracellular domain shedding, primarily mediated by the membrane-associated protease ADAM17 (an integrin and metalloproteinase 17). CD16A shedding occurs in a cis-regulatory manner at specific extracellular locations near the cell membrane (see, for example, Walcheck et al., Expert Opinion on Biological Therapy, Vol. 19, No. 12, 2019).

[0116] CD16A is essentially a low-affinity FcγR, although the two allelic variants of this receptor have different binding affinities for IgG. Uncleavable CD16A refers to a natural or non-natural variant of CD16. An example of uncleavable CD16A is one with 158... V / V A mutated, high-affinity, uncleavable CD16A (SEQ ID NO.: 3) was engineered into iPSCs to generate hnCD16-iNK cells. Compared to unmodified iNK cells, hnCD16-iNK cells exhibited greater resistance to activation-induced CD16A cleavage and demonstrated enhanced antibody-dependent cytotoxicity (ADCC).

[0117] CD64 is an integrated membrane glycoprotein, known as an Fc receptor, that binds with high affinity to monomeric IgG antibodies. It is also called Fcγ receptor 1 (FcγRI) or FCRI. Upon binding to IgG, CD64 interacts with a helper chain called the common γ chain, thereby triggering cell activation. The structure of CD64 consists of a signal peptide (enabling its transport to the cell surface), three C2-type extracellular immunoglobulin domains for antibody binding, a hydrophobic transmembrane domain, and a short cytoplasmic tail. CD64 is the only high-affinity member of the FcγR family and binds the same IgG isotype as CD16A (IgG1 and IgG3), but with a >30-fold higher affinity. CD64 differs from other FcγR members in its unique third extracellular domain, which gives it high affinity and stable binding to soluble monomeric IgG. CD64 (FcγRI) is typically expressed by some myeloid cells but not by NK cells. An exemplary CD64 is shown in SEQ ID NO.: 4.

[0118] CD64 / 16A is a chimeric CD16 receptor in which the extracellular domain of CD16A is replaced by the extracellular domain of CD64, which also possesses high affinity and non-cleavable properties, thus improving ADCC function. CD64 / 16A is preferably engineered into iPSCs to construct CD64 / 16A-iNK cells because iNK cells expressing the CD64 / 16A fusion protein have higher ADCC than iNK cells expressing CD16A. An exemplary CD64 / 16A is shown in SEQ ID NO.: 5.

[0119] In some embodiments, antibodies used with the provided iNK cells or compositions containing the provided iNK cells include, but are not limited to, rituximab, vetozumab, ofudamumab, ublituximab, oxcarbazil, obituzumab, teimozumab, oligrizumab, enoxazumab, moximozumab, epazolizumab, trastuzumab, pertuzumab, alemtuzumab, cetozumab, denituzumab, avelumumab, daratumumab, iutuzumab, erlotuzumab, and one or more of their humanized or Fc-modified variants or fragments and their functional equivalents and biosimilars. In some embodiments, antibodies used with the provided iNK cells or compositions containing the provided iNK cells include rituximab. In some embodiments, antibodies used with the provided iNK cells or compositions containing the provided iNK cells include trastuzumab. The concentration of this antibody can be readily determined by those skilled in the art.

[0120] In some embodiments, the one or more exogenous target polynucleotides comprise polynucleotides encoding cytokines. Cytokines are a class of small, biologically active proteins synthesized or secreted by immune cells (e.g., monocytes, macrophages, T cells, B cells, NK cells, etc.) and certain non-immune cells (endothelial cells, epidermal cells, fibroblasts, etc.). Cytokines typically regulate cell growth, differentiation, and effector functions, and modulate immune responses by binding to their corresponding receptors. Cytokines can be classified into interleukins, interferons, the tumor necrosis factor superfamily, colony-stimulating factors, chemokines, and growth factors, among others. Examples of cytokines include, but are not limited to, ILs such as IL2, IL4, IL6, IL7, IL9, IL10, IL11, IL12, IL15, IL18, or IL21; chemokines such as CXCR2, macrophage inflammatory protein (MIP)-Iα, interferon-induced protein-10 (IP-10), RANTES, monocyte chemokine-1 (MCP-1), MCP-2, and MCP-3, and any variants or combinations thereof. In some embodiments, the cytokines include soluble cytokines. Examples of soluble cytokines include, but are not limited to, NeoIL2 (SEQ ID NO.: 6), IL15RAsu (SEQ ID NO.: 7), IL15RLI (SEQ ID NO.: 8), IL15ILR (SEQ ID NO.: 9), and IL15-TPA (SEQ ID NO.: 10). In some embodiments, the cytokines include membrane-bound cytokines. Membrane-bound counterparts are preferred over soluble cytokines because they possess self-sustaining capabilities and are safer for clinical use. Preferred examples of membrane-bound cytokines include membrane-bound IL-15 or variants thereof. More preferred examples of membrane-bound cytokines include mbIL15 (SEQ ID NO.: 11), mbIL15RLI (SEQ ID NO.: 12), and mbIL21-mbIL15 (SEQ ID NO.: 13). The most preferred example of a membrane-bound cytokine is mbIL15RLI (SEQ ID NO.: 12). For example, this strategy can confer NK cells with the function of promoting cell proliferation and / or migration.

[0121] In some embodiments, the one or more exogenous target polynucleotides comprise a polynucleotide encoding an antibody. Examples of such antibodies include, but are not limited to, anti-CD19 antibodies, anti-CD20 antibodies, anti-BCMA antibodies, and anti-PDL1 antibodies. Examples of anti-CD19 antibodies include, but are not limited to, tafaximab, loncaituximab, and tesirine-lpyl. Examples of anti-CD20 antibodies include, but are not limited to, rituximab, obbituzumab, and ofamumumab. Examples of anti-BCMA antibodies include, but are not limited to, belantatumab and SEA-BCMA. Examples of anti-PDL1 antibodies include, but are not limited to, the membrane-bound PDL1 nanobody shown in SEQ ID NO.: 79.

[0122] In some embodiments, the one or more exogenous target polynucleotides comprise a polynucleotide encoding a protein with a safety switch function (also known as a suicide gene). Examples of proteins with a safety switch function include, but are not limited to, caspase 3, 6, 7, or 9, thymidine kinase, cytosine deaminase, and any combination thereof. This strategy introduces a suicide gene to further enhance the safety and controllability of NK cells.

[0123] In some embodiments, the expression cassette also includes a linker. Two or more exogenous polynucleotides can be linked together via the linker. In some embodiments, the linker encodes a self-cleaving peptide. In some embodiments, the linker includes, but is not limited to, an internal ribosome entry sequence (IRES) or a 2A self-cleaving peptide. Examples of 2A self-cleaving peptides include, but are not limited to, F2A, E2A, P2A, and T2A.

[0124] In this disclosure, the expression cassette includes one or more promoters operatively linked to one or more exogenous target polynucleotides. A promoter is part of a gene, typically located upstream of the 5′ end of a structural gene, and is a DNA sequence that RNA polymerase recognizes, binds to, and initiates transcription. Any suitable promoter can be used for the genetically modified PSCs and iNK cells described herein. Suitable promoters include, but are not limited to, the cytomegalovirus (CMV) promoter. This promoter is a strongly constitutive promoter capable of driving high-level expression of any polynucleotide sequence operatively linked to it. Another suitable example of a promoter is elongation growth factor-1α (EF-1α). However, other promoter sequences may also be used, including, but not limited to, the ubiquitin C (UBC) promoter, the phosphoglycerate kinase (PGK) promoter, the CMV early enhancer / chicken β-actin (CAG) promoter, and the CpG-free promoter (CLP) promoter. Furthermore, the use of any promoters or variants derived from the above-described promoters is contemplated. This disclosure includes modified nucleotide sequences obtained by replacing, deleting, and / or adding one or more bases compared to the promoter sequences described above, wherein the modification still preserves the biological function of the promoter in highly efficient expression in activated NK cells. In some embodiments, this disclosure includes sequences having at least 95%, at least 97%, or at least 99% sequence identity with any of the promoter sequences described above and having a biological function that is highly expressed in activated NK cells.

[0125] In a preferred embodiment, the one or more promoters are selected from the EF1α promoter, the CMV promoter, and / or the CLP promoter. In a more preferred embodiment, the one or more promoters are selected from the EF1α promoter and / or the CMV promoter. In the most preferred embodiment, the one or more promoters are selected from the EF1α promoter.

[0126] One or more promoters are operatively linked to one or more exogenous target polynucleotides. In some embodiments, the expression cassette contains two or more exogenous polynucleotides, and all exogenous polynucleotides may be driven by a common promoter. In some embodiments, the expression cassette contains two or more exogenous polynucleotides, and these exogenous polynucleotides may be driven by different promoters, respectively.

[0127] In some implementations, the expression cassette may also include other regulatory sequences for gene expression. Examples of regulatory sequences include, but are not limited to, enhancers, poly(A) tailing signal sequences, etc.

[0128] An enhancer is a DNA sequence that increases the transcription frequency of the gene it is linked to, and enhances the transcription of downstream genes through the promoter. Effective enhancers can be located at the 5′ or 3′ end of a gene, and some can also be located within introns. Enhancers can increase the transcription frequency of a gene. Examples of enhancers include, but are not limited to, CMV enhancers, SV40 enhancers, HPV16LCR enhancers, immunoglobulin heavy chain enhancers, HACNS1 enhancers, GADD45G enhancers, hormone response elements (HREs), and metal regulatory enhancer elements (MREs).

[0129] In some implementations, the expression cassette also includes a selection marker gene for screening expression cells from a population of cells transfected with the vector. Available selection marker genes include, for example, antibiotic resistance genes such as kanamycin (Kan), neomycin (Neo), tetracycline (Ter), chloramphenicol (Cam), etc.

[0130] When an expression cassette contains a selectable marker gene, it can be linked to an exogenous polynucleotide via an adapter. Examples of adapters include, but are not limited to, IRES, F2A, E2A, P2A, and T2A.

[0131] Furthermore, the sustained or persistent amplification of engineered PSCs also affects gene silencing of transgenes. For example, with the sustained or persistent amplification of engineered PSCs, transgenes in derived iNK cells also experience severe gene silencing effects. The inventors have further discovered that gene silencing caused by the persistent amplification of engineered PSCs can be rescued by introducing a ubiquitous chromatin opening element (UCOE) upstream of one or more promoters. Therefore, the expression cassette of this disclosure also includes one or more ubiquitous chromatin opening elements (UCOEs) operatively linked to one or more promoters. Based on the above embodiments, even if engineered PSCs have been passaged multiple times (e.g., at least 10 generations) during persistent amplification, iNK cells can still stably maintain high expression of one or more exogenous target polynucleotides.

[0132] When an expression cassette contains two or more exogenous polynucleotides driven by different promoters, two or more different or identical UCOE elements can be operatively linked to these promoters respectively.

[0133] Examples of UCOEs include, but are not limited to, 1550F (SEQ ID NO.: 14), 1550R (SEQ ID NO.: 15), 1194F (SEQ ID NO.: 16), 1194R (SEQ ID NO.: 17), 458F (SEQ ID NO.: 18), 458R (SEQ ID NO.: 19), 396F (SEQ ID NO.: 20), 396R (SEQ ID NO.: 21), and SRF6-3F (SEQ ID NO.: 22). In some preferred embodiments, the UCOE comprises 1550F, 1550R, and SRF6-3F. In some more preferred embodiments, the UCOE comprises 1550F.

[0134] In some implementations, the expression cassette also includes an insulator located flanking the exogenous target polynucleotide. An insulator is a cis-regulatory element, also known as a long-range regulator. Examples of insulators include, but are not limited to, cHS4 (2 copies, SEQ ID NO.: 23).

[0135] In some embodiments, the expression cassette contains a combination of 1550F and EF1α, or a combination of 1550F and CMV. The combination of 1550F and EF1α is preferred over the combination of 1550F and CMV because it enhances the durability of the anti-silencing effect during the process of deriving iNK cells from expanded engineered PSCs. In other words, the combination of 1550F and EF1α blocks gene silencing in both iNK differentiation and subsequent iNK expansion and / or maturation, while the combination of 1550F and CMV only blocks gene silencing during iNK differentiation.

[0136] In some embodiments, the genetically modified iNK cells are immature genetically modified iNK cells. In other embodiments, the genetically modified iNK cells are mature genetically modified iNK cells. These immature and mature genetically modified iNK cells, and especially mature genetically modified iNK cells, can still have high expression levels and uniform expression of one or more exogenous target polynucleotides.

[0137] In some embodiments, even after multiple passages during persistent expansion, the genetically modified iNK cells can substantially maintain high expression levels and uniform expression of one or more exogenous target polynucleotides. In some embodiments, even after at least 3, 4, or 5 passages during persistent expansion, the genetically modified iNK cells can substantially maintain high expression levels and uniform expression of one or more exogenous target polynucleotides. In some embodiments, even after at least 6, 7, 8, or 9 passages during persistent expansion, the genetically modified iNK cells can substantially maintain high expression levels and uniform expression of one or more exogenous target polynucleotides. In some embodiments, even after at least 10, 11, 12, or 13 passages during persistent expansion, the genetically modified iNK cells can substantially maintain high expression levels and uniform expression of one or more exogenous target polynucleotides. In some implementations, even if the genetically modified PSCs have been passaged at least 14, 15, 16, 17, 18, 19 or 20 times during persistent expansion, the genetically modified iNK cells can still maintain a high level and uniformity of expression of one or more exogenous target polynucleotides.

[0138] Methods for preparing gene-modified cells

[0139] This disclosure also relates to methods and compositions for preparing the genetically modified PSCs and iNK cells described herein.

[0140] On the other hand, this article provides a method for preparing genetically modified pluripotent stem cells (PSCs), the method comprising: introducing into PSCs a construct containing a site-specific endonuclease capable of introducing double-strand breaks at a selected locus in the PSCs genome and a construct containing an expression cassette and a pair of homologous arms specific to the selected locus and located flanking the expression cassette, the expression cassette containing one or more exogenous target polynucleotides and one or more promoters operatively linked to the one or more exogenous target polynucleotides; and integrating, via homologous recombination, the expression cassette containing the one or more exogenous target polynucleotides and the one or more promoters into the selected locus in the PSCs genome by the endonuclease to obtain genetically modified PSCs, wherein the selected locus is CISH and / or Rosa26; wherein the genetically modified PSCs, compared with PSCs genetically modified under the same conditions except for integration into a locus different from CISH and / or Rosa26, are capable of differentiating into genetically modified iNK cells with higher expression levels and uniformity of the one or more exogenous target polynucleotides.

[0141] According to this method, genetically modified PSCs can differentiate into iNK cells with an efficiency of at least 90%, such as, for example, 91% or more, 92% or more, 93% or more, 94% or more, or 95% or more. In some embodiments, genetically modified PSCs can differentiate into iNK cells with an efficiency of at least 96%. In some embodiments, genetically modified PSCs can differentiate into iNK cells with an efficiency of at least 97%. In some embodiments, genetically modified PSCs can differentiate into iNK cells with an efficiency of at least 98%. In some embodiments, genetically modified PSCs can differentiate into iNK cells with an efficiency of at least 99%. In some embodiments, genetically modified PSCs can differentiate into iNK cells with an efficiency of 100%.

[0142] According to this method, the genetically modified PSCs, compared with PSCs genetically modified under the same conditions except for integration at a locus different from CISH and / or Rosa26, are capable of differentiating into genetically modified iNK cells with at least 5-fold higher expression levels of the one or more exogenous target polynucleotides. In some embodiments, the genetically modified PSCs, compared with PSCs genetically modified under the same conditions except for integration at a locus different from CISH and / or Rosa26, are capable of differentiating into genetically modified iNK cells with at least 6, 7, 8, 9, or 10-fold higher expression levels of the one or more exogenous target polynucleotides. In some embodiments, the genetically modified PSCs, compared with PSCs genetically modified under the same conditions except for integration at a locus different from CISH and / or Rosa26, are capable of differentiating into genetically modified iNK cells with at least 11, 12, 13, 14, or 15-fold higher expression levels of the one or more exogenous target polynucleotides. In some embodiments, the genetically modified PSCs are capable of differentiating into genetically modified iNK cells with at least 16, 17, 18, 19, or 20-fold higher expression levels of the one or more exogenous target polynucleotides compared to PSCs genetically modified under the same conditions except for integration into a locus different from CISH and / or Rosa26. In some embodiments, the genetically modified PSCs are capable of differentiating into genetically modified iNK cells with at least 21, 22, 23, 24, or 25-fold higher expression levels of the one or more exogenous target polynucleotides compared to PSCs genetically modified under the same conditions except for integration into a locus different from CISH and / or Rosa26. In some embodiments, the genetically modified PSCs are capable of differentiating into genetically modified iNK cells with at least 26, 27, 28, 29, or 30-fold higher expression levels of the one or more exogenous target polynucleotides compared to PSCs genetically modified under the same conditions except for integration into a locus different from CISH and / or Rosa26.

[0143] According to this method, the genetically modified PSCs, compared with PSCs genetically modified under the same conditions except for integration at a locus different from CISH and / or Rosa26, are capable of differentiating into genetically modified iNK cells with at least 1-fold higher uniformity of expression of the one or more exogenous target polynucleotides. In some embodiments, the genetically modified PSCs, compared with PSCs genetically modified under the same conditions except for integration at a locus different from CISH and / or Rosa26, are capable of differentiating into genetically modified iNK cells with at least 2-fold higher uniformity of expression of the one or more exogenous target polynucleotides. In some embodiments, the genetically modified PSCs, compared with PSCs genetically modified under the same conditions except for integration at a locus different from CISH and / or Rosa26, are capable of differentiating into genetically modified iNK cells with at least 3-fold higher uniformity of expression of the one or more exogenous target polynucleotides. In some embodiments, the genetically modified PSCs, compared with PSCs genetically modified under the same conditions except for integration at a locus different from CISH and / or Rosa26, are capable of differentiating into genetically modified iNK cells with at least 4-fold higher uniformity of expression of the one or more exogenous target polynucleotides. In some embodiments, the genetically modified PSCs, compared with PSCs genetically modified under the same conditions except for integration at a locus different from CISH and / or Rosa26, are capable of differentiating into genetically modified iNK cells with at least 5-fold higher uniformity of expression of the one or more exogenous target polynucleotides.

[0144] According to this method, genetically modified PSCs can differentiate into iNK cells with at least 90% uniformity of expression of one or more exogenous target polynucleotides, such as, for example, 91% or more, 92% or more, 93% or more, 94% or more, or 95% or more. In some embodiments, genetically modified PSCs can differentiate into iNK cells with at least 96% uniformity of expression of one or more exogenous target polynucleotides. In some embodiments, genetically modified PSCs can differentiate into iNK cells with at least 97% uniformity of expression of one or more exogenous target polynucleotides. In some embodiments, genetically modified PSCs can differentiate into iNK cells with at least 98% uniformity of expression of one or more exogenous target polynucleotides. In some embodiments, genetically modified PSCs can differentiate into iNK cells with at least 99% uniformity of expression of one or more exogenous target polynucleotides. In some embodiments, genetically modified PSCs can differentiate into iNK cells with 100% uniformity of expression of one or more exogenous target polynucleotides.

[0145] In some embodiments, the selected locus is CISH. In some embodiments, the locus different from CISH and / or Rosa26 is selected from AAVS1, CD38, and / or NKG2A. The loci CISH, Rosa26, AAVS1, CD38, and NKG2A have been described in other parts of this document (e.g., as described in the “Genetically Modified Cells” section), and for the sake of simplicity, these same descriptions are omitted here.

[0146] This method can use any PSCs. PSCs include embryonic stem cells (ESCs) and / or induced pluripotent stem cells (iPSCs). Since iPSCs represent an unlimited source of cells for cell-based therapies, iPSCs are preferred. ESCs (e.g., hESCs) and iPSCs (e.g., hiPSCs) are known in the art and are readily available using conventional methods (e.g., methods described in the prior art) or commercially available products. For example, the CytoTune iPS2.0 Sendai Virus Reprogramming Kit (ThermoFisher Scientific) can be used to reliably generate induced pluripotent stem cells (iPSCs) from somatic cells, including PBMCs and T cells.

[0147] In this disclosure, the method further includes amplifying PSCs prior to gene modification. Amplifying PSCs prior to gene modification includes passage of the PSCs during the amplification process. Techniques for amplifying and passaged PSCs are conventional techniques in the art. For example, PSCs can be cultured and amplified in E8 medium.

[0148] In genetic engineering, recombinant vectors are commonly used to deliver target genes into cells. In this disclosure, a construct containing an expression cassette with a foreign target polynucleotide is introduced using a donor vector, and a construct containing a site-specific endonuclease capable of introducing double-strand breaks (DSBs) is introduced using an editing tool vector. In some embodiments, the construct is a vector. Vectors used herein generally include, but are not limited to, plasmids, bacteriophages, animal viruses, and granules. Vectors can be expression vectors, including transient expression vectors and viral expression vectors. Vectors are preferably eukaryotic expression vectors. Viruses that can be used as vectors include, but are not limited to, retroviruses, adenoviruses, adeno-associated viruses, herpesviruses, and lentiviruses. Techniques for constructing recombinant vectors are common to those skilled in the art of genetic engineering.

[0149] As tools for site-directed integration as described herein, available endonucleases capable of introducing DSB include, but are not limited to, zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), and CRISPR-Cas nucleases.

[0150] In some embodiments, endonucleases capable of introducing double-strand breaks include ZFNs. As known to those skilled in the art, a ZFN is a site-directed endonuclease whose nuclease is fused to a zinc finger DNA-binding domain. A zinc finger is a domain of approximately 30 amino acids within the zinc finger binding domain, its structure stabilized by coordination with zinc ions. Examples of zinc fingers include, but are not limited to, C2H2, C3H, and C4 zinc fingers. An example of a ZFN is a fusion polypeptide of the FokI nuclease domain and the zinc finger DNA-binding domain.

[0151] In some implementations, endonucleases capable of introducing double-strand breaks include TALENs. TALENs are site-directed endonucleases whose nucleases are fused to the TAL effector DNA-binding domain. TAL effector proteins are secreted by plant pathogens of the genus *Xanthomonas* during infection. These proteins enter the plant cell nucleus and bind to effector-specific DNA sequences via their DNA-binding domains, activating gene transcription at those sequences via their transactivation domains. The specificity of the TAL effector DNA-binding domain depends on the effector—a variable number of incomplete 34-amino acid repeat sequences that contain polymorphisms at selected repeat positions, known as variable double residue repeats (RVDs). An example of a TALEN is a fusion polypeptide of the FokI nuclease domain and the TAL effector DNA-binding domain.

[0152] In some implementations, endonucleases capable of introducing double-strand breaks include CRISPR-Cas nucleases. The CRISPR / Cas system is a powerful technology that can be used as a gene-editing tool to selectively modify DNA sequences at any specific location in the cellular genome. CRISPR-Cas systems have been classified into two classes and six main types. One example of a CRISPR / Cas system is the CRISPR / Cas9 system. The CRISPR-Cas9 system is based on the nucleic acid degradation activity of the endonuclease protein Cas9, which is guided to the desired site in the genome via a specific cluster-determining RNA, also known as guide RNA (gRNA). In addition, another sequence located near the target site, called the protospacer neighbor motif (PAM), is recognized by the CRISPR / Cas9 system and is essential for Cas9 function. The Cas9 protein binds to the target site with high precision in the presence of gRNA and causes a double-strand break at the cleavage site. Using a pre-designed repair template, the desired gene knock-in can be achieved through homology-directed repair (HDR).

[0153] Table 1 lists examples of gRNA targeting sequences for the CISH locus.

[0154] Table 1

[0155] Exon # Target sequence SEQ ID NO PAM 2 TTCTAGACCTCGTCCTTTGC 24 TGG 3 GCACAGGTGTTGCAGGCTGC 25 GGG 3 GGGTTCCATTACGGCCAGCG 26 AGG 3 GTGGAGGAGCAGGCAGTGCT 27 GGG 2 GCCAAAGGTGCTGGACCCAG 28 AGG 1 ACATGGTCCTCTGCGTTCAG 29 GGG

[0156] Table 2 lists examples of gRNA targeting sequences at the ROSA26 locus.

[0157] Table 2

[0158] target gene symbol Exon # Target sequence SEQ ID NO PAM THUMPD3 4 GTTTAGAGTCACATGCAACA 30 GGG THUMPD3 3 TGATCTCAGACAATGAACCT 31 GGG THUMPD3 5 TTCTTACCTGAGCATCCCAT 32 AGG THUMPD3 6 GGATCGACTATTATATCATA 33 AGG THUMPD3 2 ATTGGAGCCACTGTACCTAC 34 TGG N / A N / A GGCGATGACGAGATCACGCG 35 AGG

[0159] Table 3 lists examples of gRNA targeting sequences for AAVS1.

[0160] Table 3

[0161] target gene symbol Exon # Target sequence SEQ ID NO PAM PPP1R12C 2 TGCCTCACCTGGCGATATCT 36 AGG PPP1R12C 1 GTGCAGGGCGCTGATACCGT 37 CGG PPP1R12C 3 GTCCCTAGTGGCCCCACTGT 38 GGG PPP1R12C 4 GCCAGCACCTCGTGTCATGA 39 AGG PPP1R12C 5 GGCACTGGCCCTCACCGCAT 40 GGG PPP1R12C 6 CAGGCTCAGTACTTCCTCAT 41 CGG

[0162] Table 4 lists examples of gRNA targeting sequences for the CD38 locus.

[0163] Table 4

[0164]

[0165]

[0166] Table 5 lists examples of gRNA targeting sequences for the NKG2A locus.

[0167] Table 5

[0168] Exon # Target sequence SEQ ID NO PAM 2 GGTCTGAGTAGATTACTCCT 48 TGG 7 TATTATTGAAGATCCACACT 49 GGG 5 TCCAACAGTTGTTACTACAT 50 TGG 3 GCTCCAGAGAAGCTCATTGT 51 TGG 4 TTCTAGCTACATTAATACAG 52 AGG 6 ATGGGTGACAATGAATGGTT 53 TGG

[0169] Target genes can be knocked in via homologous recombination. Homologous recombination is a form of gene recombination in which two similar DNA strands exchange genetic material. It is also known as DNA exchange. Homologous recombination occurs between two homologous DNA molecules. Techniques for designing and obtaining homologous arm sequences are generally common to those skilled in the art. Based on the principles of homologous recombination, those skilled in the art can easily determine the sequences of homologous arms according to the selected gene editing target site.

[0170] Similar to vectors used for editing tools, donor vectors are constructed to introduce constructs containing expression cassettes with exogenous target polynucleotides.

[0171] In this method, any suitable exogenous polynucleotide can be used as intended. The one or more exogenous target polynucleotides include, but are not limited to, polynucleotides encoding luciferase or fluorescent proteins, polynucleotides encoding Fc receptors, polynucleotides encoding antibodies, polynucleotides encoding cytokines, polynucleotides encoding proteins with safety switch functions, or any combination thereof.

[0172] In some embodiments, one or more exogenous target polynucleotides include a polynucleotide encoding a luciferase or a fluorescent protein. In some embodiments, the luciferase or fluorescent protein also includes a protein encoded by another reporter gene. Examples of luciferases or fluorescent proteins and other reporter genes have been described elsewhere herein (e.g., as described in the genetically modified cells herein), and for simplicity, these same descriptions are omitted herein. In some embodiments, the luciferase is Antares2 (SEQ ID NO.: 1). In some embodiments, the luciferase is GFP (SEQ ID NO.: 2).

[0173] In some embodiments, the one or more exogenous target polynucleotides include a polynucleotide encoding an Fc receptor. In some embodiments, the Fc receptor includes CD16, CD64, or variants thereof. In some embodiments, the Fc receptor includes an uncleavable CD16A, or a CD64 / 16A fusion protein comprising a CD64 extracellular domain, a CD16A transmembrane domain, and a CD16A cytoplasmic domain.

[0174] CD16, CD64, and CD64 / 16A fusion proteins have been described elsewhere in this document (e.g., as described in “Genetically Modified Cells”), and for simplicity, these same descriptions are omitted here. An exemplary CD16A is a non-cleavable CD16A, and specifically has 158... V / V A mutated, high-affinity, cleavable CD16A (SEQ ID NO.: 3). This cleavable CD16A was engineered into iPSCs to generate hnCD16-iNK cells. Compared to unmodified iNK cells, hnCD16-iNK cells were highly resistant to activation-induced CD16A cleavage and exhibited enhanced antibody-dependent cytotoxicity (ADCC). Furthermore, CD64 / 16A was preferably engineered into iPSCs to construct CD64 / 16A-iNK cells because iNK cells expressing the CD64 / 16A fusion protein had a higher ADCC than iNK cells expressing CD16A. An exemplary CD64 / 16A sequence is shown in SEQ ID NO.: 5.

[0175] In some embodiments, the one or more exogenous target polynucleotides comprise polynucleotides encoding cytokines. These cytokines have been described elsewhere herein (e.g., as described in “Genetically Modified Cells”), and for simplicity, those same descriptions are omitted here. In some embodiments, the cytokines comprise membrane-bound cytokines. In some embodiments, the cytokines comprise membrane-bound IL-15 and variants thereof. In some embodiments, the cytokines comprise the membrane-bound IL15RLI shown in SEQ ID NO.: 12.

[0176] In some embodiments, the one or more exogenous target polynucleotides include polynucleotides encoding antibodies. These antibodies have been described elsewhere in this document (e.g., as described in “Genetically Modified Cells”), and for simplicity, those same descriptions are omitted here.

[0177] In some embodiments, the one or more exogenous target polynucleotides include polynucleotides encoding proteins that have a safety switch function. These polynucleotides encoding proteins with a safety switch function have been described elsewhere in this document (e.g., as described in the “Genetically Modified Cells” section), and for simplicity, those same descriptions are omitted here.

[0178] In some embodiments, the expression box also includes a adapter. Two or more exogenous polynucleotides can be linked together through this adapter. This adapter has been described elsewhere in this document (e.g., as described in “Genetically Modified Cells”), and for simplicity, those same descriptions are omitted here.

[0179] In this method, the expression cassette contains one or more promoters. These promoters have been described elsewhere herein (e.g., as described in “Genetically Modified Cells”), and for simplicity, these same descriptions are omitted herein. In some embodiments, the one or more promoters are selected from exogenous promoters. When exogenous promoters are used, the one or more promoters are operatively linked directly to one or more exogenous target polynucleotides. In some embodiments, the one or more promoters are selected from endogenous promoters contained in a selected locus. When endogenous promoters are used, the one or more promoters are operatively linked to one or more exogenous target polynucleotides upon integration.

[0180] In a preferred embodiment, the one or more promoters are selected from EF1α promoters, CMV promoters, and / or CLP promoters. In a more preferred embodiment, the one or more promoters are selected from EF1α promoters and / or CMV promoters. In the most preferred embodiment, the one or more promoters are selected from EF1α promoters.

[0181] One or more promoters are operatively linked to one or more exogenous target polynucleotides. In some embodiments, the expression cassette contains two or more exogenous polynucleotides, and all exogenous polynucleotides may be driven by a common promoter. In some embodiments, the expression cassette contains two or more exogenous polynucleotides, and these exogenous polynucleotides may be driven by different promoters, respectively.

[0182] In some implementations, the expression cassette also includes other regulatory sequences. These other regulatory sequences have been described elsewhere in this document (e.g., as described in “Genetically Modified Cells”), and for the sake of simplicity, these same descriptions are omitted here.

[0183] The expression frame may also include a selectable marker gene and an adapter for linking the selectable marker gene to the exogenous polynucleotide. The selectable marker gene and adapter have been described elsewhere in this document (e.g., as described in the “Genetically Modified Cells” section), and for the sake of simplicity, those same descriptions are omitted here.

[0184] The expression cassette also includes one or more ubiquitin open elements (UCOEs) operatively linked to one or more promoters. Based on the above embodiments, iNK cells can stably maintain high expression of one or more exogenous target polynucleotides even after engineered PSCs have undergone multiple passages (e.g., at least 10 passages) during persistent expansion. UCOE elements have been described elsewhere in this document (e.g., as described in “Genetically Modified Cells”), and for simplicity, these same descriptions are omitted here. When the expression cassette contains two or more exogenous polynucleotides driven by different promoters, two or more different or identical UCOE elements can be operatively linked to these promoters, respectively.

[0185] In some implementations, the expression box also includes an insulator. Insulators have been described elsewhere in this document (e.g., as described in “Genetically Modified Cells”), and for simplicity, those same descriptions are omitted here.

[0186] In some embodiments, the expression cassette includes a combination of 1550F and EF1α, or a combination of 1550F and CMV. The combination of 1550F and EF1α is preferred over the combination of 1550F and CMV because this combination can improve the persistence of the anti-silencing effect during the process of deriving iNK cells from expanded engineered PSCs.

[0187] This disclosure also includes a nucleic acid construct comprising an expression frame containing one or more exogenous target polynucleotides and one or more promoters operatively linked to the one or more exogenous target polynucleotides. The nucleic acid construct may also include one or more UCOE elements operatively linked to the one or more promoters. The exogenous target polynucleotides, promoters, and other elements, including UCOE elements, have been described above.

[0188] After site-specific editing of PSCs, the genetically modified PSCs can be amplified to provide an unlimited source of cells for the preparation of engineered iNK cells as intended. Therefore, the methods disclosed herein also include amplification (e.g., serial amplification) of genetically modified PSCs. Any commonly used method for amplifying or serially amplifying PSCs can be used in the methods described herein. For example, genetically modified PSCs can be cultured and amplified in E8 medium.

[0189] In some embodiments, serially amplifying genetically modified PSCs includes passage the genetically modified PSCs multiple times during the amplification process. In some embodiments, serially amplifying genetically modified PSCs includes passage the genetically modified PSCs at least 3, 4, or 5 times during the amplification process. In some embodiments, serially amplifying genetically modified PSCs includes passage the genetically modified PSCs at least 6, 7, 8, or 9 times during the amplification process. In some embodiments, serially amplifying genetically modified PSCs includes passage the genetically modified PSCs at least 10, 11, 12, or 13 times during the amplification process. In some embodiments, serially amplifying genetically modified PSCs includes passage the genetically modified PSCs at least 14, 15, 16, 17, 18, 19, or 20 times during the amplification process.

[0190] This article also provides a method for preparing genetically modified iNK cells, comprising: preparing genetically modified PSCs according to the method for preparing genetically modified PSCs described herein, and then differentiating the genetically modified PSCs into NK cells to prepare genetically modified iNK cells, wherein the genetically modified iNK cells have a higher expression level and uniformity of the one or more exogenous target polynucleotides compared with iNK cells that are genetically modified under the same conditions except for integration into a locus different from CISH and / or Rosa26.

[0191] As a method for differentiating genetically modified PSCs into iNK cells, any method known in the art for differentiating PSCs into NK cells can be used. For example, a method may be used comprising: forming a plurality of embryoids from PSCs; adding a first differentiation medium, wherein the first differentiation medium contains a GSK3β inhibitor (e.g., CHIR99021) and at least one of a BMP signaling pathway activator (e.g., BMP4), insulin, IGF-1, VEGF, and bFGF in a basal medium; removing the first differentiation medium and adding a second differentiation medium, wherein the second differentiation medium contains VEGF, bFGF, and at least one of the following components: a BMP signaling pathway activator (e.g., BMP4), a Nodal inhibitor (e.g., SB431542), insulin, IGF-1, IL3, and IL6 in a basal medium; removing the second differentiation medium; and adding a second differentiation medium. The basal medium was refluxed and a third differentiation medium was added to obtain hematopoietic progenitor cells (PSCs). The third differentiation medium contained growth factors and colony-stimulating factors in the basal medium. The growth factors were selected from one or more of insulin, VEGF, IGF-1, and bFGF; the colony-stimulating factors were selected from one or more of TPO, SCF, and Flt-3L. The third differentiation medium was then removed and a fourth differentiation medium was added to differentiate the PSCs into NK cells. The fourth differentiation medium contained one or more colony-stimulating factors and one or more interleukins in the basal medium. The colony-stimulating factors were selected from TPO, SCF, Flt-3L, and IL-3, and the interleukins were selected from IL-2, IL-7, and IL-15. A method for differentiating PSCs into NK cells has been described in more detail in CN111235105B, the entire contents of which are incorporated herein by reference.

[0192] In some implementations, the method for preparing genetically modified iNK cells also includes expanding and maturing the genetically modified iNK cells.

[0193] As a method for amplifying and maturing genetically modified iNK cells, any method known in the art for amplifying and maturing iNK cells can be used. For example, a method can be used comprising amplifying and maturing NK cells in an amplification and maturation medium containing interleukins and substances for promoting NK cell maturation and amplification in a basal medium, wherein the interleukins are selected from one or more of IL-2, IL-12, IL-18, IL-21, IL-27, and IL-15, and the substances for promoting NK cell maturation and amplification are selected from one or more of human AB plasma, human platelet lysate, vitamin A, nicotinamide, vitamin E, and heparin, and wherein the basal medium comprises IMDM, F-12, 0.2-20 mg / ml rHSA, 0-1000 μM thioglycerol, 0-200 μg / ml ascorbic acid, 1-50 μg / ml transferrin, 1-50 ng / ml sodium selenite, and 5-100 μM ethanolamine. Methods for expanding and maturing iNK cells have been described in more detail in CN111235105B, the entire contents of which are incorporated herein by reference.

[0194] According to this disclosure, methods for preparing genetically modified iNK cells can provide genetically modified iNK cells with high cell purity or proportion (expressed as CD56+ cell percentage or CD56+%). In some embodiments, the methods for preparing genetically modified iNK cells can provide genetically modified iNK cells with a purity of at least 90%, such as, for example, 91% or more, 92% or more, 93% or more, 94% or more, or 95% or more. In some embodiments, the methods for preparing genetically modified iNK cells can provide genetically modified iNK cells with a purity of at least 96%. In some embodiments, the methods for preparing genetically modified iNK cells can provide genetically modified iNK cells with a purity of at least 97%. In some embodiments, the methods for preparing genetically modified iNK cells can provide genetically modified iNK cells with a purity of at least 98%. In some embodiments, the methods for preparing genetically modified iNK cells can provide genetically modified iNK cells with a purity of at least 99%. In some embodiments, the methods for preparing genetically modified iNK cells can provide genetically modified iNK cells with a purity of 100%.

[0195] Genetically modified iNK cells can be isolated before use. Isolation methods are commonly used in the art, including, for example, cell sorting and centrifugation.

[0196] Composition

[0197] This disclosure also relates to cell populations or compositions comprising genetically modified PSCs or iNK cells. In some embodiments, this disclosure provides cell populations or compositions comprising the genetically modified PSCs or iNK cells described herein. In some embodiments, this disclosure provides cell populations or compositions comprising cells produced by any of the preparation methods described herein.

[0198] This article also provides pharmaceutical compositions comprising the genetically modified PSCs or iNK cells described herein and one or more pharmaceutically acceptable carriers. The amount of cells used in the pharmaceutical composition that are effective in treating a specific condition or disease may depend on the nature of the condition or disease and can be determined using standard clinical techniques.

[0199] Pharmaceutical carriers are well known in the art. Exemplary pharmaceutical carriers are sterile aqueous solutions that contain no substances other than the active ingredient and water, or contain buffers (e.g., sodium phosphate at physiological pH), physiological saline, or both (e.g., phosphate-buffered saline). Furthermore, aqueous carriers may contain more than one buffer salt, as well as salts (e.g., sodium chloride and potassium chloride), glucose, polyethylene glycol, and other solutes. Liquid compositions may also contain a liquid phase other than water. Examples of such additional liquid phases include glycerol, vegetable oils (e.g., cottonseed oil), and water-oil emulsions. The amount of cell population used in a pharmaceutical composition that is effective in treating a specific disease or condition may depend on the nature of the disease or condition and can be determined using standard clinical techniques.

[0200] Methods for formulating suitable pharmaceutical compositions are known in the art (see, for example, Remington: The Science and Practice of Pharmacy, 21st edition, 2005; and Drugs and the Pharmaceutical Sciences: a Series of Textbooks and Monographs (Dekker, NY)). For example, solutions or suspensions intended for parenteral, intradermal, or subcutaneous application may include the following components: sterile diluents, such as water for injection, saline solution, non-volatile oils, polyethylene glycol, glycerol, propylene glycol, or other synthetic solvents; antimicrobial agents, such as benzyl alcohol or methylparaben; antioxidants, such as ascorbic acid or sodium bisulfite; chelating agents, such as ethylenediaminetetraacetic acid; buffers, such as acetates, citrates, or phosphates; and agents for adjusting tension, such as sodium chloride or glucose. pH may be adjusted with acids or bases, such as hydrochloric acid or sodium hydroxide. Parenteral preparations can be packaged in ampoules, disposable syringes, or multi-dose vials made of glass or plastic.

[0201] Administration methods include, but are not limited to, injection and infusion. In some embodiments, injection includes, but is not limited to, intravenous, intrathecal, intraperitoneal, intraspinal, intracerebrospinal, and intrasternal infusion. In some embodiments, the route is intravenous. In some embodiments, the cells described herein are administered as a bolus or by continuous infusion over a period of time (e.g., intravenous infusion). In some embodiments, the cells described herein are administered in several doses over a period of time (e.g., several infusions over a period of time). The cells described herein can be administered as a single dose or in 2, 3, 4, 5, 6, or more doses (or infusions).

[0202] application

[0203] This article also provides information on the use of genetically modified PSCs or their derivatives, such as iNK cells, disclosed herein in the preparation of drugs for the treatment or prevention of tumors such as cancer, autoimmune diseases, infections, or blood disorders.

[0204] This article also provides a method for treating or preventing cancer, including administering a cell population, cell composition, or pharmaceutical composition as described herein to a subject in need.

[0205] By administering the cell populations or pharmaceutical compositions disclosed herein to subjects in need, a variety of cancers can be treated or prevented.

[0206] Examples of cancers include, but are not limited to, adrenal cancer, bladder cancer, leukemia, bone cancer, brain cancer, breast cancer, carcinoma, cervical cancer, colon cancer, colorectal cancer, endometrial cancer, ear, nose, and throat (ENT) cancer, endometrial cancer, esophageal cancer, gastrointestinal cancer, head and neck cancer, Hodgkin's disease, colon cancer, kidney cancer, laryngeal cancer, leukemia, liver cancer, lymph node cancer, lymphoma, mesothelioma, myeloma, nasopharyngeal carcinoma, neuroblastoma, non-Hodgkin's lymphoma, oral cancer, pancreatic cancer, penile cancer, pharyngeal cancer, prostate cancer, rectal cancer, sarcoma, seminoma, skin cancer, stomach cancer, teratoma, testicular cancer, thyroid cancer, uterine cancer, vaginal cancer, vascular tumors, chronic myeloid leukemia, acute myeloid leukemia, myelomonocytic leukemia, melanoma, large cell lung cancer, ovarian cancer, non-small cell lung cancer or small cell lung cancer and their metastases.

[0207] General Method

[0208] In practicing this disclosure, many conventional techniques from molecular biology, protein biochemistry, cell biology, microbiology, and recombinant DNA were used. See, for example, Sambrook and Russell, eds., (2001) Molecular Cloning: A Laboratory Manual, 3rd edition; Ausubel et al., eds., (2007) Current Protocols in Molecular Biology series; Methods in Enzymology series (Academic Press, Inc.).NY); MacPherson et al., (1991) PCR 1: A Practical Approach (Oxford University Press, IRL); MacPherson et al., (1995) PCR 2: A Practical Approach; Harlow and Lane (eds.), (1999) Antibodies, A Laboratory Manual; Freshney, (2005) Culture of Animal Cells: A Manual of Basic Technique, 5th Edition; Gait (ed.), (1984) Oligonucleotide Synthesis; US Patent No. 4,683,195; Hames and Higgins (eds.), (1984) Nucleic Acid Hybridization; Anderson, (1999) Nucleic Acid Hybridization Hybridization); Hames and Higgins, eds., (1984) Transcription and Translation; Immobilized Cells and Enzymes, (IRL Press (1986)); Perbal, (1984) A Practical Guide to Molecular Cloning; Miller and Calos, eds., (1987) Gene Transfer Vectors for Mammalian Cells (Cold Spring Harbor Laboratory); Makrides, eds., (2003) Gene Transfer and Expression in Mammalian Cells; Mayer and Walker, eds., (1987) Immunochemical Methods in Cell and Molecular Biology (Academic Press, London); and Herzenberg et al., eds., (1996) Weir's Handbook of Experimental Immunology. .

[0209] It should be understood that any aspect or implementation of this disclosure described herein, including aspects or implementations described only in the examples or claims, may be combined with any one or more other aspects and / or implementations of this disclosure, unless such combination is inappropriate or expressly waived. Example

[0210] 1. Materials

[0211] All commonly used reagents and instruments used throughout the embodiments of this disclosure are commercially available. The sources of some reagents and instruments have been described elsewhere in this document.

[0212] Example 1

[0213] This embodiment was implemented to demonstrate that the Rosa26 and CISH loci are significantly superior to other target loci in engineering hiPSC and iNK cells.

[0214] hiPSCs were prepared according to the schemes in Examples 3 and 4 of Patent No. CN1 08373998B. The hiPSCs were cultured and amplified in E8 medium (Nuwacell Co., Ltd., China). Then, as... Figure 1 As shown, hiPSCs were engineered at different loci to express Antares2-P2A-Neo. All procedures were identical except for targeting different loci. The following steps describe the details of knocking Antares2 into the selected loci (Rosa26, CISH, AAVS1, CD38, or NKG2A).

[0215] Using a donor vector and a Cas / gRNA vector, the target gene Antares2 (SEQ ID NO.: 1) was knocked into a selected locus in the hiPSC genome. To construct the Cas / gRNA vector, a U6 promoter-gRNA-Locus-gRNA chimeric fragment was synthesized by GenScript Inc. (China) and ligated to the KpnI / NotI site of a Cas-Template vector (Nuwacell Ltd.) using a T4 ligase (NEBM0202) according to the manufacturer's instructions. The constructed Cas / gRNA vector contained pUC ori, a U6 promoter, gRNA-Locus (e.g., gRNA-CISH), a gRNA chimeric fragment (SEQ ID NO.: 65), an EF1α promoter, the Cas9 gene, a P2A adapter, a neomycin resistance marker, a BGHpAPoly(A) signal, and a kanamycin resistance marker. The Cas / gRNA vector, the target sequence gRNA-Locus, and their corresponding positions at each locus are shown in Table 6 below.

[0216] Table 6

[0217]

[0218] To construct the donor vector, gRNA-5′-terminal homologous arm and 3′-terminal homologous arm-gRNA were synthesized by GenScript (China) and ligated to the NheI / ClaI and EcoRI / BamHI sites of the pKI-Antares2 vector (SEQ ID NO.: 54) (Nuwacell Co., Ltd., China) using T4 ligase (NEB M0202) according to the manual instructions to obtain the donor vector. The constructed donor vector contains pUC ori, 5′-terminal homologous arm, EF1α promoter, Antares2, P2A linker, neomycin resistance marker, BGHpAPolyA signal, 3′-terminal homologous arm, and kanamycin resistance marker. The homologous arms used for each locus and the donor vector are shown in Table 7 below.

[0219] Table 7

[0220] donor carrier 5'-Homologous Arm 3'-Homologous Arm Target loci pKI-Antares2-Rosa26 SEQ ID NO.: 55 SEQ ID NO.: 56 Rosa26 pKI-Antares2-CISH SEQ ID NO.: 57 SEQ ID NO.: 58 CISH pKI-Antares2-AAVS1 SEQ ID NO.: 59 SEQ ID NO.: 60 AAVS1 pKI-Antares2-CD38 SEQ ID NO.: 61 SEQ ID NO.: 62 CD38 pKI-Antares2-NKG2A SEQ ID NO.: 63 SEQ ID NO.: 64 NKG2A

[0221] 2 μg of donor vector and 2 μg of Cas / gRNA vector were transfected into 2 × 10⁶ cells using Nucleofector 2b (Lonza Inc.). 6 hiPSCs. The transfected hiPSCs were then processed at a rate of 2 × 10⁻⁶. 4 cells / cm 2 Cells were seeded at a density suitable for their growth on six-well plates and selected with 1 μg / mL puromycin for 1-2 days. After 5-7 days of growth, hiPSC single clones were picked and transferred to 48-well plates, then further expanded in E8 medium (Nuwacell Ltd.) to six-well plates to obtain sufficient cell numbers for further selection. HiPSCs from single clones were collected, digested into single cells, and Antares2 expression was analyzed by flow cytometry by recording fluorescence collected through the PerCP-Cy5.5 channel.

[0222] First, nested PCR testing was performed using... Using Pfx DNA polymerase (ThermoFisherScientific), positive clones with the Antares2 sequence correctly inserted into the selected locus in the genome were screened according to the manual instructions. Nested PCR detection was performed by amplifying the 5′ and 3′ linker sequences between the inserted sequence and the surrounding genomic target locus in the hiPSC genome. Based on PCR detection, it was confirmed that the clone had engineered two alleles at the desired locus.

[0223] Potential positive clones screened by PCR were sequenced by Beijing Qingke Biotechnology Co., Ltd., China, to further confirm insertion correctness. Positive clones with correct insertion were subjected to karyotype analysis by Guangzhou KingMed Diagnostics Center Co., Ltd. (China) to rule out chromosomal abnormalities. Ultimately, the "EF1α-Antares2-P2A-Neo" expression cassette was successfully inserted into the target site at the selected locus (e.g., Figure 1 (As shown).

[0224] The first-generation engineered hiPSCs, confirmed as first generation, were named P1 (first generation). Following the protocol of Example 1 in Chinese Patent CN111235105B, P1 generation hiPSCs were differentiated into iNK cells. On day 24 of differentiation (D24), iNK cells were collected and stained with anti-CD56-PE antibody (BD, 556647). The percentage of CD56+ iNK cells was detected by flow cytometry. Figure 2A ).

[0225] like Figure 2A As shown, the differentiation efficiency of hiPSCs with Antares2 integrated at the CISH locus was 95.35%, while that of hiPSCs with Antares2 integrated at the Rosa26 locus was 99.44%, both similar to the 86.68% of wild-type (WT) hiPSCs. As controls, the differentiation efficiencies of hiPSCs with Antares2 integrated at the AAVS1, CD38, or NKG2A loci were 77.38%, 82.81%, and 76.78%, respectively. This indicates that neither CISH nor Rosa26 affects the differentiation efficiency of hiPSCs into iNK cells.

[0226] Using the luciferin-luciferase bioluminescence assay kit ( The expression level of Antares2 in engineered hiPSC and D24 iNK cells was measured using a single-luciferase (Firefly) reporter gene assay kit (Transgen (China), Cat.#FR101-01) according to the manual instructions. Results are as follows: Figure 2B As shown. The expression of Antares2 in hiPSC and D24 iNK cells was analyzed by flow cytometry. Figure 2C ).

[0227] like Figure 2B and 2C As shown, among all loci, the expression level and uniformity of Antares2 integrated at the Rosa26 locus are highest in hiPSC (Antares2). + Cells (95.69%) and iNK cells (Antares2) +The expression of Antares2, integrated into the CISH locus, was highest in all cells (98.19%). Among all the loci shown, CISH was unique because Antares2 expression was silenced in pluripotent cells but restored upon differentiation into iNK cells. + The percentage of cells was 90.08%. After differentiation into iNK cells, except for CISH and Rosa26, the expression levels and homogeneity of Antares2 at all loci were much lower (Antares2). + The percentage of cells (approximately 30%) and homogeneity (approximately 1 / 3) indicates that gene expression at these loci was silenced or reduced. This suggests that different loci significantly influence the expression levels and activity of transgenes in pluripotent and ultimately differentiated cells.

[0228] Example 2-3

[0229] This embodiment is implemented to optimize expression cassettes containing different forms of cytokines and CD16 for NK cells randomly integrated via the PiggyBac transposon. The optimized forms of cytokines and CD16 will be used in engineered hiPSCs and iNK cells.

[0230] Example 2

[0231] The NK92 cell line was used as an example of NK cells. The NK92 cell line was purchased from Procell Inc. (China) and cultured according to the manual. The expression cassettes shown in Table 8 were synthesized by GenScript (China) and ligated to the XbaI / BamHI sites of the PB-PNEE vector (SEQ ID NO.: 66) (Nuwacell Co., Ltd., China) using T4 ligase (NEB M0202) according to the manual. The CD16A used here is a high-affinity, non-cleavable CD16 with 158... V / V Mutation (SEQ ID NO.: 3).

[0232] Table 8

[0233] serial number expression carrier Expression box sequence 1 pPB-PNEE-CD16A-T2A-NeoIL2 CD16A-T2A-NeoIL2 (SEQ ID NO.: 67) 2 pPB-PNEE-CD16A-T2A-IL15RAsu CD16A-T2A-IL15RAsu (SEQ ID NO.: 68) 3 pPB-PNEE-CD16A-T2A-IL15RLI CD16A-T2A-IL15RLI (SEQ ID NO.: 69) 4 pPB-PNEE-CD16A-T2A-IL15ILR CD16A-T2A-IL15ILR (SEQ ID NO.: 70) 5 pPB-PNEE-CD16A-T2A-IL15-TPA CD16A-T2A-IL15-TPA (SEQ ID NO.: 71) 6 pPB-PNEE-CD16A-T2A-mbIL15 CD16A-T2A-mbIL15 (SEQ ID NO.: 72) 7 pPB-PNEE-CD16A-T2A-mbIL15RLI CD16A-T2A-mbIL15RLI (SEQ ID NO.: 73) 8 pPB-PNEE-CD16A-T2A-mbIL21-mbIL15 CD16A-T2A-mbIL21-mbIL15 (SEQ ID NO.: 74)

[0234] Transfect 7.5 × 10⁷ cells with 3 μg expression vector and 3 μg PB transposase vector (Nuwacell Co., Ltd., China). 6NK92 cells. Cells were selected and transfected with 750 μg / mL neomycin for approximately two weeks. NK92 cells stably overexpressing the expression cassette shown were cultured for 7 days in NK92 medium (Pronosei Biotechnology Co., Ltd., Wuhan, China, #CM-0530) with or without IL-15. The total cell count was performed on day 7 using a Vicell counter (Beckman). NK92 cells were stained with CD16-APC antibody (APC anti-human CD16 antibody, Biolegend Cat#302012), and CD16 was analyzed by flow cytometry. + Cell percentage ( Figures 3A-3B ).

[0235] Comparison of CD16 with and without IL-15 + The percentage of cells showing preferential expansion was only observed in NK92 cells expressing membrane-bound IL15 analogs (#6, #7, and #8), indicating that membrane-bound cytokines are self-sustaining and should be safer in clinical applications. Figure 3A In #6, #7, and #8, comparing the total cell number in the presence and absence of IL-15, only NK92 cells expressing mbIL15RLI (#7) maintained the best cell proliferation in the presence of IL-15, while #6 and #8 appeared to show an inhibitory effect on proliferation despite the presence of exogenous IL-15. Figure 3B ).

[0236] Example 3

[0237] The expression cassettes shown in Table 9 were synthesized by GenScript (China) and ligated to the XbaI / BamHI sites of the PB-PNEE vector (Nuwacell Co., Ltd., China) using T4 ligase (NEBM0202) according to the manual instructions. The CD16A used here is a high-affinity, non-cleavable CD16 with 158... V / V Mutation. The CD64 / 16A used here is a chimeric CD16A receptor in which the extracellular domain of CD16A is replaced by the extracellular domain of CD64, which also has high affinity and non-cleavable properties.

[0238] Table 9

[0239] serial number expression carrier Expression box sequence 1 pPB-PNEE-CD16A-T2A-NeoIL2 CD16A-T2A-NeoIL2 (SEQ ID NO.: 67) 2 pPB-PNEE-CD16A-T2A-IL15-TPA CD16A-T2A-IL15-TPA (SEQ ID NO.: 71) 3 pPB-PNEE-CD16A-T2A-IL15RLI CD16A-T2A-IL15RLI (SEQ ID NO.: 69) 4 pPB-PNEE-CD16A-T2A-mbIL15RLI CD16A-T2A-mbIL15RLI (SEQ ID NO.: 73) 5 pPB-PNEE-CD64 / 16A-T2A-NeoIL2 CD64 / 16A-T2A-NeoIL2 (SEQ ID NO.: 75) 6 pPB-PNEE-CD64 / 16A-T2A-IL15-TPA CD64 / 16A-T2A-IL15-TPA (SEQ ID NO.: 76) 7 pPB-PNEE-CD64 / 16A-T2A-IL15RLI CD64 / 16A-T2A-IL15RLI (SEQ ID NO.: 77) 8 pPB-PNEE-CD64 / 16A-T2A-mbIL15RLI CD64 / 16A-T2A-mbIL15RLI (SEQ ID NO.: 78)

[0240] Transfected 7.5 × 10⁷ cells with 3 μg expression vector and 3 μg PB transposase vector (Nuwacell Co., Ltd., China). 6 NK92 cells. Cells were selected and transfected with 750 μg / mL neomycin for approximately two weeks. The expression of CD16 or CD64 in transfected NK92 cells was analyzed by flow cytometry. Figure 3C To detect CD16 expression, randomly integrated NK92 cells were stained with CD16 antibody (APC anti-human CD16 antibody, Biolegend Cat#302012), and CD16 expression was analyzed by flow cytometry. + Percentage of cells. For CD64 expression detection, randomly integrated NK92 cells were stained with CD64-APC antibody (APC anti-human CD64 antibody Biolegend, Cat#305014), and CD64 expression was analyzed by flow cytometry. + Percentage of cells. For example... Figure 3C As shown, all randomly integrated NK92 cells exhibited high uniformity in the expression of inserted genes.

[0241] ADCC function of randomly integrated NK92 cells was measured. ADCC assays were performed according to the method described in the literature (Dall'Ozzo S, Tartas S, Paintaud G, et al., Rituximab-dependent cytotoxicity by natural killer cells: influence of FCGR3). After incubating randomly integrated NK92 cells with increased concentrations of trastuzumab (Roche) for 4 hours, the specific cytotoxicity of randomly integrated NK92 cells against SK-OV-3 cells (a HER2-expressing ovarian cell line) was measured. Figure 3D After incubating randomly integrated NK92 cells with increased concentrations of rituximab (Roche) for 4 hours, the specific cytotoxicity of the randomly integrated NK92 cells against Raji cells (a CD20-expressing Burkitt lymphoma cell line) was measured. Figure 3E Comparing the ADCC function of randomly integrated NK92 cells expressing different forms of CD16, NK92 cells expressing CD16A were significantly superior to wild-type (WT) NK92 cells, and NK92 cells expressing CD64 / 16A were significantly superior to NK92 cells expressing 16A. Figure 3D and 3E In particular, NK92 cells co-expressing CD64 / 16A and mbIL15RLI(#8) exhibited the best ADCC function.

[0242] Example 4

[0243] This embodiment is implemented to demonstrate the effects of different promoters on transgene expression in engineered hiPSC and iNK cells.

[0244] hiPSCs were cultured and amplified in E8 medium (Nuwacell Ltd., China). Using a method similar to that in Example 1, GFP driven by the EF1α, CMV, or CLP promoter was knocked into the CISH locus of hiPSCs. The first-generation confirmed engineered hiPSCs were named P1 (generation 1), and then differentiated into iNK cells according to the protocol of Example 1 in Chinese Patent CN111235105B. On day 31 of differentiation, iNK cells were collected and stained with PE-labeled anti-CD56 antibody (BD, 556647). The expression levels and homogeneity of GFP in engineered hiPSCs and iNK cells were analyzed by flow cytometry, and CD56 expression was detected by flow cytometry. + Percentage of NK cells ( Figure 4 ).

[0245] like Figure 4 As shown, all promoters supported high expression of the inserted GFP during NK cell differentiation, with CMV and CLP promoters being superior to EF1α. Furthermore, all engineered hiPSCs using these promoters differentiated into NK cells with a high efficiency of 99% or higher.

[0246] Example 5

[0247] This embodiment was implemented to demonstrate reduced transgene expression in iNK cells derived from engineered hiPSCs after sustained expansion.

[0248] hiPSCs were cultured and amplified in E8 medium (Nuwacell Ltd., China). Using a method similar to that in Example 1, CD64 / 16A-T2A-mbIL15RLI (Example 3, Table 9, #8), driven by the EF1α promoter, was knocked into the CISH locus of hiPSCs. First-generation confirmed CISH... - / - CD64 / 16A knock-in hiPSCs were named P1 (generation 1). P1 hiPSCs were amplified in E8 medium (Nuwacell Ltd.) and passaged more than 10 times. Subsequently, P1, P5, and P12 hiPSCs were differentiated into iNK cells using a method similar to that in Example 1. On day 24 of differentiation, NK cells were collected and stained with PE-labeled anti-CD56 antibody (BD, 556647). The percentage of CD56+ NK cells was detected by flow cytometry. The expression of CD64 / 16A and the number of iNK cells were analyzed by flow cytometry. Figure 5 ).

[0249] like Figure 5As shown, 79.28% of iNK cells differentiated from P1 generation engineered hiPSCs expressed CD64 / 16A, 65.82% of iNK cells differentiated from P5 generation engineered hiPSCs expressed CD64 / 16A, while only 37.24% of iNK cells differentiated from P12 generation engineered hiPSCs expressed CD64 / 16A, indicating that CD64 / 16A is gradually silenced or its expression decreases with the sustained expansion of engineered hiPSCs. However, the efficiency of differentiation into iNK cells was not significantly affected by the sustained expansion of engineered hiPSCs.

[0250] Examples 6-8

[0251] This embodiment is implemented to demonstrate the effects of various anti-silencing elements on randomly integrated hiPSC cells.

[0252] Example 6

[0253] Different versions of UCOE elements (1550F (SEQ ID NO.: 14), 1550R (SEQ ID NO.: 15), 1194F (SEQ ID NO.: 16), 1194R (SEQ ID NO.: 17), 458F (SEQ ID NO.: 18), 458R (SEQ ID NO.: 19), 396F (SEQ ID NO.: 20), and 396R (SEQ ID NO.: 21), where F represents forward and R represents reverse) and mb PDL1 Nb (membrane-bound PDL1 nanobody, as shown in SEQ ID NO.: 79) were synthesized by GenScript (China). Following the manual instructions, these elements were ligated to the XbaI / BamHI and NotI / ClaI sites of the PB-PNEE vector (Nuwacell Co., Ltd., China) to obtain recombinant vectors. For convenient detection of nanobody expression, Strep tag II was ligated to mb PDL1 Nb.

[0254] hiPSC cells were transfected with 3 μg of any of the above recombinant vectors and 3 μg of PB transposase vector (Nuwacell Ltd., China). mb PDL1 Nb, driven by an EF1α promoter with or without different versions of the UCOE element, was randomly inserted into hiPSCs via the PiggyBac transposon. HiPSCs stably overexpressing mb PDL1 Nb were continuously amplified for 5 passages in E8 medium (Nuwacell Ltd.). Cells were collected at each passage and stained with Strep tag II antibody (LSBio, Cat#LS-C203631). The percentage of cells expressing mb PDL1 Nb was analyzed by flow cytometry. Figure 6A ).

[0255] like Figure 6A As shown, compared with the control without any UCOE element, the UCOE element can enhance the expression of nanobodies in each generation of amplified hiPSCs. The length and orientation of the UCOE element affect the anti-silencing effect, with the largest and most orthogonal 1550F element showing the best silencing effect. However, during continuous amplification and passaging of randomly integrated hiPSCs, gene expression still gradually decreased despite the presence of 1550F, indicating that UCOE cannot completely prevent nanobodies from silencing with persistent amplification of randomly integrated hiPSCs.

[0256] Example 7

[0257] 1550F, SRF6-3F (SEQ ID NO.: 22), and mb PDL1 Nb were synthesized by GenScript (China), and mb PDL1 Nb driven by the EF1α promoter of 1550F or SRF6-3F was randomly inserted into hiPSCs using a similar method. hiPSCs overexpressing mb PDL1 Nb were continuously amplified for 5 passages in E8 medium (Nuwacell Ltd.). Cells were collected at each passage, and the expression of mb PDL1 Nb was analyzed by flow cytometry. Figure 6B ).

[0258] exist Figure 6B In the comparison between SRF6-3F and 1550F, no further improvement in expression stability was found.

[0259] Example 8

[0260] The cHS4 insulator was synthesized by GenScript (China) and, according to the manual, ligated to the NotI / ClaI and HindIII / NdeI sites of the PB-PNEE vector (Nuwacell Co., Ltd., China) using T4 ligase (NEBM0202) to obtain the recombinant vector. For easy detection of nanobody expression, a Strep tag II was ligated to the mb PDL1 Nb.

[0261] hiPSC cells were transfected with 3 μg of any of the above recombinant vectors and 3 μg of PB transposase vector (Nuwacell Ltd., China). mb PDL1 Nb, driven by an EF1α promoter with or without the cHS4 insulator, was randomly inserted into hiPSC cells via a PiggyBac transposon. Stably transfected hiPSC cells were continuously expanded in E8 medium (Nuwacell Ltd.) for 10 days. On days 3, 6, and 10, transfected hiPSCs were collected, and the expression of mb PDL1 Nb was analyzed by flow cytometry. Figure 6C ).

[0262] like Figure 6C As shown, comparing the expression of nanobodies in the presence and absence of cHS4 insulators, cHS4 insulators could not rescue the silencing or reduced expression of mb PDL1 Nb with the persistent amplification of randomly integrated hiPSCs.

[0263] Example 9

[0264] This embodiment is implemented to demonstrate the combined effects of different promoters and UCOE elements in randomly integrated iNK cells.

[0265] hiPSCs were prepared according to the protocols described in Examples 3 and 4 of Chinese Patent No. CN108373998B and differentiated into iNK cells according to the protocol of Example 1 of Chinese Patent No. CN111235105B. Using a method similar to Example 2, GFP driven by different promoters (EF1α and CMV) with or without the 1550 FUCOE element was randomly inserted into iNK cells via the PiggyBac transposon. The cells were amplified using feeder cells (The Life Ark Inc., China, #ZY-NKZ-0104) (referring to the protocol of Example 1 of Chinese Patent No. CN111235105B), and after drug screening with 750 μg / mL neomycin, randomly integrated iNK cells were collected, and GFP expression was analyzed by flow cytometry. Figures 7A-7B ).

[0266] like Figures 7A-7B As shown, GFP expression remained relatively stable in iNK cells driven by both the CMV promoter with and without the UCOE element and the EF1α promoter, indicating that gene silencing did not occur during gene modification in the final differentiated cell type. Compared to the EF1α promoter, the CMV promoter drove higher levels of transgene expression with and without the UCOE element. The combination of the UCOE and CMV promoters increased GFP expression levels while maintaining its uniformity, while the combination of the UCOE and EF1α promoters decreased GFP expression levels while maintaining its uniformity. These data suggest that the UCOE-CMV promoter is a more effective driver of transgene expression in randomly integrated iNK cells.

[0267] Example 10

[0268] This embodiment is implemented to demonstrate the anti-silencing effect of the UCOE element on engineered iNK cells.

[0269] CD64 / 16A-T2A-mbIL 15RLI driven by EF1α, with or without the 1550F UCOE element (Example 3, Table 9, #8), was knocked into the CISH locus of hiPSCs using a method similar to that in Example 1. The first-generation confirmed engineered hiPSCs were named P1 (Generation 1). The cloned hiPSCs were amplified and passaged more than 10 times in E8 medium (Nuwacell Ltd.). Then, the hiPSCs P1, P12, and P15 were differentiated into iNK cells (“EF1α” for P1 and P12, “UCOE-EF1α” for P1 and P15, respectively). CD64 expression in iNK cells differentiated from engineered hiPSCs at different passages was analyzed by flow cytometry. Figure 8 ).

[0270] like Figure 8 As shown, using the EF 1α promoter without the 1550F UCOE element, 96.93% of iNK cells differentiated from P1 generation engineered hiPSCs expressed CD64 / 16A, while only 35.63% expressed CD64 / 16A when differentiated from P12 generation engineered hiPSCs. This indicates that engineered hiPSCs may lead to severe gene silencing or decreased expression after persistent expansion. However, using the EF1α promoter combined with the 1550F UCOE element, even after hiPSCs have been expanded and passaged for 15 generations, iNK cells can still stably maintain high CD64 / 16A expression (>90%), indicating that the UCOE element can rescue gene silencing in iNK cells caused by persistent expansion of engineered hiPSCs.

[0271] Example 11

[0272] This embodiment was implemented to demonstrate the combined effects of different promoters and UCOE elements on immature and mature engineered iNK cells.

[0273] CD64 / 16A-T2A-mbIL15RLI (Example 3, Table 9, #8), driven by different promoters (EF1α and CMV) combined with the 1550F UCOE element, was knocked into the CISH locus of hiPSCs using a method similar to that of Example 1. The first-generation confirmed engineered hiPSC was named P1 (Generation 1). Then, following the protocol of Example 1 in Chinese Patent CN111235105B, the hiPSCs of P1 were differentiated for 24 days to obtain immature iNK cells (D24 iNK cells). Following the manual instructions, the D24 iNK cells were further expanded and matured using feeder cells (The Life Ark Inc., China, #ZY-NKZ-0104) for 8 days (following the protocol of Chinese Patent CN111235105B) to obtain mature iNK cells (D32 iNK cells). Flow cytometry was used to analyze the expression of CD64 in engineered hiPSCs and iNK cells, specifically D24 iNK cells and D32 iNK cells. Figure 9 ).

[0274] like Figure 9 As shown, both the EF1α-1550F and CMV-1550F combinations silenced CD64 / 16A expression in engineered hiPSCs. However, on day 24 of iNK differentiation (when cells were still immature), there was no significant difference in CD64 / 16A expression between the two combinations. However, when these immature iNK cells further expanded and matured into mature iNK cells, a significant difference emerged between the two combinations. The 1550F / EF1α combination effectively rescued severe gene silencing in mature iNK cells, while the 1550F / CMV combination could not.

[0275] Example 12

[0276] This embodiment was implemented to demonstrate the knock-in of CD16A and mbIL15RLI at the Rosa26 locus in hiPSC and iNK cells.

[0277] Using a method similar to Example 1, CD16A-T2A-mbIL15RLI (Example 2, Table 8, #7) driven by the EF1α promoter was knocked into the Rosa26 locus of hiPSCs. The first-generation confirmed engineered hiPSCs were named P1 (Generation 1). Following the protocol of Example 1 in Chinese Patent CN111235105B, the hiPSCs of P1 were differentiated into iNK cells. The expression of CD16A in the engineered hiPSCs was measured by flow cytometry. Figure 10AiNK cells were collected on day 24 and then co-cultured with feeder cells (The Life Ark Inc., China, #ZY-NKZ-0104) for 9 days according to the manual instructions to further mature and expand them (referring to the protocol of Chinese Patent No. CN111235105B). iNK cells were collected on day 32 and simultaneously stained with anti-CD16 antibody (APC anti-human CD16 antibody, Biolegend Cat#302012) and anti-CD56 antibody (BD, 556647) for flow cytometry analysis. Results are as follows: Figure 10B As shown.

[0278] Figure 10A The results showed that CD64 / 16A and mbIL15RLI were highly co-expressed in engineered hiPSCs. Figure 10B The results showed that most of the expanded engineered iNK cells (90.25%) were double positive for both CD16 and CD56, while only 31.05% of wild-type iNK cells were double positive, indicating that the gene editing method is safe and allows for high expression of the transgene.

[0279] It will be readily understood by those skilled in the art that the methods, compositions, and products described herein are merely representative of exemplary embodiments and are not intended to limit the scope of this disclosure. It will be apparent to those skilled in the art that various substitutions and modifications can be made to the content disclosed herein without departing from the scope and spirit of this disclosure.

[0280] All patents and publications mentioned in this specification demonstrate the skill of a person skilled in the art to which this disclosure pertains. All patents and publications are incorporated herein by reference in the same manner as each individual publication is expressly and individually designated as incorporated by reference.

[0281] This disclosure is not limited to the specific embodiments described herein, which are intended as a single example illustrating various aspects of this disclosure. Not all various embodiments of this disclosure will be described herein. The terminology and expressions used are descriptive and not limiting, and their use is not intended to exclude any equivalents of the shown and described features or portions thereof, but it should be recognized that various modifications may be made within the scope of this disclosure. Therefore, it should be understood that although this disclosure has been specifically disclosed through preferred embodiments and optional features, modifications and variations of the concepts disclosed herein can be adopted by those skilled in the art, and such modifications and variations are considered to be within the scope of this disclosure as defined in the appended claims.

Claims

1. Genetically modified pluripotent stem cells (PSCs) comprising an expression cassette at a selected locus integrated into the genome of the PSCs, the expression cassette containing one or more exogenous target polynucleotides and one or more promoters operatively linked to the one or more exogenous target polynucleotides, wherein the selected locus is CISH and / or Rosa26, and wherein the genetically modified PSCs, compared with PSCs genetically modified under the same conditions except for integration at a locus different from CISH and / or Rosa26, are capable of differentiating into genetically modified iNK cells with higher expression levels and uniformity of the one or more exogenous target polynucleotides.

2. The genetically modified PSCs according to claim 1, wherein the genetically modified PSCs, compared with PSCs genetically modified under the same conditions except for integration into a locus different from CISH and / or Rosa26, are capable of differentiating into genetically modified iNK cells with at least 2-fold, and preferably at least 4-fold, higher uniformity of expression of the one or more exogenous target polynucleotides.

3. The genetically modified PSCs according to claim 1 or 2, wherein the locus different from CISH and / or Rosa26 is selected from AAVS1, CD38 and / or NKG2A.

4. Genetically modified PSCs according to any one of claims 1-3, wherein the one or more promoters are selected from EF1α, PGK, CAG, CMV, CLP, UBC and / or any promoters derived therefrom, and preferably EF1α, CMV and / or CLP.

5. Genetically modified PSCs according to any one of claims 1-4, wherein the selected locus is CISH.

6. The genetically modified PSCs according to any one of claims 1-5, wherein the one or more exogenous target polynucleotides comprise polynucleotides encoding luciferase or fluorescent proteins, polynucleotides encoding Fc receptors, polynucleotides encoding antibodies, polynucleotides encoding cytokines, polynucleotides encoding proteins having a safety switch function, or any combination thereof.

7. The genetically modified PSCs according to claim 6, wherein the Fc receptor comprises CD16, CD64 or variants thereof, preferably the uncleavable CD16A shown in SEQ ID NO.:3 and the CD64 / 16A fusion protein shown in SEQ ID NO.:5, and more preferably the CD64 / 16A fusion protein shown in SEQ ID NO.:

5.

8. The genetically modified PSCs according to claim 6, wherein the cytokines include membrane-bound cytokines, preferably membrane-bound IL-15 and its variants, and more preferably membrane-bound IL15RLI as shown in SEQ ID NO.:

12.

9. Genetically modified PSCs according to any one of claims 1-8, wherein the expression cassette further comprises one or more ubiquitous chromatin open elements (UCOEs) operatively linked to the one or more promoters.

10. The gene-modified PSCs according to claim 9, wherein the expression cassette comprises a combination of the EF1α promoter and 1550F shown in SEQ ID NO.: 14, or a combination of the CMV promoter and 1550F shown in SEQ ID NO.: 14, and preferably a combination of the EF1α promoter and 1550F shown in SEQ ID NO.:

14.

11. Genetically modified iNK cells comprising an expression cassette integrated into a selected locus, the expression cassette containing one or more exogenous target polynucleotides, and one or more promoters operatively linked to said one or more exogenous target polynucleotides, wherein said selected locus is CISH and / or Rosa26, and wherein said genetically modified iNK cells have higher expression levels and uniformity of said one or more exogenous target polynucleotides compared to iNK cells genetically modified under the same conditions except for integration into a locus different from CISH and / or Rosa26.

12. The genetically modified iNK cells of claim 11, wherein the genetically modified iNK cells have at least 2-fold, and preferably at least 4-fold, higher expression uniformity of the one or more exogenous target polynucleotides compared to iNK cells genetically modified under the same conditions except for integration into a locus different from CISH and / or Rosa26.

13. The gene-modified iNK cells according to claim 11 or 12, wherein the locus different from CISH and / or Rosa26 is selected from AAVS1, CD38 and / or NKG2A.

14. The gene-modified iNK cells according to any one of claims 11-13, wherein the one or more promoters are selected from EF1α, PGK, CAG, CMV, CLP, UBC and / or any promoter derived therefrom, and are preferably EF1α, CMV and / or CLP.

15. Genetically modified iNK cells according to any one of claims 11-14, wherein the selected locus is CISH.

16. The gene-modified iNK cell according to any one of claims 11-15, wherein the one or more exogenous target polynucleotides comprise polynucleotides encoding luciferase or fluorescent proteins, polynucleotides encoding Fc receptors, polynucleotides encoding antibodies, polynucleotides encoding cytokines, polynucleotides encoding proteins having a safety switch function, or any combination thereof.

17. The genetically modified iNK cell according to claim 16, wherein the Fc receptor comprises CD16, CD64 or variants thereof, preferably the uncleavable CD16A shown in SEQ ID NO.:3 and the CD64 / 16A fusion protein shown in SEQ ID NO.:5, and more preferably the CD64 / 16A fusion protein shown in SEQ ID NO.:

5.

18. The genetically modified iNK cells according to claim 17, wherein the cytokines include membrane-bound cytokines, preferably membrane-bound IL-15 and its variants, and more preferably membrane-bound IL15RLI as shown in SEQ ID NO.:

12.

19. The gene-modified iNK cell of claim 18, wherein the expression cassette further comprises one or more ubiquitous chromatin open elements (UCOEs) operatively linked to the one or more promoters.

20. The gene-modified iNK cell of claim 19, wherein the expression cassette comprises a combination of the EF1α promoter and 1550F as shown in SEQ ID NO.: 14, or a combination of the CMV promoter and 1550F as shown in SEQ ID NO.: 14, and preferably the combination of the EF1α promoter and 1550F as shown in SEQ ID NO.:

14.

21. The genetically modified iNK cell according to claim 20, wherein the genetically modified iNK cell is an immature or mature genetically modified iNK cell, and preferably a mature genetically modified iNK cell.

22. A method for preparing genetically modified pluripotent stem cells (PSCs), the method comprising: Introduce into PSCs a construct comprising a site-specific endonuclease capable of introducing double-strand breaks at selected loci in the genome of the PSCs, and a construct comprising an expression cassette and a pair of homologous arms specific to the selected loci and located flanking the expression cassette, the expression cassette comprising one or more exogenous target polynucleotides and one or more promoters operatively linked to the one or more exogenous target polynucleotides; as well as By means of the endonuclease, and via homologous recombination, an expression cassette containing one or more exogenous target polynucleotides and one or more promoters is integrated into the selected locus of the PSC genome to obtain genetically modified PSCs, wherein the selected locus is CISH and / or Rosa26. The genetically modified PSCs therein, compared with PSCs genetically modified under the same conditions except for integration into a locus different from CISH and / or Rosa26, are capable of differentiating into genetically modified iNK cells with higher levels and uniformity of expression of the one or more exogenous target polynucleotides.

23. The method of claim 22, wherein the genetically modified PSCs, compared with PSCs genetically modified under the same conditions except for integration into a locus different from CISH and / or Rosa26, are capable of differentiating into genetically modified iNK cells with at least 2-fold, and preferably at least 4-fold, higher uniformity of expression of the one or more exogenous target polynucleotides.

24. The method according to claim 22 or 23, wherein the locus different from CISH and / or Rosa26 is selected from AAVS1, CD38 and / or NKG2A.

25. The method according to any one of claims 22-24, wherein the one or more promoters are selected from exogenous promoters and are directly operably linked to the one or more exogenous target polynucleotides.

26. The method according to any one of claims 22-24, wherein the one or more promoters are selected from endogenous promoters contained in the selected locus and are operatively linked to the one or more exogenous target polynucleotides upon integration.

27. The method of claim 25 or 26, wherein the one or more promoters are selected from EF1α, PGK, CAG, CMV, CLP, UBC and / or any promoters derived therefrom, and are preferably EF1α, CMV and / or CLP.

28. The method according to any one of claims 22-27, wherein the selected locus is CISH.

29. The method according to any one of claims 22-28, wherein the one or more exogenous target polynucleotides comprise polynucleotides encoding luciferase or fluorescent proteins, polynucleotides encoding Fc receptors, polynucleotides encoding antibodies, polynucleotides encoding cytokines, polynucleotides encoding proteins having a safety switch function, or any combination thereof.

30. The method of claim 29, wherein the Fc receptor comprises CD16, CD64 or variants thereof, preferably the uncleavable CD16A shown in SEQ ID NO.:3 and the CD64 / 16A fusion protein shown in SEQ ID NO.:5, and more preferably the CD64 / 16A fusion protein shown in SEQ ID NO.:

5.

31. The method according to claim 29, wherein the cytokine comprises a membrane-bound cytokine, preferably a membrane-bound IL-15 and variants thereof, and more preferably the membrane-bound IL15RLI shown in SEQ ID NO.:

12.

32. The method according to any one of claims 22-31, wherein the expression box further comprises one or more ubiquitous chromatin open elements (UCOEs) operatively connected to the one or more promoters.

33. The method of claim 32, wherein the expression box comprises a combination of the EF1α promoter and the 1550F shown in SEQ ID NO.: 14, or a combination of the CMV promoter and the 1550F shown in SEQ ID NO.: 14, and preferably a combination of the EF1α promoter and the 1550F shown in SEQ ID NO.:

14.

34. The method of claim 32, further comprising continuously amplifying the gene-modified PSCs.

35. The method of claim 34, wherein the sequential amplification of the gene-modified PSCs comprises: During the amplification process, the genetically modified PSCs are passaged for at least 10 generations, preferably at least 14 generations.

36. A method for preparing genetically modified iNK cells, the method comprising: Genetically modified PSCs are prepared by the method according to any one of claims 22-35, and then the genetically modified PSCs are differentiated into NK cells to prepare the genetically modified iNK cells. The genetically modified iNK cells described therein have higher expression levels and uniformity of the one or more exogenous target polynucleotides compared to iNK cells that were genetically modified under the same conditions except for integration into a locus different from CISH and / or Rosa26.

37. The method of claim 36, further comprising expanding and maturing the genetically modified iNK cells.

Images