Phage vector

By designing self-complementary phage vectors and helper vector systems, the problem of low conversion efficiency of single-stranded DNA to double-stranded DNA in mammalian cells by phage vectors was solved, achieving efficient gene delivery and large genome packaging, and improving the transduction efficiency and flexibility of phage vectors.

CN120958136APending Publication Date: 2025-11-14IMPERIAL COLLEGE INNVOATIONS LTD
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202480007443.5
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Priority Date
2023-01-10
Filing Date
2024-01-10
Publication Date
2025-11-14

AI Technical Summary

Technical Problem

Existing phage vectors have low efficiency in converting single-stranded DNA to double-stranded DNA in mammalian cells, which limits gene delivery efficiency, and adeno-associated virus vectors have difficulties in packaging large genomes.

Method used

Design a phage vector comprising at least two single-stranded self-complementary transgene expression cassettes separated by linkers, forming a double-stranded transgene expression cassette through hybridization, and packaging it in a prokaryotic host using an auxiliary vector system.

Benefits of technology

It significantly improved the gene delivery efficiency of phage vectors in mammalian cells, solved the problem of single-stranded DNA to double-stranded DNA conversion, and enhanced the large genome packaging capacity, achieving higher transduction efficiency and flexibility.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120958136A_ABST
    Figure CN120958136A_ABST
Patent Text Reader

Abstract

The present invention relates to bacteriophage vectors, and novel bacteriophage vectors comprising transgenes, in particular novel bacteriophage vectors comprising conventional mammalian transgene cassettes. The invention also extends to the use of such bacteriophage vectors as research tools, as well as their use in delivery of transgenes in various gene therapy applications, DNA and / or peptide vaccine delivery, and imaging techniques.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to phage vectors, particularly but not limited to novel phage vectors containing transgenes, especially conventional mammalian transgene cassettes. The invention extends to the use of such phage vectors as research tools and for delivering transgenes in various gene therapy applications, DNA and / or peptide vaccine delivery, and imaging techniques. Background Technology

[0002] Phages continue to be a safe vector for targeted transgene delivery because they lack inherent tropism for mammalian cell receptors but can be engineered to display tissue-specific ligands on their coat proteins, allowing cell entry without disrupting viral structure (1-6). However, despite their significant advantages over eukaryotic viruses, tissue-targeted phage vectors have shown limited efficacy because phages have evolved to infect only bacteria and lack optimized strategies for transgene expression after entering eukaryotic cells (2).

[0003] Previous research by the inventors has shown that the gene transfer efficiency of filamentous M13 phages can be improved, and an effective strategy is to combine the characteristics of phages with those of animal viruses. Importantly, over the past few years, the inventors have devised various strategies to improve the gene delivery efficiency of filamentous M13 phage-derived vectors. Indeed, like other viral vectors, successful gene delivery mediated by M13 phage vectors requires: i) efficient diffusion through the extracellular matrix (ECM) to reach the cell surface, ii) binding to cell surface receptors for cellular uptake, iii) endosome escape, and iv) nuclear entry to initiate gene expression. Clearly, phages have evolved to infect only bacteria, and there is no optimized strategy to accomplish these steps to express transgenes in mammalian cells. Over the past few years, the inventors have devised various methods to overcome these limitations, including reducing the size of M13 phage particles to facilitate their diffusion across the extracellular matrix (ECM) (7,8) and incorporating endosome escape peptides into the major capsid protein of recombinant pVIII to enhance phage escape from endosome / lysosomal degradation pathways (9,10). Furthermore, to improve gene expression in the cell nucleus, the inventors previously added inverted terminal repeat sequences (ITRs) from adeno-associated virus (AAV2) to both sides of the mammalian transgene expression cassette, thereby improving phage gene delivery efficiency (6). In addition, to enhance the transcription of therapeutic genes in cancer cell nuclei, the inventors replaced the cytomegalovirus (CMV) promoter with the tumor activation and chemotherapy-inducible promoter of the glucose-regulated protein Grp78 (11,12). The inventors have also conjugated anticancer drugs with the M13 phage vector to increase phage nuclear entry into cancer cells (13).

[0004] However, unlike traditional viral vectors, filamentous M13 phages require the additional conversion of their single-stranded DNA (ssDNA) genome into double-stranded DNA (dsDNA) form in order to be correctly recognized by the cell's transcriptional mechanisms (14). Although the ability of M13 phages to enter the cell nucleus has been successfully addressed, the conversion of the single-stranded (ss) genome to the double-stranded (ds) genome remains a key problem to be solved. In mammalian cells, the conversion of M13 phage ssDNA to dsDNA depends on cytokines, which is a very inefficient process that limits transduction efficiency (15).

[0005] Clearly, converting M13 phage into double-stranded DNA (dsDNA) has long been a major challenge in M13 phage-mediated gene delivery to mammalian cells. The requirement for complementary strand synthesis or recruitment is currently considered a rate-limiting factor restricting the efficiency of M13 phage vectors. To overcome this limitation, conversion of ssDNA to dsDNA has been promoted by genotoxic treatment of human cell lines pre-incubated with phage particles (15). Unfortunately, such treatments are not applicable to living organisms.

[0006] In addition to the issues related to filamentous bacteriophages (such as M13 phage) mentioned above, adeno-associated virus (AAV) vectors also present significant problems related to the rate-limiting step of ssDNA to dsDNA conversion. Furthermore, although the AAV capsid can carry two self-complementary ssDNA sequences, each containing a transgene expression cassette for the production of dsAAV DNA during cell transduction, the maximum length of each ssDNA sequence cannot exceed 2.3 kb. Therefore, packaging issues exist when packaging expression cassettes larger than 2.3 kb (i.e., large genomes) to produce dsDNA AAV in transduced cells for gene therapy applications.

[0007] Therefore, there is a need to provide a novel phage vector for delivering transgenic cassettes, for example, by delivering them into mammalian cells. Summary of the Invention

[0008] Unlike relying on potentially variable cellular mechanisms to provide complementary strands for single-stranded genome phage vectors, the inventors unexpectedly discovered that this problem could be circumvented by designing a single phage vector carrying a complementary sequence to a transgene expression cassette.

[0009] Therefore, according to a first aspect of the invention, a phage vector is provided comprising at least two single-stranded self-complementary transgenic expression cassettes separated by linkers, which hybridize to form a double-stranded transgenic expression cassette.

[0010] As discussed in the examples, the inventors designed a phage vector carrying complementary sequences to a transgenic expression cassette, which hybridize to form a double-stranded transgenic expression cassette. Advantageously, the phage vector of the present invention overcomes the problems of single-stranded (ss) DNA to double-stranded (ds) DNA conversion in filamentous phage vectors (such as M13) and the related problems in adeno-associated virus (AAV) vectors. The present invention also solves the problem of packaging large genomes for the production of double-stranded AAV vectors. To demonstrate that the phage vector of the present invention has better gene delivery performance than prior art, the inventors used reporter genes (such as green fluorescent protein GFP and luciferase). Subsequently, the inventors used the cytokine TRAIL to support their findings and further demonstrate the remarkable superiority of the vector of the present invention in gene delivery. When using genes encoding cytokines (such as TRAIL) in the expression cassette, the inventors also demonstrated cancer cell death, indicating that the phage vector of the present invention can be used for the efficient delivery of therapeutic genes.

[0011] Therefore, the phage vector of the present invention can be a filamentous phage vector, such as M13, or a hybrid vector of AAV DNA and filamentous phage capsid.

[0012] The inventors conducted several in vitro experiments using various cell lines and transgenes. Surprisingly, they observed that the transduction efficiency of the phage vector of the present invention was 3 to 15 times higher than that of conventional single-stranded DNA phage vectors. In fact, advantageously, the phage vector of the present invention exhibited rapid onset of action and higher transgene expression levels in all tested cell lines. More importantly, unlike conventional single-stranded phage vectors, DNA replication inhibitors did not affect the transduction of the phage vector of the present invention. Furthermore, as discussed in the examples, in vivo studies showed that, compared to conventional single-stranded DNA phage particles, the phage vector of the present invention significantly improved gene delivery efficiency to solid tumors when administered systemically to mice. All these biological characteristics demonstrate the emergence and properties of a novel class of filamentous phage vectors capable of delivering double-stranded DNA, which will make a significant contribution to the continued development of phage-based gene delivery systems.

[0013] Because circular phage genomes can affect the formation of double-stranded DNA, the inventors used a phage midline, such as that described in WO 2017 / 077275, the entire contents of which are incorporated herein by reference. This process involves removing the phage genome, retaining only the f1 origin of replication, to enable the replication and packaging of the transgenic expression cassette in bacteria. A phage midline is defined as a plasmid DNA containing a phage origin of replication, hence the name "phage midline." In this paper, the inventors used the phage midline as a DNA backbone to design a novel phage genome carrying two transgenic expression cassettes. The resulting double-stranded vector is a phage particle.

[0014] Therefore, preferably, the phage vector is a hybrid phage particle genome wrapped with a phage-derived coat protein. This hybrid phage particle genome can be called a "phage particle genome" (i.e., a gene construct containing two replication origins—one from a phage (such as F1) and the other from a bacterium (such as pUC1)).

[0015] Preferably, the genome of the phage vector contains a packaging signal that enables the replication of at least two single-stranded, self-complementary transgenic expression cassettes, which can hybridize in bacteria and subsequently be packaged into the phage vector as double-stranded transgenic expression cassettes in a prokaryotic host. The packaging signal may preferably include a phage origin of replication. For example, the origin of replication preferably includes an F1 origin, more preferably from an F1 phage. One embodiment of the F1 origin's DNA sequence is represented herein as SEQ ID No:1, as follows:

[0016] ACGCGCCCTGTAGCGGCGCATTAAGCGCGGCGGGTGTGGTTACGCGCAGCGTGACCGCTACACTTGCCAGCGCCCTAGCGCCCGTCCCTTTCGCTTTCTTCCCTTCCTTTCTCGCCAGTTCGCCGGCTTTCCCCGTCAAGCTCTAAATCGGGGGCCTCCCTTTAGGGTTCCGATTTAGTGCTTTACGGCACCTCGACCCCAAAAAACTTGATTTGGGTGATGGTT CACGTAGTGGGCCATCGCCCTGATAGACGGTTTTTCGCCCTTTGACGTTGGAGTCCACGTTCTTTAATAGTGGACTCTTGTTCCAAACTGGAACAACACTCAACCCTATCTCGGGCTATTCTTTTGATTTATAAGGGATTTTGCCGATTTCGGCCTATTGGTTAAAAAATGAGCTGATTTAACAAAAATTTAACGCGAATTTTAACAAAATATTAACGTTTACAATTT

[0017] [SEQ ID NO:1]

[0018] Preferably, the genome of the phage vector contains an origin of replication for enabling at least two single-stranded, self-complementary transgene expression cassettes to replicate within a prokaryotic host. Preferably, the origin of replication enables high copy number replication of the vector within the host. Preferably, the origin of replication includes a bacterial origin of replication. Preferably, the origin of replication includes a pUC origin (for molecular cloning). One embodiment of the pUC origin's DNA sequence is represented herein as SEQ ID No:2, as follows:

[0019] TTGAGATCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGT CCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACC GGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGCGGGACAGGTATCC GGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAA

[0020] [SEQ ID NO:2]

[0021] Alternatively, in another implementation, the phage vector can be designed to integrate into the host cell's genome. In this case, nucleic acid sequences that facilitate targeted integration of the vector genome (e.g., through homologous recombination) should be envisioned. Therefore, the phage vector's genome may contain one or more DNA sequences that enable its targeted integration into the host genome.

[0022] In one implementation, the phage vector can be used as an experimental research tool and can be used in vitro or in vitro.

[0023] In another embodiment, preferably, the phage vector can be used to deliver at least two self-complementary transgenic expression cassettes to tissue-specific targets, whether the vector is administered to a subject systemically or locally in vivo, applied in vitro to a cell mixture, or applied to an organ in an ex vivo setting. Preferably, the at least two self-complementary transgenic expression cassettes comprise viral transgenic expression cassettes. More preferably, the at least two self-complementary transgenic expression cassettes comprise mammalian viral transgenic expression cassettes. For example, in a preferred embodiment, the at least two self-complementary transgenic expression cassettes may comprise lentiviral transgenic expression cassettes. The at least two self-complementary transgenic expression cassettes are preferably adeno-associated virus (AAV) transgenic expression cassettes.

[0024] At least two self-complementary transgenic expression cassettes can contain any nucleic acid encoding a factor that may have therapeutic or industrial use in target cells or tissues. In one embodiment of the invention, the nucleic acid can be DNA, which may be genomic DNA or cDNA. In some embodiments, non-naturally occurring cDNA may be preferred. In another embodiment, the nucleic acid can be RNA, such as antisense RNA or shRNA.

[0025] The factor encoded by the nucleic acid can be a polypeptide or a protein. For example, in an embodiment of the phage vector used for cancer treatment in the first aspect, the transgene can encode a herpes simplex virus thymidine kinase gene, which can then exert a therapeutic effect on target tumor cells. The transgene can encode cytokines, such as tumor necrosis factor-associated apoptosis-inducing ligand (TRAIL). This vector can be used to treat any cancer, such as bone cancer.

[0026] However, it should be understood that the cell types targeted by a phage vector depend on the type of cell-targeting ligand expressed on the vector surface. For example, a cell-targeting ligand may contain an arginine-glycine-aspartic acid (RGD) sequence, such as RGD4C.

[0027] The at least two transgenic expression cassettes described above may contain one or more functional elements required for expressing nucleic acids in target cells. For example, preferably, each of the at least two transgenic expression cassettes contains a promoter for driving transgenic expression. A suitable promoter may be a cytomegalovirus (CMV) promoter. In this document, the DNA sequence of one embodiment of the CMV promoter is represented herein as SEQ ID No:3, as shown below:

[0028] ACGCGTGGAGCTAGTTATTAATAGTAATCAATTACGGGGTCATTAGTTCATAGCCCATATATGGAGTTCCGCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACG TCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTC CTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTGATGCGGTTTTGGCAGTACATCAATGGGCGTGGATAGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCATTGACGTCAATGGGAGTTTGTTTTGCACCAAAATCAACGGGACTTT CCAAAATGTCGTAACAACTCCGCCCCATTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCTCGTTTAGTGAACCGTCAGATCGCCTGGAGACGCCATCCACGCTGTTTTGACCTCCATAGAAGACACCGGGACCGATCCAGCCTCC

[0029] [SEQ ID NO:3]

[0030] In another preferred embodiment, at least two transgenic expression cassettes each contain a glucose regulatory protein 78 (grp78) promoter. The nucleic acid sequence of one embodiment of the grp78 promoter is represented herein as SEQ ID No:4, as follows:

[0031] CCCGGGGGCCCAACGTGAGGGGAGGACCTGGACGGTTACCGGCGGAAACGGTTTCCAGGTGAGAGGTCACCCGAGGGACAGGCAGCTGCTCAACCAATAGGACCAGCTCTCAGGGCGGATGCTGCCTCTCATTGGCGGCCGTTAAGAATGACCAGTAGCCAATGAGTCGGCTGGGGGGGCGCGTACCAGT GACGTGAGTTGCGGAGGAGGCCGCTTCGAATCGGCAGCGGCCAGCTTGGTGGCATGAACCAACCAGCGGCCTCCAACGAGTAGCGAGTTCACCAATCGGAGGCCTCCACGACGGGGCTGCGGGGAGGATATATAAGCCGAGTCGGCGACCGGCGCGCTCGATACTGGCTGTGACTACACTGACTTGGAC

[0032] [SEQ ID NO:4]

[0033] Alternatively, in another preferred embodiment, at least two transgene expression cassettes each contain a tumor-specific promoter or a tissue-specific promoter. Tissue-specific promoters can be used to target transcription and gene expression via phage vectors displaying ligands for delivery to these specific tissues.

[0034] Preferably, at least two transgenic expression cassettes each contain a nucleic acid segment encoding a polyadenylated (polyA) tail. Preferably, the polyA tail is located at the end of the transgenic expression cassette, i.e., the 5' or 3' end. In this document, the DNA sequence of one embodiment of the nucleic acid segment encoding the polyA tail is represented herein as SEQ ID No:5, as shown below:

[0035] ACGGGTGGCATCCCTGTGACCCCTCCCCAGTGCCTCTCCTGGCCCTGGAAGTTGCCACTCCAGTGCCCACCAGCCTTGTCCTAATAAAATTAAGTTGCATCATTTTGTCTGACTAGGTGTCCTTCTATAATATTATGGGGTGGAGGGGGGTGGTATGGAGCAAGGGGCAAGTTGGGAAGACAACCTGTAGGGCCTGCGGGGTCTATTGGGAACCAAGCTGGAGTGCAGTGGCACAATCT TGGCTCACTGCAATCTCCGCCTCCTGGGTTCAAGCGATTCTCCTGCCTCAGCCTCCCGAGTTGTTGGGATTCCAGGCATGCATGACCAGGCTCCAGCTAATTTTTGTTTTTTTGGTAGACGGGGTTTCACCATATTGGCCAGGCTGGTCTCCAACTCCTAATCTCAGGTGATCTACCCACCTTGCCTCCCCAAATTGCTGGGATTACAGGGCTGAACCACTGCTCCTTCCCTGTCCT

[0036] [SEQ ID NO:5]

[0037] Therefore, in a preferred embodiment, each of the at least two single-stranded self-complementary transgenic expression cassettes contains a promoter (preferably CMV), a nucleic acid segment encoding a factor (e.g., a therapeutic factor), and a polyA tail.

[0038] Preferably, the phage vector comprises at least two single-stranded self-complementary transgenic expression cassettes separated by linkers, which hybridize to form double-stranded transgenic expression cassettes. Alternatively, the phage vector may comprise four single-stranded self-complementary transgenic expression cassettes (i.e., two pairs of self-complementary expression cassettes) separated by linkers, which hybridize to form two double-stranded transgenic expression cassettes.

[0039] like Figure 2 As shown, in order for the single-stranded self-complementary transgenic expression cassettes to hybridize, they must be arranged in opposite directions in the phage vector; that is, the first expression cassette extends along the 5' to 3' direction, while the corresponding second expression cassette extends along the 3' to 5' direction. It should be understood that these expression cassettes are substantially identical in sequence, but extend in opposite or antiparallel directions on either side of the linker separating them. Therefore, in a preferred embodiment, the two single-stranded self-complementary transgenic expression cassettes are arranged in opposite directions in the phage vector.

[0040] Understandably, for at least two single-stranded self-complementary transgenic expression cassettes to successfully hybridize into a double-stranded transgenic expression cassette, their sequences should be similar, even if not identical, despite being in opposite directions of extension. However, their sequences do not necessarily have to be identical; hybridization will occur as long as each expression cassette exhibits sufficient sequence consistency over a sufficiently long segment.

[0041] The sequence identity percentage between the first and second expression cassettes can be at least 65%, 70%, or 75%. Preferably, the sequence identity percentage between the first and second expression cassettes is at least 80%, 85%, or 90%. More preferably, the sequence identity percentage between the first and second expression cassettes is at least 92%, 94%, or 95%. Even more preferably, the sequence identity percentage between the first and second expression cassettes is at least 96%, 97%, or 98%. Most preferably, the sequence identity percentage between the first and second expression cassettes is at least 99% or 100%.

[0042] Preferably, the linker separating the at least two self-complementary transgenic expression cassettes is a terminal inverted repeat (ITR). Preferably, the phage vector contains a second ITR. More preferably, the second ITR is located on the flank of one of the at least two self-complementary transgenic expression cassettes.

[0043] Alternatively, in another preferred embodiment, the linker separating at least two self-complementary transgene expression cassettes is an unrelated DNA fragment. Preferably, the length of the linker or unrelated DNA fragment is between 60 bp and 300 bp, between 80 bp and 280 bp, between 100 bp and 260 bp, between 120 bp and 240 bp, between 140 bp and 220 bp, or between 160 bp and 200 bp. Most preferably, the length of the linker or unrelated DNA fragment is 180 bp.

[0044] "Irrelevant DNA fragments" refer to DNA fragments with low or no sequence identity to both the first and second single-stranded self-complementary expression cassettes. For example, the sequence identity percentage between the linker and the first and second expression cassettes is less than 50%, 45%, or 40%. Preferably, the sequence identity percentage between the linker and the first and second expression cassettes is less than 35%, 30%, or 25%. Preferably, the sequence identity percentage between the linker and the first and second expression cassettes is less than 20%, 15%, or 10%. Preferably, the sequence identity percentage between the first and second expression cassettes is at least 8% or 5%.

[0045] Preferably, the first ITR and the second ITR are AAV ITRs. The ITR can be specific to AAV-2 or other AAV serotypes and can be any sequence as long as it can form a hairpin loop in the secondary structure. For example, the AAV serotype can be AAV1-9, but is preferably AAV1, AAV2, AAV5, AAV6, or AAV8. One embodiment of the ITR is a DNA sequence (a left-handed inverted terminal repeat sequence from a commercially available AAV plasmid), which is represented herein as SEQ ID No:6, as follows:

[0046] CCTGCAGGCAGCTGCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCGTCGGGCGACCTTTGGTCGCCCGCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTGGCCAACTCCATCACTAGGGGTTCCT

[0047] [SEQ ID NO:6]

[0048] The DNA sequence of the ITR in another embodiment (a right-handed inverted terminal repeat sequence from a commercially available adeno-associated virus (AAV) plasmid) is represented herein as SEQ ID No:7, as follows:

[0049] AGGAACCCCTAGTGATGGAGTTGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCAAAGGTCGCCCGACGCCCGGGCTTTGCCCGGGCGGCCTCAGTGAGCGAGCGAGCGCGCAGCTGCCTGCAGG

[0050] [SEQ ID NO:7]

[0051] Preferably, the phage vector contains only two ITRs. Preferably, the phage vector contains fewer than three ITRs.

[0052] Preferably, the genome of the phage vector contains a selection marker that will depend on the host cell to which the vector is carried, for example, to confer resistance to an antibiotic (such as ampicillin) to the host cell (preferably bacteria). This marker provides selective pressure during the production of the vector in the host cell. Therefore, in a preferred embodiment, the phage vector contains an ampicillin resistance gene.

[0053] Preferably, the phage vector comprises one or more minor capsid proteins. The phage vector may contain a pIII minor capsid protein configured to display a cell-targeting ligand, thereby enabling the vector to be delivered to target cells. Preferably, the phage vector comprises one or more major capsid proteins. The phage vector may contain at least one pVIII major capsid protein configured to display a foreign peptide thereon.

[0054] Phage vectors may contain modifications to their capsid structure, for example, through treatment or chemical and biochemical coupling (making them modified). Suitable examples of modification may include crosslinking peptide residues to the phage particle. In another embodiment, the phage vector may contain one or more functional peptides attached to its capsid. For example, the functional peptide may contain a nuclear translocation signal or an endosome escape peptide. Thus, phage particles can be multifunctional and can utilize the features disclosed in WO 2014 / 184528, the contents of which are incorporated herein by reference.

[0055] In another embodiment, the phage vector can be bound to a cationic polymer to form a complex having a net positive charge, as described in WO 2014 / 184529, the contents of which are incorporated herein by reference. The cationic polymer can be selected from the group consisting of: chitosan; poly-D-lysine (PDL); diethylaminoethyl (DEAE); diethylaminoethyl-glucan (DEAE.DEX); polyethyleneimine (PEI); polyglucan; protamine sulfate; and cationic lipids. Preferably, the cationic lipid is selected from... And DOTAP (N-[1-(2,3-dioleoyloxy)propyl]-N,N,N-trimethylammonium methyl sulfate). Preferably, the cationic polymer comprises DEAE, more preferably DEAE.DEX.

[0056] Preferably, the phage vector comprises a genome that substantially lacks the genome of the phage from which the vector is derived. Preferably, the genome of the phage vector lacks at least 60%, more preferably at least 70%, and even more preferably at least 80% of the genome of the phage from which it is derived. More preferably, the genome of the phage vector lacks at least 90%, more preferably at least 95%, and even more preferably at least 99% of the genome of the phage from which it is derived. Preferably, the genome of the phage vector lacks all the genomes of the phage from which it is derived. However, as discussed above, in some embodiments, the genome of the phage vector may include a phage replication origin, such that single-stranded DNA can replicate in the host bacterium, i.e., an F1 phage replication origin.

[0057] Preferably, the genome of the phage vector lacks structural genes required for the formation, packaging, or release of particles from the prokaryotic host. These structural genes encode capsid proteins, etc. Therefore, preferably, the phage vector lacks structural genes encoding phage capsid proteins. Preferably, the phage vector contains a genome that lacks genes encoding minor or major capsid proteins of the phage derived from the vector. Preferably, the phage vector contains a genome that lacks genes encoding either the pIII capsid minor capsid protein or the pVIII capsid major capsid protein. Most preferably, the phage vector contains a genome that lacks both genes encoding the pIII capsid minor capsid protein and genes encoding the pVIII capsid major capsid protein.

[0058] Therefore, the phage vector preferably contains a replication-defective virus-like particle or virus particle that is constructed from and displays structural components derived from the phage, including but not limited to proteins and other conjugates, although the genome of the vector does not contain the structural genes of the phage from which it is derived.

[0059] Therefore, given that the genome of the phage vector of the first aspect lacks most of the genome (including structural genes) of its derived phage, an alternative system is needed to provide the necessary structural (i.e., capsid) genes required to package the phage vector genome into a phage capsid to produce the phage vector of the present invention. Accordingly, the inventors have designed a system for producing the vector of the first aspect, which involves the use of a separate so-called "helper virus" vector. Thus, in practice, the phage vector of the first aspect is a hybrid phage particle vector containing cis-genetic components of a phage particle and cis-genetic components of a eukaryotic virus, such as AAV ITR.

[0060] Therefore, in a second aspect, a system for generating a phage vector from a prokaryotic host is provided, the system comprising:

[0061] (i) a first vector configured to persist within a prokaryotic host and comprising at least two single-stranded self-complementary transgenic expression cassettes separated by linkers and hybridizing to form a double-stranded transgenic expression cassette, and a packaging signal for enabling the replication of the at least two single-stranded self-complementary transgenic expression cassettes; and

[0062] (ii) A second vector containing nucleic acids for encoding structural proteins required for packaging the double-stranded transgenic expression cassette.

[0063] This allows the phage vector to form and be released from the prokaryotic host.

[0064] The second aspect of the preferred system is capable of packaging the genome of a eukaryotic virus (such as AAV or lentivirus) provided by the first vector into a prokaryotic capsid (i.e., bacteriophage) provided by the second vector.

[0065] Advantageously, isolating the propagation elements of a phage vector into a first "therapeutic" vector carrying a transgene expression cassette and a second, independent "helper" vector carrying viral packaging structure genes significantly reduces the genome / vector size, thereby substantially increasing transgene capacity. In embodiments where phage vectors are used for therapy, this is a particularly useful advantage for gene therapy applications. Therefore, it increases the production yield of the vector system, gene transduction efficiency, and enhances its flexibility in other applications.

[0066] Preferably, the system of the second aspect is used to generate a phage vector according to the first aspect. Therefore, preferably, the first vector contains the genome of the phage vector. The packaging signal of the first vector may preferably include an origin of replication, preferably a phage origin of replication. Preferably, the origin of replication in the first vector includes an F1 origin of replication, more preferably from an F1 phage origin of replication.

[0067] Preferably, the first vector includes a second origin of replication for enabling at least two single-stranded, self-complementary transgenic expression cassettes to replicate within a prokaryotic host for molecular cloning. Preferably, this origin of replication enables the vector to undergo high copy number replication within the host for molecular cloning. Preferably, this origin of replication includes a pUC origin of replication. Alternatively, the first vector may contain one or more DNA sequences that facilitate targeted integration into the host genome, thus eliminating the need for any origin of replication.

[0068] The aforementioned at least two single-stranded self-complementary transgenic expression cassettes include one viral transgenic expression cassette, more preferably a mammalian viral transgenic expression cassette. For example, the at least two transgenic expression cassettes may include an AAV transgenic expression cassette or a lentiviral transgenic expression cassette, with the AAV transgenic expression cassette being preferred.

[0069] Preferably, the linker of the first vector is an ITR, more preferably an AAV ITR, and even more preferably an adeno-associated virus type 2 (AAV2) ITR. Alternatively, in another preferred embodiment, the linker of the first vector is an unrelated DNA fragment. Preferably, the linker is as described above for the phage vector of the first aspect.

[0070] In a preferred embodiment, the first vector contains a second ITR. Preferably, the second ITR is located on one flank of at least two self-complementary transgene expression cassettes. Preferably, the first ITR and / or the second ITR is an AAV ITR. Preferably, the first vector contains only two ITRs. Preferably, the first vector contains fewer than three ITRs.

[0071] The second vector or "helper phage" is preferably a phage specifically modified to rescue the genome of the first vector from a prokaryotic host. Therefore, the second vector (i.e., the helper phage) is provided to provide its proteins and peptides to the first vector, or to any other DNA entity containing a functional packaging signal and / or a single-stranded origin of replication. The second vector is most preferably replication-deficient. Preferably, the second vector contains a disrupted packaging signal, which significantly weakens its ability to package itself into the phage particle. Preferably, the second vector contains a disrupted origin of replication. In one embodiment, the disrupted origin of replication is a medium copy number origin, such as p15a. In another embodiment, the disrupted origin of replication is a low copy number origin, such as pMB1. Preferably, the first vector (i.e., the genome of the phage vector) is configured to be superior to the second vector (i.e., the helper phage) in both replication and packaging.

[0072] The genome of the second vector can be modified to endow the resulting phage vector with targeting properties (or multifunctional properties as described in WO2014 / 184528). Therefore, the second vector provides structural capsid proteins for the assembly of the phage vector. Preferably, the second vector contains nucleic acids encoding one or more minor capsid proteins, or encoding one or more major capsid proteins. All capsid proteins can be wild-type or recombinant, present in single-copy or multiple-copy form, and can be modified to display chimeric or synthetic peptides. This includes displaying antigens of other viruses for peptide vaccine delivery; or, in cases requiring DNA vaccines (delivered by phage particles from the first aspect), acting as adjuvants.

[0073] Therefore, in one embodiment, the second vector may contain a first nucleic acid sequence encoding a pIII capsid minor coat protein configured to display a cell-targeting ligand, enabling the phage vector to be delivered to target cells (e.g., tumor cells). Thus, it may be necessary to introduce a 9-amino acid mutation into the pIII minor coat protein of the recombinant phage particle to make it responsive to α-expression. ν β3 and α ν β5 integrin is specific to tumor cells and angiogenic tumor-associated endothelial cells. Therefore, the genome of the second vector can contain the RGD4C targeting peptide (sequence CDCRGDCFC—SEQ ID No:8).

[0074] In another embodiment, the second vector may contain a second nucleic acid sequence encoding at least one pVIII capsid major coat protein, which is configured to display a foreign peptide thereon. Therefore, it may be necessary to introduce a mutation in the wild-type pVIII major coat protein of the phage vector to display a short peptide, for example, less than 10 amino acids in length. This short peptide may be a targeting motif or have an inherent biological / chemical function in vivo or in vitro. For example, it could generate an immune stimulus in vivo by displaying an antigen, or bind to nanoparticles (e.g., gold) in vitro by displaying a gold-binding peptide.

[0075] The first vector can be a member of the Retroviridae family or the Orthoretrovirinae subfamily. The first vector can also be a member of the Lentiviral genus. Preferably, the first vector is a member of the Parvoviridae family or its subfamily. More preferably, the first vector is a member of the Parvovirus genus or an Adeno-associated Virus species.

[0076] Once the first vector (i.e., the genome of the phage vector) and the second vector (i.e., the helper phage) are constructed, they are used together to generate the first-aspect phage vector in a prokaryotic host. It should be understood that the packaging signals (e.g., origin of replication) in the first vector that enable the phage vector genome to replicate act as signals to the structural proteins of the second vector (i.e., the helper phage) to package the genome (i.e., they work synergistically in a trans-acting manner in the host), thereby forming the first-aspect particles.

[0077] In a third aspect, a method for generating a phage vector from a prokaryotic host is provided, the method comprising: -

[0078] (i) Introducing a first vector into a prokaryotic host cell, the first vector being configured to persist within the prokaryotic host and comprising at least two single-stranded self-complementary transgenic expression cassettes separated by linkers and hybridizing to form a double-stranded transgenic expression cassette, and a packaging signal for enabling the at least two single-stranded self-complementary transgenic expression cassettes to replicate.

[0079] (ii) Introducing a helper phage into the host, the helper phage containing nucleic acid encoding phage structural proteins; and

[0080] (iii) The host is cultured under conditions that produce a double-stranded transgenic expression cassette, which is packaged with structural proteins to enable the formation and release of a phage vector carrying the double-stranded transgenic expression cassette in the prokaryotic host.

[0081] Advantageously, this produces extremely high yields of phage vectors. The first vector (i.e., the genome of the phage vector) can be introduced into a host cell, for example, through infection. This host cell can then be transformed with a helper phage to produce the phage vector. Preferably, the method includes a purification step after the culturing step. Purification may include centrifugation and / or filtration.

[0082] In a fourth aspect, a method for generating bacteriophage particles from a prokaryotic host is provided, the method comprising: -

[0083] (i) Introducing the following into a prokaryotic host cell: (a) a first vector configured to persist within the prokaryotic host and containing at least two single-stranded self-complementary transgenic expression cassettes separated by linkers and hybridizing to form a double-stranded transgenic expression cassette, and a packaging signal for enabling the replication of the at least two single-stranded self-complementary transgenic expression cassettes; and (b) a second vector containing structural proteins encoded by nucleic acids required for packaging the double-stranded transgenic expression cassette; and

[0084] (ii) The host is cultured under conditions that produce a double-stranded transgenic expression cassette packaged with structural proteins, so that the phage vector is formed in and released from the prokaryotic host.

[0085] Advantageously, this improves safety. The second vector (i.e., a helper phage) can be introduced into the host cell, for example, through infection. The host cell can then be transformed with the first vector (i.e., the genome of the phage vector) to produce the phage vector. Preferably, the method includes a purification step after the culturing step. Purification may include centrifugation and / or filtration.

[0086] In a fifth aspect, there is provided the use of an assistant phage containing nucleic acid encoding a viral vector structural protein for producing a phage vector according to the first aspect from a prokaryotic host.

[0087] In the sixth aspect, a host cell comprising a first vector and / or a second vector as defined in the second aspect is provided.

[0088] The host cell is preferably a prokaryotic cell, more preferably a bacterial cell. Examples of suitable host cells include: (i) TG1 (genotype: K-12supE thi-1Δ(lac-proAB)Δ(mcrB-hsdSM)5, (r K -m K - Plasmid: F'[traD36 proAB + lacI q lacZΔM15];(ii)DH5αF′IQ TM (genotype: Δ(lacZYA-argF)U169 recA1endA1 hsdR17(rk - ,mk + phoA supE44λ-thi-1gyrA96 relA1, plasmid: F′proAB + lacIqZΔM15zzf::Tn5[KmR]); and (iii)XL1-Blue MRF′ (genotype: Δ(mcrA)183Δ(mcrCB-hsdSMR-mrr)173endA1 supE44 thi-1recA1 gyrA96 relA1 lac, plasmid: F′proABlacIqZΔM15 Tn10(Tetr)).

[0089] On the other hand, phage vectors according to the first aspect or systems according to the second aspect are provided for use as experimental research tools.

[0090] For example, the carrier or system can be used in vitro or outside the body.

[0091] However, preferably, the carrier is used in a therapeutic or diagnostic method, and more preferably in vivo.

[0092] Therefore, in the seventh aspect, a phage vector according to the first aspect or a system according to the second aspect is provided for use in treatment or diagnosis.

[0093] Because the phage vector of this invention possesses targeting specificity and transduction efficiency, it can be used to treat a wide variety of diseases. Therefore, this invention can provide host bacteria with two self-complementary transgenic expression cassettes, which hybridize to form a double-stranded transgenic expression cassette during the production of phage particles in the host bacteria. This characteristic significantly expands the therapeutic application prospects of recombinant phages in gene therapy. This invention can be used preventively for disease prevention, and also for improving and / or treating diseases after their onset.

[0094] Therefore, in the eighth aspect, a phage vector according to the first aspect or a system according to the second aspect is provided for gene therapy technology.

[0095] In a ninth aspect, a method is provided for treating, preventing, or improving a disease in a subject using gene therapy technology, the method comprising administering to a subject in need of such treatment a therapeutically effective amount of a phage vector according to the first aspect or a system according to the second aspect.

[0096] It should be understood that the present invention can be used to construct a variety of different phage vectors, which, depending on their properties and the exogenous proteins they display, can be used to treat and / or diagnose a variety of diseases. For example, in embodiments where the phage vector contains a tumor-targeting ligand and / or contains a transgene expressing an anti-tumor gene (such as the herpes simplex virus thymidine kinase (HSVtk) gene), the vector can be used in combination with ganciclovir (GCV) for the treatment of cancer. The target cells in gene therapy are preferably eukaryotic cells, more preferably mammalian cells.

[0097] Therefore, this gene therapy technology is preferably used to treat, prevent, or improve cancer. The tumor may be located in the brain, such as medulloblastoma, glioblastoma, or diffuse engenerative pontine glioma (DIPG). This phage vector can be used in combination with conventional treatments, such as chemotherapy drugs (i.e., doxorubicin, temozolomide, lomustine), radiation therapy, immune checkpoint inhibitors (i.e., PD-1, PD-L1, or CTLA4 inhibitors) or other drugs / exogenous compounds, including but not limited to histone deacetylase inhibitors (HDAC inhibitors), proteasome inhibitors, and anticancer products from natural and dietary sources (e.g., genistein).

[0098] The inventors believe that the phage vector of the present invention has significant commercial value in delivering peptide and / or DNA and / or adjuvant vaccines.

[0099] Therefore, in a tenth aspect, a vaccine is provided which comprises a phage vector according to the first aspect or a system according to the second aspect.

[0100] In the eleventh aspect, a phage vector according to the first aspect or a system according to the second aspect is provided for delivering a vaccine to a subject.

[0101] Preferably, the vaccine is a peptide vaccine. More preferably, it is a DNA vaccine. The vaccine preferably contains a suitable adjuvant. In one embodiment, the phage vector can be used to carry a transgenic or DNA cassette encoding an antigen (i.e., at least two single-stranded self-complementary transgenic expression cassettes that hybridize to form a double-stranded transgenic expression cassette) to stimulate the body's immune system. The phage vector can also be used to directly display and express the target antigen on the major pVIII coat protein, thereby providing a highly efficient platform for simultaneous delivery of multiple antigens (as a DNA vaccine), proteins, or adjuvants readily expressed on the phage surface via a single phage particle. The subject can be a mammal, but is preferably a human.

[0102] Therefore, in the twelfth aspect, a phage vector according to the first aspect or a system according to the second aspect is provided for targeted delivery of exogenous antigens to the tumor of a vaccine subject.

[0103] First, animals are vaccinated with a foreign antigen vaccine, or animals that have already been vaccinated with a vaccine containing the antigen used. Then, tumor-targeting vectors are administered to vaccinated animals to deliver the foreign antigen to the tumor site, thereby inducing an immune attack against these tumors.

[0104] The inventors also believe that the phage vector of the present invention can be used in a variety of different genetic-molecular imaging techniques, such as positron emission tomography (PET), ultrasound (US), single-photon emission computed tomography (SPECT), functional magnetic resonance imaging, or bioluminescence imaging.

[0105] Therefore, in the thirteenth aspect, there is provided the use of a phage vector according to the first aspect or a system according to the second aspect in genetic molecular imaging techniques.

[0106] The transgene carried by the phage particle encodes herpes simplex virus thymidine kinase (HSVtk) and / or sodium / iodine cotransporter (NIS), and the particle is preferably used in conjunction with a radiolabeled substrate. For example, the human sodium / iodine cotransporter (NIS) imaging gene is preferably used in conjunction with I... 124 Combined with clinically applicable positron emission tomography (PET) imaging, or with I 125 / 99m Tc pertechnetate is used in combination for clinically applicable SPECT imaging.

[0107] Alternatively, the HSVtk gene is preferably used in combination with a radiolabeled nucleoside analog, such as 20-[18F]-fluoro-20-deoxy-1-bD-arabinofuranyl5-ethyluracil ([18F]FEAU).

[0108] It should be understood that the phage vectors and systems according to the present invention (hereinafter referred to as "reagents") can be used in pharmaceuticals, which can be used as a monotherapy, or as an adjunct to, or in combination with, the treatment, improvement or prevention of known diseases (such as cancer). For example, a treatment method that combines the phage particles and systems of the present invention with existing chemotherapeutic agents (such as temozolomide, doxorubicin or genistein) is preferred.

[0109] In another preferred embodiment, treatment may include the combined use of the phage vector and system of the present invention with an extracellular matrix degrading agent (such as an enzyme or losartan). The inventors believe that the extracellular matrix degrading agent should enhance the diffusion of the phage vector within the treated subject, particularly within solid tumors.

[0110] The reagents of the present invention (i.e., the phage carrier of the first aspect or the system of the second aspect) can be formulated into a variety of different compositions, depending on how the composition is used. Thus, for example, the composition can be in the form of powder, tablets, capsules, liquid, etc., or any other suitable form applicable to humans or animals requiring treatment. It should be understood that the carrier of the medicament of the present invention should be a carrier that is well tolerated by the treated subject.

[0111] Medicinal products containing the reagents of the present invention can be used in a variety of ways. For example, oral administration may be required, in which case the reagents may be contained in a composition that can be taken orally, for example, in tablet, capsule, or liquid form. Compositions containing the reagents of the present invention can be administered by inhalation (e.g., nasal inhalation). The compositions can also be formulated as topical preparations, for example, creams or ointments that can be applied to the skin.

[0112] The reagents of the present invention can also be incorporated into sustained-release or delayed-release devices. For example, such devices can be implanted on or under the skin, allowing for continuous release of the drug over weeks or even months. The device can be placed at least near the treatment site. Such devices may be particularly advantageous when long-term use of the reagents of the present invention is required for treatment, and when frequent administration (e.g., at least daily injections) is typically necessary.

[0113] In a preferred embodiment, the reagents and compositions of the present invention can be administered to a subject by injection into the bloodstream or by direct injection to the site of treatment. Injection methods include intravenous (bolus or infusion), subcutaneous (bolus or infusion), intradermal (bolus or infusion), intraperitoneal injection, or administration via convection enhancement (suitable for local injection at the disease site).

[0114] It should be understood that the required dosage of a reagent depends on its biological activity and bioavailability, which in turn depends on the route of administration, the physicochemical properties of the reagent (i.e., the phage vector or system), and whether it is used for monotherapy or combination therapy. The frequency of administration is also affected by the reagent's half-life in the treated subject. The optimal dosage can be determined by those skilled in the art and will vary depending on the specific agent used, the concentration of the pharmaceutical composition, the route of administration, and the progression of the disease. Other factors depending on the specific treated subject, including the subject's age, weight, sex, diet, and timing of administration, may also require dosage adjustments.

[0115] Typically, the daily dose of the reagent of the present invention is between 0.01 μg / kg body weight and 500 μg / kg body weight. More preferably, the daily dose is between 0.01 μg / kg body weight and 400 μg / kg body weight, and even more preferably between 0.1 μg / kg body weight and 200 μg / kg body weight.

[0116] The agent can be administered before, during, or after the onset of disease. For example, it can be administered immediately after the onset of disease in the subject. The daily dose can be administered once systemically (e.g., once daily injection). Alternatively, the agent may need to be administered two or more times a day. For example, the agent can be administered twice daily (or the frequency may be increased depending on the severity of the disease being treated), at doses ranging from 25 mg to 7000 mg each time (i.e., assuming a weight of 70 kg). The treated patient may receive the first dose upon waking and then the second dose in the evening (if it is a twice-daily dosing regimen), or every 3 or 4 hours after the first dose. Alternatively, a sustained-release device can be used to deliver the optimal dose of the agent of the present invention to the patient without repeated administration.

[0117] Known procedures, such as those routinely used in the pharmaceutical industry (e.g., in vivo experiments, clinical trials), can be used to prepare specific formulations containing the carrier or system described in this invention, as well as to develop precise treatment regimens (e.g., daily doses and dosing frequencies of reagents).

[0118] Therefore, in a fourteenth aspect of the invention, a pharmaceutical composition is provided comprising a phage vector according to the first aspect or a system according to the second aspect, and a pharmaceutically acceptable carrier.

[0119] This composition can be used to therapeutically improve, prevent, or treat any disease (such as cancer) that can be treated with gene therapy in a subject.

[0120] The present invention also provides, in its fifteenth aspect, a method for preparing a pharmaceutical composition according to the twelfth aspect, the method comprising contacting a therapeutically effective amount of a phage carrier according to the first aspect or a system according to the second aspect with a pharmaceutically acceptable carrier.

[0121] The “subject” can be a vertebrate, mammal, or livestock. Therefore, the reagents, compositions, and drugs of the present invention can be used to treat any mammal, such as livestock (e.g., horses or dogs), pets, or in other veterinary applications. However, most preferably, the subject is a human.

[0122] The "therapeutic effective dose" of the reagent (i.e., the phage vector) refers to the drug dose required to treat the target disease or produce the expected effect (such as achieving effective delivery of transgenes to target cells or tissues, thereby achieving tumor killing) when administered to a subject.

[0123] For example, the therapeutically effective dose of the reagent used may be from about 0.01 mg to about 800 mg, preferably from about 0.01 mg to about 500 mg.

[0124] The term "pharmaceutically acceptable carrier" as used herein refers to any known compound or combination of known compounds known to those skilled in the art and suitable for the formulation of pharmaceutical compositions.

[0125] In one embodiment, the pharmaceutically acceptable carrier can be a solid, and the corresponding composition can be in powder or tablet form. A pharmaceutically acceptable solid carrier can contain one or more substances that can also act as a flavoring agent, lubricant, solubilizer, suspending agent, dye, filler, flow aid, compression aid, inert binder, sweetener, preservative, coating agent, or tablet disintegrant. The carrier can also be an encapsulation material. In a powder, the carrier is a finely divided solid mixed with a finely divided active pharmaceutical agent according to the invention. In a tablet, the active pharmaceutical agent (e.g., the particles or system of the invention) can be mixed in appropriate proportions with a carrier having the necessary compressibility and compressed into the desired shape and size. Powders and tablets preferably contain up to 99% active pharmaceutical agent. Suitable solid carriers include, for example, calcium phosphate, magnesium stearate, talc, sugars, lactose, dextrin, starch, gelatin, cellulose, polyvinylpyrrolidone, low-melting-point waxes, and ion exchange resins. In another embodiment, the pharmaceutical carrier can be a gel, and the composition can be in the form of a cream, etc.

[0126] However, pharmaceutical carriers can also be liquids, and the corresponding pharmaceutical compositions are in solution form. Liquid carriers can be used to prepare solutions, suspensions, emulsions, syrups, elixirs, and pressurized compositions. The particles or systems according to the invention can be dissolved or suspended in pharmaceutically acceptable liquid carriers, such as water, organic solvents, mixtures of the two, or pharmaceutically acceptable oils. Liquid carriers may contain other suitable pharmaceutical additives, such as solubilizers, emulsifiers, buffers, preservatives, sweeteners, flavorings, suspending agents, thickeners, colorants, viscosity modifiers, stabilizers, or osmotic pressure modifiers. Examples of suitable liquid carriers for oral and injectable use include water (partially containing the above-mentioned additives, such as cellulose derivatives, preferably sodium carboxymethyl cellulose solution), alcohols (including monohydric and polyhydric alcohols, such as diols) and their derivatives, and oils (such as fractionated coconut oil and peanut oil). For injectable administration, the carrier can also be an oily ester such as ethyl oleate and isopropyl myristate. Sterile liquid carriers can be used to prepare sterile liquid compositions for injection. The liquid carrier of the pressurized composition may be a haloalkanes or other pharmaceutically acceptable propellants.

[0127] Liquid pharmaceutical compositions in the form of sterile solutions or suspensions can be administered, for example, by intramuscular, intrathecal, epidural, intraperitoneal, intravenous, and especially subcutaneous injection. The carrier or system can be prepared as a sterile solid composition, which can be dissolved or suspended in sterile water, physiological saline, or other suitable sterile injection media at the time of administration.

[0128] The phage carriers, systems, and pharmaceutical compositions of the present invention can be administered orally in the form of sterile solutions or suspensions containing other solutes or suspending agents (e.g., physiological saline or glucose sufficient to make the solution isotonic), bile salts, gum arabic, gelatin, sorbitan monooleate, polysorbate 80 (an oleate copolymerized from sorbitol and its anhydrides with ethylene oxide), etc. The particles and systems of the present invention can also be administered orally in the form of liquid or solid compositions. Compositions suitable for oral administration include solid forms (e.g., pills, capsules, granules, tablets, and powders) and liquid forms (e.g., solutions, syrups, elixirs, and suspensions). Forms suitable for parenteral administration include sterile solutions, emulsions, and suspensions.

[0129] It should be understood that adeno-associated virus (AAV) is often the preferred vector for gene therapy. Lentiviral vectors also offer several key advantages over other systems as gene delivery vectors. First, they have a large packaging capacity, capable of holding at least 8 kb of DNA, an important characteristic when packaging large expression cassettes containing tissue-specific promoters and transgenes. Second, lentiviral vectors not only differ in genomic structure from the simpler retroviruses but also can transduce non-dividing cells, a highly valuable property when considering their application as gene therapy vectors in non-proliferating tissues such as muscle, neurons, and hematopoietic stem cells. Furthermore, lentiviral vectors exhibit lower immunogenicity compared to adenoviral vectors, making systemic administration feasible. However, obstacles to the application of AAV or lentiviruses in laboratory and clinical studies include their extremely high production costs and low yields.

[0130] In addition to its practical value in gene therapy, imaging, and vaccine delivery, the phage vector of this invention can also be used to produce recombinant viral vectors, such as AAV or lentiviruses, in vitro or in vivo (including in situ). Phage-mediated AAV production utilizes the ability of phage vectors to package large amounts of single-stranded DNA (ssDNA). A typical AAV production system comprises three main components: recombinant adeno-associated virus (rAAV), the rep-cap gene, and an adenovirus helper gene, which work together to produce rAAV particles.

[0131] Therefore, in the sixteenth aspect, there is provided a use of the phage vector according to the first aspect or the system according to the second aspect for generating a recombinant viral vector, the recombinant viral vector comprising or derived from a viral genome within the genome of the phage vector.

[0132] In a seventeenth aspect, a method for producing a recombinant viral vector is provided, the method comprising introducing a phage vector according to a first aspect or a system according to a second aspect into a eukaryotic host cell, thereby enabling the host cell to produce a recombinant viral vector.

[0133] Preferably, the recombinant viral vector is a recombinant mammalian virus, rAAV, a recombinant self-complementary AAV vector, or a recombinant lentiviral vector. In other words, the recombinant viral vector can be a conventional AAV vector or a self-complementary AAV vector according to the first aspect. Preferably, the phage vector according to the first aspect or the system according to the second aspect is used in conjunction with the delivery and / or presence of other genetic elements determined by the genome of the phage vector required for the production of mammalian viruses within eukaryotic host cells, to function in cis and / or trans. Methods for assisting or enhancing the transfer of genes from phage particles to host cells include those described in WO2014 / 184528 (i.e., multifunctional) and WO 2014 / 184529 (i.e., binding with cationic polymers to form a complex with a net positive charge).

[0134] The eukaryotic host cell can be a mammalian cell. This host cell may comprise or be derived from human embryonic kidney cells (HEK293), fall armyworm pupa ovarian tissue cells (Sf9), or Chinese hamster ovary cells (CHO). Insect cells are also under consideration.

[0135] In one implementation, the host cell can be transformed by one or more phage vector genomes carrying genes selected from the group consisting of: rAAV genes, lentiviral genes, capsid genes, replication genes, accessory protein-coding genes, and any other genes required for mammalian viral expression and packaging.

[0136] For example, in phage vector-mediated production of rAAV / scAAV, the rAAV gene or scAAV sequence can be carried by a phage vector according to the first aspect, while the adenovirus helper gene and rep-cap gene can be carried by separate vectors or integrated into the eukaryotic host genome. Any combination of rAAV, rep-cap, and adenovirus helper genes can be carried by one or more vectors, i.e., in cis or trans configuration. Alternatively, in rAAV production, the rep-cap protein or adenovirus helper protein can also be integrated into or introduced into the eukaryotic host as a stably expressed helper DNA (such as a plasmid). In this case, the phage vector provides the recombinant viral genome for packaging into a recombinant virus, specifically determined by the transgenic expression cassette within the phage vector genome.

[0137] This method can be performed in vivo, in vitro, ex vivo, or in situ. For in situ production, the phage vector preferably contains a targeting portion for target eukaryotic cells that are designated eukaryotic hosts. Preferably, in in situ, ex vivo, and in vivo virus production, the designated eukaryotic host cell type is a diseased cell. Preferably, the diseased cell is a malignant tumor cell or a benign tumor cell. In ex vivo virus production, the eukaryotic host is preferably a derivative of any of the eukaryotic hosts listed above. The application of the phage vector and the genetic elements required to produce the recombinant virus (determined by the transgenic expression cassette in the phage vector) within the eukaryotic host cell can be as described above, either in a cis- or trans-acting configuration.

[0138] It should be understood that the present invention extends to any nucleic acid, peptide, or variant, derivative, or analog thereof that substantially comprises an amino acid or nucleic acid sequence of any of the sequences mentioned herein. The terms “substantially the amino acid / polynucleotide / peptide sequence,” “functional variant,” and “functional fragment” refer to a sequence having at least 40% sequence identity with an amino acid / polynucleotide / peptide sequence of any of the sequences mentioned herein, such as having 40% sequence identity with a nucleic acid as defined herein.

[0139] This invention also covers amino acid / polynucleotide / peptide sequences having higher sequence identity with any of the sequences mentioned herein, specifically, sequence identity greater than 65%, more preferably greater than 70%, further preferably greater than 75%, and even more preferably greater than 80%. Preferably, the amino acid / polynucleotide / peptide sequence has at least 85% identity with any of the sequences mentioned herein, more preferably at least 90% identity, further preferably at least 92% identity, even more preferably at least 95% identity, even more preferably at least 97% identity, more preferably at least 98% identity, and most preferably at least 99% identity.

[0140] Those skilled in the art should understand how to calculate the percentage of sequence identity between two amino acid / polynucleotide / peptide sequences. To calculate the percentage of sequence identity between two amino acid / polynucleotide / peptide sequences, the two sequences must first be aligned, and then the sequence identity value is calculated. The percentage of identity between two sequences may vary depending on the following factors: -(i) the sequence alignment method used, such as ClustalW, BLAST, FASTA, Smith-Waterman (implemented in different programs), or structure alignment based on three-dimensional structural comparison; -(ii) the parameters used in the alignment method, such as local versus global alignment, the pairing score matrix used (e.g., BLOSUM62, PAM250, Gonnet, etc.), and the gap penalty, such as functional form and constants.

[0141] After sequence alignment, there are many different methods to calculate the percentage consistency between two sequences. For example, the number of consistent sites can be divided by any of the following values: (i) the length of the shorter sequence; (ii) the length of the alignment; (iii) the average length of the two sequences; (iv) the number of non-vacancy sites; or (v) the number of equivalent sites after excluding protrusions. Furthermore, it is worth noting that percentage consistency is also closely related to sequence length. Therefore, the shorter a pair of sequences, the higher the sequence consistency may be due to chance factors.

[0142] Therefore, it should be understood that precise alignment of protein or DNA sequences is a complex process. The commonly used multiple sequence alignment program ClustalW (Thompson et al., 1994, *Nucleic Acids Research*, Vol. 22, pp. 4673-4680; Thompson et al., 1997, *Nucleic Acids Research*, Vol. 24, pp. 4876-4882) is the preferred method for generating protein or DNA multiple sequence alignments in this invention. The parameters applicable to ClustalW are as follows: For DNA alignment: Gap Open Penalty = 15.0, Gap Extension Penalty = 6.66, Matrix = Identity. For protein alignment: Gap Open Penalty = 10.0, Gap Extension Penalty = 0.2, Matrix = Gonnet. For DNA and protein alignment: ENDGAP = -1, GAPDIST = 4. Those skilled in the art will understand that adjusting these and other parameters may be necessary to obtain optimal sequence alignment results.

[0143] Preferably, the percentage consistency between two amino acid / polynucleotide / peptide sequences is calculated based on the alignment result using (N / T) × 100, where N is the number of positions in the two sequences that have the same residues, and T is the total number of positions compared, including vacancies, and may or may not include overhangs. Preferably, overhangs should be included in the calculation. Therefore, an optimal method for calculating the relative percentage consistency between two sequences includes: (i) performing sequence alignment using the ClustalW program with a suitable set of parameters (e.g., the parameters described above); and (ii) substituting the values ​​of N and T into the following formula: Sequence consistency = (N / T) × 100.

[0144] Those skilled in the art will be familiar with alternative methods for identifying similar sequences. For example, highly similar nucleotide sequences may be encoded by sequences that hybridize with the nucleic acid sequence described herein or its complementary sequence under stringent conditions. Stringent conditions refer to the hybridization of DNA or RNA bound to a filter membrane at approximately 45°C in 3-fold sodium chloride / sodium citrate (SSC), followed by washing at least once with 0.2-fold SSC / 0.1% sodium dodecyl sulfate (SDS) at approximately 20–65°C. Alternatively, highly similar polypeptides may differ from the sequence described herein by at least one, but less than five, ten, twenty, fifty, or one hundred amino acids.

[0145] Due to the degeneracy of the genetic code, any nucleic acid sequence can obviously be altered or changed without significantly affecting the protein sequence it encodes, thus creating functional variants. Suitable nucleotide variants are those whose sequences are altered by different codon substitutions encoding the same amino acid, resulting in synonymous mutations. Other suitable variants are those with homologous nucleotide sequences, but containing all or part of the sequence altered by different codon substitutions encoding amino acids, where the substituted amino acid has a similar biophysical side chain to the substituted amino acid, resulting in conserved mutations. For example, small nonpolar, hydrophobic amino acids include glycine, alanine, leucine, isoleucine, valine, proline, and methionine. Large nonpolar, hydrophobic amino acids include phenylalanine, tryptophan, and tyrosine. Polar neutral amino acids include serine, threonine, cysteine, asparagine, and glutamine. Positively charged (basic) amino acids include lysine, arginine, and histidine. Negatively charged (acidic) amino acids include aspartic acid and glutamic acid. Therefore, it should be understood which amino acids can be replaced by amino acids with similar biophysical properties, and those skilled in the art will know the nucleotide sequences encoding these amino acids.

[0146] All features described herein (including any appended claims, abstract, and drawings), and / or all steps of any disclosed method or process, may be combined with any of the foregoing aspects in any combination, except for combinations in which at least some of such features and / or steps are mutually exclusive. Attached Figure Description

[0147] To better understand the present invention and to illustrate how its embodiments are implemented, examples will be shown with reference to the accompanying drawings, wherein:

[0148] Figure 1A schematic diagram of a DNA construct of a single-stranded DNA vector derived from M13 phage in the prior art, namely adeno-associated virus / phage (“AAVP”), and a phage-particle adeno-associated virus (“PAAV”) vector in the prior art, is shown, and compared with the novel self-complementary phage particle of the present invention (“self-complementary phage”, hereinafter referred to as “self-complementary phage particle” or “scPhagemid”), which can be either M13 or AAV. In the present invention, a phage particle carrying two single-stranded self-complementary transgenic expression cassettes is used as a DNA backbone to induce hybridization of the transgenic cassettes in the host bacteria, subsequently producing a double-stranded transgenic cassette for packaging by a phage capsid. A “phage particle” is defined as a plasmid DNA containing the origin of phage replication, hence the name phage particle. Here, the inventors use phage particles as a DNA backbone to design a novel phage genome carrying two transgenic cassettes. The resulting double-stranded vector is a phage particle. The existing AAVP contains a complete phage genome and a single mammalian transgenic cassette flanked by ITR sequences derived from the AAV2 virus (6). On the other hand, the existing PAAV particles are based on phage particle design, containing a single transgenic cassette, and require an assistant phage to provide the structural genes during production (8). In contrast, the latest generation of phage vectors according to the present invention (i.e., "self-complementary phage particles" or "scPhagemid") carries an additional transgenic cassette compared to AAVP and PAAV. These two expression cassettes are identical, separated by ITR linkers from AAV, but in opposite directions; the first expression cassette extends along the 5' to 3' direction, while the second expression cassette extends along the 3' to 5' direction, as shown below. Figure 1 As shown, these expression cassettes are identical, but extend in opposite or antiparallel directions on either side of the ITR that separates them. A second AAV ITR is also included, located on the flank of one of the transgene expression cassettes. Similar to the case of PAAV, the helper phage provides the structural genes for the "single-stranded complementary phage," enabling it to replicate.

[0149] Figure 2 This demonstrates how the single-stranded self-complementary phage midparticle "scPhagemid" or "scPP" of the present invention enables hybridization between two complementary transgenic expression cassettes on both sides of the ITR linker, thereby producing a hairpin loop-like double-stranded DNA (dsDNA) transgenic expression cassette.

[0150] Figure 3A cloning strategy for constructing a phagemid backbone carrying complementary transgenic expression cassettes for the preparation of scPPs delivering green fluorescent protein (GFP) is illustrated. Using primers containing PciI restriction sites, a complete GFP transgenic expression cassette, from promoter to polyadenylated (poly A) signal, is amplified from a phagemid by polymerase chain reaction (PCR). This insert is then cloned into the PciI restriction sites of the same phagemid. The final phagemid contains two complementary GFP transgenic expression cassettes and two AAV2-ITRs, with a left ITR connecting the two cassettes and a right ITR flanking one cassette. These cassettes are identical but extend in opposite or antiparallel directions on either side of the left ITR, and hybridization can occur between the two complementary transgenic expression cassettes flanking the ITR connectors, forming double-stranded DNA.

[0151] Figure 4 The expression of green fluorescent protein (GFP) in B16-F1 cells is shown on day 5 after transduction with either RGD4C.scPP (i.e., the phage vector that forms a double-stranded DNA hairpin loop structure according to the present invention) or RGD4C.PAAV vector (i.e., the single-stranded phage vector used as a control). A) Cell microscopic imaging using fluorescence microscopy; B) Quantification of GFP-positive cells by flow cytometry analysis.

[0152] Figure 5 The constructs used to evaluate gene delivery efficiency are summarized as PAAV, scPP (the phage vector according to the invention), and cwPP. PAAV demonstrates a phage vector with a copy of an expression cassette flanked by an AAV ITR; scPP demonstrates the phage particle vector of the invention with two oppositely oriented expression cassettes that form double-stranded DNA; and cwPP demonstrates a control phage particle carrying two identically oriented Lucia transgenic expression cassettes, i.e., clockwise (cw), preventing these cassettes from hybridizing to form double-stranded DNA. Experiments used particles carrying the reporter gene Lucia or green fluorescent protein (GFP), as well as particles carrying the therapeutic genes tumor necrosis factor α (TNFα), interleukin-15 (IL15), and TRAIL.

[0153] Figure 6 The expression of the Lucia gene in B16-F1 melanoma cells was compared between those targeting RGD4C.scPP-Lucia (i.e., the phage vector of this invention) and those targeting RGD4C.PAAV-Lucia. Different doses of the vector were used: 25,000, 50,000, 100,000, 500,000, and 10... 6Transduction units (TU) / cell were used to transduce cells. Error bars represent the mean standard error (SEM). Statistical analysis was performed daily and per construct using one-way ANOVA, followed by selected multiple comparisons: pairwise comparisons between double-stranded and single-stranded vectors. Cells treated with RGD4C-deficient non-targeting vectors (scPP-Lucia or PAAV-Lucia) and untreated cells were also included in the experiments. Data are expressed as relative luminescent units (RLU). Experiments were repeated multiple times, with at least n = 5 biological replicates and n = 3 technical replicates per biological replicate.

[0154] Figure 7 It was confirmed that, under conditions of 100,000 TU / cell, the scPP vector (i.e., the phage vector according to the invention) was superior in B16-F1 cells to single-chain PAAV batches prepared by two different researchers.

[0155] Figure 8 The dosage of 10 was shown. 6 Example of data obtained from four experiments on B16-F1 cells using a TU / cell vector.

[0156] Figure 9 This shows a comparison of Lucia gene expression in B16-F1 melanoma cells at different doses, compared with... Figure 6 Similar to the previous method. Error bars represent the mean standard error (SEM). Statistical analysis was performed on day 1 and for each construct using one-way ANOVA, followed by selected multiple comparisons: pairwise comparisons between double-stranded and single-stranded vectors. Cells treated with the non-targeting vectors scPP or PAAV lacking RGD4C, as well as untreated cells, were also included in the experiment. Data are expressed as relative luminescent units (RLU). The experiment was repeated multiple times, with at least n = 5 biological replicates and n = 3 technical replicates per biological replicate.

[0157] Figure 10 The results show different dosages (100,000, 500,000 and 10). 6 Comparison of Lucia gene expression in human HEK293 cells at TU / cell. Error bars represent mean standard error (SEM). Statistical analysis was performed daily and per construct using one-way ANOVA, followed by selected multiple comparisons: pairwise comparisons between double-stranded and single-stranded vectors. Cells treated with the non-targeting vectors scPP or PAAV lacking RGD4C, as well as untreated cells, were also included in the experiment. Data are expressed as relative luminescent units (RLU). Experiments were repeated multiple times, with at least n = 5 biological replicates and n = 3 technical replicates per biological replicate.

[0158] Figure 11 The values ​​shown are 100,000, 500,000, and 10. 6 Comparison of Lucia gene expression in rhabdomyosarcoma (RMS) metastatic cancer cells at TU / cell doses. Error bars represent mean standard error (SEM). Statistical analyses were performed daily and per construct using one-way ANOVA, followed by selected multiple comparisons: pairwise comparisons between double-stranded and single-stranded vectors. Cells treated with RGD4C-deficient scPP or PAAV, as well as untreated cells, were also included in the experiments. Data are expressed as relative luminescent units (RLU). Experiments were repeated multiple times, with at least n = 5 biological replicates and n = 3 technical replicates per biological replicate.

[0159] Figure 12 It shows 500000 and 10 6 Comparison of Lucia gene expression in human A549 lung cancer cells under TU / cell conditions. Error bars represent standard errors (SEM). Statistical analysis was performed daily and per construct using one-way ANOVA, followed by selected multiple comparisons: pairwise comparisons between double-stranded and single-stranded vectors. Cells treated with the non-targeting vectors scPP or PAAV lacking RGD4C, as well as untreated cells, were also included in the experiments. Data are expressed as relative optical units (RLU). Experiments were repeated multiple times, with at least n = 5 biological replicates and n = 3 technical replicates per biological replicate.

[0160] Figure 13 Another researcher showed that at 100,000 and 10 6 Validation results of Lucia gene expression data in human A549 lung cancer cells under TU / cell conditions.

[0161] Figure 14 The expression of the Lucia gene in human MCF7 breast cancer cells at 100,000 TU / cell is compared. Error bars represent standard errors (SEM). Statistical analyses were performed daily and per construct using one-way ANOVA, followed by selected multiple comparisons: pairwise comparisons of double-stranded vectors versus single-stranded vectors. Cells treated with the non-targeting vectors scPP or PAAV lacking RGD4C, as well as untreated cells, were also included in the experiments. Data are expressed as relative light units (RLU). Experiments were repeated multiple times, with at least n = 5 biological replicates and n = 3 technical replicates per biological replicate.

[0162] Figure 15The results of ELISA quantification of secretory TNFα in B16-F1 cells on day 4 (D4) and day 6 (D6) after transduction with scPP (i.e., the phage vector described in this invention) or PAAV carrying the TNFα gene are shown. The transduction doses were 500,000 (500kJ) and 1×10⁻⁶, respectively. 6 (1M) or 4×10 6 (4M)TU / cell. Statistical analyses were performed daily and for each construct using one-way ANOVA, followed by selected multiple comparisons: pairwise comparisons of double-stranded and single-stranded vectors. Cells treated with the non-targeting vectors scPP or PAAV lacking RGD4C, as well as untreated cells, were also included in the experiment.

[0163] Figure 16 The following figures show the ELISA quantitative results of secreted IL15 in B16-F1 cells on day 4 after transduction with RGD4C.scPP (i.e., the phage vector described in this invention) or RGD4C.PAAV carrying the IL15 gene, with transduction doses of 500,000 (500kJ) and 10,000 kJ, respectively. 6 (1M) and 4×10 6 (4M)TU / cell. Statistical analyses were performed daily and for each construct using one-way ANOVA, followed by selected multiple comparisons: pairwise comparisons of double-stranded and single-stranded vectors. Cells treated with the non-targeting vector (M13) lacking RGD4C and untreated cells were also included in the experiment.

[0164] Figure 17 The following figures show the ELISA quantitative results of secreted IL15 in B16-F10 melanoma cells on day 4 after transduction with RGD4C.scPP (i.e., the phage vector described in this invention) or RGD4C.PAAV carrying the IL15 gene, with transduction doses of 500,000 (500kJ) and 10,000 kJ, respectively. 6 (1M) and 4×10 6 (4M)TU / cell. Statistical analyses were performed daily and for each construct using one-way ANOVA, followed by selected multiple comparisons: pairwise comparisons of double-stranded and single-stranded vectors. Cells treated with the non-targeting vectors scPP or PAAV lacking RGD4C, as well as untreated cells, were also included in the experiment.

[0165] Figure 18The results of ELISA quantification of secretory TRAIL in human osteosarcoma cells on day 4 after transduction with RGD4C.scPP (i.e., the phage vector described in this invention) or RGD4C.PAAV at 500,000 TU / cell are shown. Cells treated with empty RGD4C.scPP vector (vector without TRAIL gene or mimic vector) and untreated cells were also included in the experiment. Furthermore, RGD4C.scPP vector carrying transmembrane TRAIL (RGD4C.scPP-TRAIL) was used for cell transduction.

[0166] Figure 19 The study compared the effects of intravenous injection of 5 × 10⁶ mg / L in immunodeficient mice. 10 Gene delivery in subcutaneous solid tumors (human osteosarcoma) was investigated after administering RGD4C.scPP (i.e., the phage vector described in this invention) and RGD4C.PAAV vectors to mice per TU. Tumor and healthy tissues were collected on day 7 post-vector injection. Mice lacking RGD4C and treated with non-targeting vectors scPP or PAAV, as well as untreated mice, were also included in the experiment.

[0167] Figure 20 The diffusion of bacteriophages in Matrigel is shown. scPP and PAAV vectors were labeled with fluorescein isothiocyanate (FITC) and inoculated into Matrigel at a concentration of 5 mg / ml. Images were captured using a fluorescence microscope at inoculation (t=0) and 18 hours after inoculation (t=18).

[0168] Figure 21 The internalization of phage particles in B16-F1 cells is shown. A) Flow cytometry (FACS) analysis of cells using anti-phage antibodies; B) Quantitative polymerase chain reaction (qPCR) using primers targeting the ampicillin gene located outside the transgene expression cassette in the vector.

[0169] Figure 22 The transduction efficiency of scPP (i.e., the phage vector described in this invention) was compared with that of the control vectors cwPP and awPP. A) Schematic diagram of the three vectors used: ITR is shown in blue, and the transgene and its direction are also labeled. B) B16F1 cells were transduced using the vector encoding Lucia at a dose of 10. 6 TU / cell. This figure shows representative experimental results (n=3), which were repeated twice. Data are chemiluminescence detection values ​​on day 4 after transduction. One-way ANOVA was used to analyze statistical differences, with a significance level set at α=0.05.

[0170] Figure 23The transduction efficiency of scPP (i.e., the phage vector described in this invention) was compared with that of a mixed vector of cwPP and awPP. A) Schematic diagram of the transduction process and possible hybridization: ITR is shown in blue, and the transgene and its direction are also labeled. B) B16F1 cells were transduced using a vector encoding Lucia at a dose of 10. 6 TU / cell, or a dose of 5×10 5 TU / cell cwPP and dose of 5×10 5 Transduction was performed using a hybrid vector of TU / cell awPP. This figure shows representative experimental results (n=3), which were replicated twice; data are luminescence detection values ​​on day 4 post-transduction. One-way ANOVA was used to analyze statistical differences, with a significance level set at α=0.05.

[0171] Figure 24 The results of phage particle measurements based on transmission electron microscopy (TEM) images are shown. A) TEM images of different phage particles. B) Quantification results of phage particle size. Two different stock solutions were imaged for each phage particle, and 100 particles of each phage were quantified. One-way ANOVA was used to calculate statistical differences among the four samples; only pairwise comparisons with no statistically significant differences are shown in the figure.

[0172] Figure 25 The particle size determination analysis of scPP, PAAV, and helper phage vectors is shown. A) Two different preparations were analyzed for each vector, and a total of 100 particles were measured from the obtained transmission electron microscopy (TEM) images. B) Intact phage particles were loaded onto agarose gels under non-denaturing conditions.

[0173] Figure 26The diagram illustrates the self-hybridization of the transgenic expression cassette during the production of scPP (i.e., the phage vector described in this invention) in bacteria. A) Schematic diagram of the hypothetical scenario. This illustrates the hypothetical intramolecular hybridization of the scPP genome. This scenario would form a double-stranded DNA target within the transgene (orange box) that can be digested by BamHI. The digested genome should produce a 1898 bp double-stranded DNA fragment, which, upon denaturation, would form a 3796 bp single-stranded DNA band. B) Comparison between BamHI-digested and undigested scP-Lucia genome samples. C) Migration analysis of the denatured 1kb Plus DNA ladder: Equal samples of the 1kb Plus DNA ladder and the linearized pAAV GFP plasmid (5378 bp) were electrophoresed in their native and denatured forms on a 1M urea denaturing agarose gel. When the ladder sample was denatured, the 5000 bp DNA ladder band transformed into a double band. D) Verification of the ability of the scPP-Lucia phage genome to form double-stranded DNA fragments: The 1898bp fragment obtained by digesting the phage genome with BamHI was electrophoresed together with a 1kb Plus DNA ladder treated in the same way, in both native (left) and denatured (right) forms. The denatured sample migrated at the same speed as the 4000bp band in the DNA ladder.

[0174] Figure 27 The diagram illustrates the inhibitory effect of hydroxyurea (HU) on gene expression in PAAV vectors. A) The time curve of Lucia gene expression after transduction of B16-F1 cells with the vector in the presence of hydroxyurea. B) A control experiment was also conducted, in which cells received water instead of hydroxyurea. C) This figure shows the Lucia gene expression data on day 6 after transduction of B16-F1 cells in the presence of hydroxyurea. D) This figure shows the Lucia gene expression data on day 6 after transduction in the absence of hydroxyurea.

[0175] Figure 28 This study compares the efficacy of PAAV and scPP in delivering the Lucia reporter gene to metastatic human osteosarcoma 143B cells over a period of 1 to 3 days, with increasing vector dosage. Lucia expression is expressed as relative luminescent units (RLU). The vectors targeted tumor cells via the RGD4C ligand, with the non-targeting vector (NT) serving as a control.

[0176] Figure 29This study compares the efficacy of PAAV and scPP in delivering the secreted cytokine TRAIL (soluble TRAIL, sTRAIL) to metastatic human osteosarcoma 143B cells. The figure shows enzyme-linked immunosorbent assay (ELISA) data used to quantify the release of sTRAIL protein from cancer cell culture medium after carrier treatment.

[0177] Figure 30 This study demonstrates the induction of osteosarcoma cell death after treatment with scPP-sTRAIL, which encodes secretory sTRAIL, under in vitro conditions.

[0178] Figure 31 The results of the toxicity assessment are shown. No increase in lactate dehydrogenase (LDH), a toxicity biomarker for osteosarcoma, was observed in mice after administration of the RGD4C.scPP vector encoding sTRAIL.

[0179] Figure 32 The biodistribution of sTRAIL delivery was shown in established osteosarcoma-bearing mice following systemic administration of PAAV and scPP vectors encoding sTRAIL.

[0180] Figure 33 Immunofluorescence staining results of sTRAIL protein expression in tumors after treatment with RGD4C.PAAV and RGD4C.scPP, which encode sTRAIL, are shown. Higher levels of sTRAIL production were detected in mouse tumors treated with RGD4C.scPP.

[0181] Figure 34 The results of hematoxylin and eosin staining of the tumors are shown: mice treated with RGD4C.scPP-sTRAIL systemically showed extensive tumor damage compared with untreated mice or mice injected with non-targeted NT vectors. Detailed Implementation

[0182] Example

[0183] The inventors aim to provide a novel phage vector containing a self-complementary sequence of a transgenic expression cassette to achieve hybridization during production in host bacteria or transduction of mammalian cells, thereby delivering double-stranded DNA of the mammalian transgenic expression cassette. This novel phage vector addresses the problems associated with double-stranded phages due to their capsid and large genome, while also overcoming issues related to AAVs. In various embodiments, this novel phage vector is referred to as a self-complementary phage particle or scPP. To demonstrate that scPP's gene delivery performance is superior to existing technologies, the inventors used reporter genes such as green fluorescent protein (GFP) and luciferase. Subsequently, the inventors further validated the results using TRAIL or soluble TRAIL (sTRAIL) to demonstrate the unexpectedly superior performance of scPP particles in gene delivery. Furthermore, when using genes such as TRAIL, the inventors also observed cancer cell death, indicating that this vector can be used to deliver therapeutic genes.

[0184] Materials and methods

[0185] Molecular cloning of constructs

[0186] A green fluorescent protein (GFP) transgenic expression cassette, flanked by AAV2 ITR, was amplified from the pAAV-GFP plasmid (Cell Biolabs) from the promoter to the polyadenylation signal. Primers used contained PciI restriction sites. The plasmid backbone and PCR insert were then digested with PciI (NEB, UK) and ligated overnight using T4 ligase (NEB, UK). The construct was transformed into DH5α *E. coli*. Subsequently, plasmids were extracted from different bacterial colonies using a mini-extraction kit (Miniprep, Qiagen) and verified by restriction enzyme digestion and DNA sequencing (Eurofins). The correct clone was transformed into TG1 Mix&Go competent *E. coli* (Zymoresearch, USA) to generate phage vectors. A schematic diagram of the cloning strategy is shown below. Figure 3 To generate phage particles carrying TNFα, TRAIL, or IL15 transgenes, GFP is replaced with the corresponding DNA coding sequence.

[0187] bacteriophage production

[0188] The vector's backbone DNA construct was used to transform TG1 Mix&Go competent E. coli (Zymo Research, USA). The dual-tandem vector (encoding two co-directional transgenic copies of a control phage particle, either clockwise (cw) or counter-clockwise (aw)) was cultured in 2xYT medium until the absorbance (OD) at 600 nm was measured.600nm When the γ-ray concentration reaches 0.3-0.6, this value indicates that the bacteria are in the exponential growth phase. At this point, the bacterial culture is infected with the appropriate helper phage (either a targeted phage displaying RGD4C or a non-targeted (NT) M13 phage) and incubated at 37°C for 15 minutes. After incubation, the culture is added to 2xYT medium containing 50 μg / ml kanamycin and 100 μg / ml carbenicillin and incubated overnight at 32°C and 160 rpm. The next day, the culture is centrifuged at 4°C and 6000g for 15 minutes. The supernatant is collected and mixed with 0.4 volumes of 21 mM polyethylene glycol (PEG, molecular weight 8000) / 3.36 M sodium chloride / 1% Triton X-100 and incubated overnight at 4°C. Then, the solution is centrifuged at 4°C and 10000g for 30 minutes. The precipitate was resuspended in phosphate-buffered saline (PBS) and mixed with 0.5 volumes of 21 mM polyethylene glycol (PEG) / 3.36 M sodium chloride (NaCl), and incubated overnight at 4°C. Next, it was centrifuged at 10,000 g for 30 minutes at 4°C, and then resuspended in PBS by gentle shaking at 37°C and 120 rpm for 3 hours. The precipitate was then centrifuged at 10,000 g for 10 minutes at room temperature to remove residual bacterial contamination, and the resulting supernatant was filtered through a 0.45 μm filter. Subsequently, PCR was used to detect the presence of the RGD4C coding sequence in the pIII capsid protein gene to verify the targeting purity of the prepared phage, and further analysis was performed using a 2% agarose gel.

[0189] Titration of bacteriophage particles

[0190] Phage particles were quantified in prokaryotic hosts. Serial dilutions of phages were performed in PBS to infect TG1 *E. coli* grown in 2xYT medium to the logarithmic growth phase, followed by incubation at 37°C. After 20 minutes of incubation in a 37°C water bath, the phage / bacteria mixture was thoroughly remixed and spread onto solid agar plates containing a selective antibiotic. TYE top agar containing 100 μg / ml ampicillin was used because the phage particles contained an ampicillin resistance gene. TYE top agar containing 50 μg / ml kanamycin was used because the helper phages contained a kanamycin resistance gene. The concentration of scPP particles in the sample was determined by colony counting when the bacteria were spread onto ampicillin-containing TYE top agar; the concentration of helper phages was determined when spread onto kanamycin-containing medium. Phage particle concentrations were expressed as bacterial transduction units (TU / μl).

[0191] Intramolecular self-hybridization of transgene expression cassettes in self-complementary phage particles (scPP)

[0192] First, scPP was treated with DNAse-I, and then its genome was extracted. In short, the sample was treated with 100 mM Tris-HCl and 25 mM EDTA (pH 8), and 4% sodium dodecyl sulfate (SDS) was added. The mixture was incubated at 70°C for 10 minutes to lyse the phage capsid. Subsequently, 3 M potassium acetate (pH 5.5) was added to the sample, and the mixture was centrifuged at 12000 g for 10 minutes at room temperature to precipitate the phage capsid protein. The sample was then equilibrated using a 0.1 M sodium acetate (pH 5.0), 0.6 M sodium chloride, and 0.15% (v / v) Triton X-100 anion exchange column (Qiagen Midiprep kit). The supernatant was loaded onto the column and allowed to flow out by gravity. The column was then washed twice with 0.1 M sodium acetate (pH 5.0) and 825 mM sodium chloride, and the sample was eluted with QF elution buffer (Qiagen). The obtained sample was further purified by isopropanol-ethanol precipitation and finally resuspended in TE buffer (Qiagen).

[0193] The concentration of extracted phage genome was calculated based on single-stranded DNA samples (1 OD). 260 (Unit = 33 μg / ml single-stranded DNA). The genome was then digested with BamHI (NEB, UK) and subjected to agarose gel electrophoresis. A 2000 bp band was recovered using a gel extraction kit (Qiagen) and precipitated with isopropanol-ethanol. Aliquots of the extracted DNA bands and 1 kb Plus DNA ladder (Thermo Fisher) were mixed with a solution containing 0.5 mg / ml bromophenol blue, 8 M urea, 1% (v / v) Triton X-100, and 1 mM Tris pH 8. Half of each sample (extracted band and ladder) was denatured at 80°C for 5 min. Subsequently, the denatured and undenatured forms of the DNA ladder and extracted bands were loaded onto a denatured 1 M urea 1.2% agarose gel and electrophoresed at 55 V for 4 h on ice. The gel was then stained in TAE buffer containing 0.5 μg / μl ethidium bromide at room temperature for 2 h.

[0194] Because the molecular weight reference bands of the DNA ladder exhibit different migration behaviors under native and denaturing conditions, additional controls were used to confirm the migration of these reference bands. For this purpose, denatured samples of the linearized scPP-GFP plasmid (5378 bp) were electrophoresed side-by-side with the DNA ladder in a urea denaturing gel.

[0195] Cell transduction and Lucia expression

[0196] Seed adherent cells into appropriately sized well plates / tissue culture dishes, ensuring 70-80% cell confluence 48 hours post-seeding. On the day of transduction, determine the average cell count in each well / dish to calculate the required amount of phage particles to be added. Prepare the transduction mixture by diluting an appropriate amount of phage particle stock solution into serum-free medium and mixing thoroughly. The recommended volume of transduction mixture per well / dish is the minimum volume just enough to completely cover the cell monolayer. During transduction, discard the original culture medium, add the transduction mixture to the cells, and incubate at 37°C and 5% CO2 for 6-12 hours, then add an equal volume of complete culture medium. After 24 hours, discard all culture medium and replace with fresh medium. Maintain the transduced cells in culture until analysis.

[0197] Quantitative analysis of secretory luciferase expression in culture medium

[0198] At specific time points following transduction with phage particles carrying the Lucia DNA sequence, 10 μL of culture medium was collected from each well and transferred to opaque 96-well plates. Luciferase activity was quantified using QUANTI-Luc, with the luciferase substrate prepared according to the manufacturer's protocol (Invivogen, France) and added to the wells. Luciferase activity was measured using a GloMax Discover microplate luminescence detector (Promega, UK). The culture medium was not changed at any time point in these experiments.

[0199] GFP expression in transduced cells

[0200] Cells transduced with scPP-GFP and their transduction ratios were analyzed using FACS or fluorescence microscopy.

[0201] Transmission electron microscopy (TEM)

[0202] A copper mesh coated with a carbon film was subjected to glow discharge treatment to enhance its hydrophilicity. Phage particles were dropped onto the copper mesh and incubated for 10-15 minutes, after which excess liquid was blotted away with absorbent paper. The copper mesh was then rinsed with sterile filtered deionized water and blotted dry with absorbent paper, repeated twice, and dried for 15 minutes each time. A 1% uranium acetate solution was added to the copper mesh for negative staining of the particles; after 30 seconds, the mesh was rinsed twice with sterile filtered deionized water and dried. The copper mesh was imaged using a scanning electron microscope (JEOL JEM-2010, UK) and analyzed using ImageJ software.

[0203] Agarose gel analysis of bacteriophages

[0204] The phage stock solution was analyzed using a nanodrop spectrophotometer to identify 30 μg of phage samples. These samples were then loaded with 2x loading buffer (126 mM Tris-HCl, pH 6.8, 15%). Type 400 and 0.002% bromophenol blue were mixed in a 1:1 ratio and loaded onto a 0.8% agarose gel. The samples were electrophoresed at 50V for 5 hours, followed by fixation of the gel overnight with 10% acetic acid and 50% methanol. The next day, the gel was stained with Coomassie Brilliant Blue for 3 hours, then destained overnight with 20% methanol and 5% acetic acid. Bands were detected using a BioRad gel imaging system.

[0205] Fluorescent dye labeling of bacteriophage particles

[0206] Phage particles were labeled with FITC. 50 mL of phage particles (total volume 5 × 10⁻⁶) were added. 11 TU) was added to 200 μL of a solution containing 5 mg / mL FITC (Sigma, UK), and the mixture was rotated and mixed for 1 hour at room temperature in the dark. Then, a PEG / NaCl solution was added to a final concentration of 25-30%, and the phage particles were precipitated overnight at 4°C. The solution was centrifuged at 13000 rpm for 15 minutes, and the phage particle precipitate was collected. The precipitate was resuspended in 250 μL of PBS, and then precipitated again with PEG / NaCl. This process was repeated until free FITC was completely removed. Finally, the FITC-conjugated phage particles were resuspended in PBS, and their titer was determined by E. coli infection and colony counting.

[0207] Matrix gel diffusion of bacteriophage particles

[0208] 200 μl of Engelbreth-Holm-Swarm mouse sarcoma matrix gel (Sigma, UK) at a concentration of 2.5 mg / ml was added to a 48-well plate and then transferred to a 37°C environment. Simultaneously, FITC-labeled particles at a concentration of 5 μg / ml were prepared. 5 μl of each particle solution was aspirated into a gel loading tip, which was then inserted into the matrix gel to allow particle diffusion. Fluorescence images were then captured using a fluorescence microscope (Nikon Eclipse TE2000U, Japan) at 0 and 18 hours and analyzed using OpenLab imaging software.

[0209] Particle internalization

[0210] Use 1×10 6 TU / cell or 5×10 5FITC-labeled phage particles were used to transduce TU / cells. Six hours after transduction, cells were washed with PBS and then detached by treatment with 2 mg / ml ice-bath streptomycin for 10 minutes on ice. The streptomycin treatment was terminated with 20% fetal bovine serum (FBS), followed by centrifugation at 200g for 5 minutes at room temperature. The pellet was resuspended in 20% FBS and centrifuged again. The pellet was resuspended in 4% paraformaldehyde and incubated at room temperature for 10 minutes. After incubation, cells were centrifuged at 300g for 5 minutes at room temperature and blocked for 30 minutes at room temperature with a solution containing 0.1% saponin and 2% bovine serum albumin (BSA). Cells were centrifuged at 300g for 5 minutes at room temperature, and the pellet was treated with rabbit anti-fd phage antibody (Sigma 086K4860; 1:1000 dilution) diluted in PBS containing 0.1% saponin and 1% bovine serum albumin and incubated at room temperature for 1 hour. After incubation, cells were centrifuged under the same conditions and washed three times with PBS containing 0.1% saponin and 1% bovine serum albumin. Subsequently, cells were labeled with goat anti-rabbit Alexa Fluor-647 (Invitrogen 21245; 1:500 dilution) diluted in PBS containing 0.1% saponin and 1% bovine serum albumin, and incubated at room temperature in the dark for 1 hour. Cells were washed twice with PBS containing 0.1% saponin and finally resuspended in PBS.

[0211] Next, intracellular phage particles were analyzed by flow cytometry. FACS detection was performed using a BD FACscalibur flow cytometer (BD Biosciences) equipped with an argon ion laser (488 nm) and a red diode laser (635 nm). The mean fluorescence intensity and percentage were measured for at least 10,000 gated cells in each triplet well. The cell population was gated and analyzed using FACScalibur software.

[0212] Polyacrylamide gel electrophoresis (SDS-PAGE)

[0213] Add the loading dye (Laemmli buffer and β-mercaptoethanol) to the sample, then load the sample into 4-15% mini-PROTEAN TGX Stain-Free solution. TM In the gel. 10x Tris-glycine-SDS (Sigma) was used as the electrophoresis buffer, and NEB protein color standards were used as the protein ladder.

[0214] Determination of phage contamination

[0215] Phage samples were pretreated with DNase-I at 37°C for 30 minutes. Subsequently, DNase-I was inactivated by incubation with 50 mM EDTA at 65°C for 10 minutes; the phage capsid was lysed by heating at 95°C for 10 minutes with 1% SDS. The temperature was gradually reduced to 23°C in 3°C increments, and SDS was bound with 1% Triton X-100. The samples were then diluted 1:250 with DEPC water. Concentrations ranging from 2 × 10⁻⁶ were obtained using scPAAV and helper phage plasmids (as standards). 8 Up to 2×10 3 Standard curve of plasmid / μL.

[0216]

[0217] Tumor necrosis factor α (TNFα) enzyme-linked immunosorbent assay (ELISA)

[0218] Cells were transduced using phage particles, and the medium was replaced with fresh complete medium 24 hours after transduction. Conditioned medium was collected on day 4 after transduction and replaced with fresh medium, and conditioned medium was collected again on day 6 after transduction.

[0219] Enzyme-linked immunosorbent assay (ELISA)

[0220] The amount of IL15 produced in the supernatant after transduction was quantified using the mouse IL15 DuoSet ELISA kit (R&D Systems, UK).

[0221] Use ELISA MAX according to the manufacturer's instructions. TM The standard kit is used to quantify the concentration of tumor necrosis factor α (TNFα) in conditioned medium.

[0222] For the TRAIL ELISA, we coated plates with capture antibodies. Next, we washed the plates twice with wash buffer (PBS containing 0.05% Tween 20) and blocked them with PBS containing 1% BSA at room temperature for 1 hour. We washed the plates twice with wash buffer, added the samples, and incubated them at room temperature for 2 hours. Next, we incubated the detection antibodies at room temperature for 1 hour. Then, we added avidin-horseradish peroxidase D (avidin-HRP D) to each well, followed by the substrate solution.

[0223] result

[0224] Example 1 - Construction of a DNA backbone for hybridization of two self-complementary transgenic expression cassettes

[0225] Reference Figure 1 and Figure 2The diagram illustrates known adeno-associated virus / phage (“AAVP”) vectors (left) and known phage-particle adeno-associated virus (“PAAV”) vectors (middle), both derived from single-stranded M13 filamentous phages. AAVP contains the complete phage genome and a single mammalian transgenic expression cassette flanked by ITR sequences derived from the AAV2 virus; while PAAV is based on a phage particle design, containing a single transgenic expression cassette flanked by ITRs, and requires an assistant phage to provide structural genes during production. A problem with both AAVP and PAAV is that when processing mammalian cells, these vectors deliver single-stranded DNA of the transgenic expression cassette, which must be converted to double-stranded DNA for gene expression and transduction to occur. This process relies on mammalian cytokines, is inefficient, leads to delayed gene expression initiation, and results in slow and inefficient increases in gene delivery over time.

[0226] The inventors previously discovered that transducing cells using two phage vectors carrying complementary sequences of mammalian transgenic expression cassettes did not enhance gene delivery. Therefore, the inventors attempted to provide the complementary sequence of the transgenic expression cassette within a single phage vector. Figure 1 In other words, designing a phage vector that simultaneously carries a transgenic expression cassette and its complementary sequence to induce hybridization during: (i) cell transduction, or (ii) production and preparation in a bacterial host. Figure 2 ).

[0227] Figure 1 and Figure 2 (Right side) shows a single-stranded (SS) self-complementary phage particle backbone (“self-complementary phage particle or scPP”) used for phage production in this invention. In effect, this self-complementary phage particle backbone enables two single-stranded self-complementary transgenic expression cassettes to hybridize and form a double-stranded transgenic expression cassette. AAVP and PAAV contain only one copy of the expression cassette, while the scPP of this invention carries an additional transgenic expression cassette compared to AAVP and PAAV. The two expression cassettes are identical, separated by an inverted terminal repeat (ITR) linker, but their sequence reading directions are opposite; that is, the first expression cassette extends in the 5' to 3' direction, while the second expression cassette extends in the 3' to 5' direction, as shown below. Figure 1 As shown. Figure 2 As shown, the phage particle of the present invention enables hybridization between two self-complementary transgene expression cassettes on either side of the ITR linker, thereby forming a double-stranded DNA with a hairpin-like structure. Another AAV ITR is included to laterally attach to one of the transgene expression cassettes.

[0228] To avoid the potential impact of circular phage genomes on double-stranded DNA formation, the inventors used phage particles instead of phages to remove the phage genome, retaining only the f1 origin of replication, allowing the transgene expression cassette to replicate and be packaged in bacteria. Figure 1 and Figure 2 Since the phage genome is absent, helper phages are needed to infect bacteria to provide the structural genes encoding the capsid proteins required for packaging. Figure 1 and Figure 2 Bacteriophages are not tropism-dependent on mammalian cells; therefore, to enable the vector to enter cells, the inventors demonstrated a bicyclic RGD4C ligand on the helper phage (…). Figure 1 and Figure 2 This ligand has been extensively characterized and used for phage-mediated gene delivery. This ligand enables phages to enter mammalian cells by binding to the αvβ3 integrin heterodimer receptor, which is primarily expressed on the surface of cancer cells. The inventors used RGD4C / αvβ3 as a ligand-receptor system to demonstrate the conceptual feasibility of this novel platform technology.

[0229] In this novel design, two complementary mammalian transgenic expression cassettes are linked via an AAV2-derived ITR ( Figure 1 and Figure 2 The inventors also added a second ITR, which is laterally attached to the parental transgene expression cassette to protect it during cell transduction and improve its persistence over time. Figure 1 and Figure 2 ).

[0230] Example 2 - Compared with PAAV, scPP showed a significant increase in gene delivery.

[0231] In the first set of experiments, the inventors sought to investigate the gene delivery performance of a newly designed phage vector (scPP) to verify whether the scPP vector outperformed the corresponding single-stranded phage vector control (PAAV) in mammalian cells. Therefore, the inventors compared the gene expression of scPP and PAAV in parallel. For cell transduction, the inventors constructed a tumor-targeting phage particle that displayed a double-loop RGD4C in the pIII gene of the filamentous M13KO7 helper phage. The RGD4C ligand binds to the αvβ3 integrin heterodimer receptor, which is highly expressed on tumor cells and tumor blood vessels but almost undetectable in healthy tissues. This ligand has been widely used to deliver M13 phage vectors into mammalian cells. A non-targeting vector lacking RGD4C was also included in the experiments and added to the cells as a negative control.

[0232] First, the inventors used a vector expressing the green fluorescent protein (GFP) reporter gene ( Figure 3The study used RGD4C to treat mouse melanoma B16-F1 cells, which express the αvβ3 receptor for the RGD4C ligand. Microscopic analysis of GFP expression on day 4 post-transduction showed that B16-F1 tumor cells transduced with RGD4C.scPP-GFP produced significantly more GFP than those treated with RGD4C.PAAV-GFP. Figure 4 A). Furthermore, flow cytometry analysis of GFP expression showed that RGD4C.scPP-GFP-induced GFP expression was dose-dependent, with a significant increase in expression at 10... 6 At TU / cell, the proportion of GFP-positive cells exceeded 35%; in contrast, RGD4C.PAAV-GFP at 10 6 When TU / cells were used, the proportion of GFP-positive cells was less than 5%. Figure 4 B). Importantly, no GFP expression was detected in cells treated with non-targeted phage particles (NT) lacking the RGD4C ligand, demonstrating that gene delivery by the targeted particles was selective for integrin-expressing cells and mediated by the RGD4C ligand. Figure 4 B).

[0233] Next, to verify these data, the inventors used particles carrying the reporter gene encoding secreted Gaussian luciferase (Lucia) to perform a comprehensive quantitative analysis of gene delivery (8,16). Figure 5 Gene expression was quantified by analyzing luciferase activity in the growth medium. The inventors tested different doses of the particles and assessed gene expression over several days. Furthermore, the inventors collected a group of tumor cell lines from different species and histological origins to rule out the possibility that the observed gene delivery efficiency of RGD4C.scPP was species- or histology-specific. Transduction experiments used mouse melanoma B16-F1 cells, B16-F10 cells, and RMS metastatic melanoma cells. The inventors also included human MCF7 breast cancer cells, A549 lung cancer cells, and human osteosarcoma cells. In addition, the inventors tested these vectors on human embryonic kidney HEK293 cells, as this cell type is widely used for routine gene delivery, viral and non-viral transduction, and DNA transfection experiments, and has previously been used as a standard in vitro model for phage-mediated gene delivery. Data showed that gene expression of RGD4C.scPP particles was detectable as early as 1 to 2 days after treatment at all tested doses and gradually increased over time. Figures 6-14 In contrast, gene expression initiation of RGD4C.PAAV was delayed, and its expression level was consistently significantly lower than that of RGD4C.scPP across all tested time points, dosages, and cell lines. Figures 6-14 The non-targeted particles, used as a control, showed no gene expression. Figures 6-14These findings suggest that the observed enhanced gene expression may be due to earlier induction, more successfully transduced cells, or the combined effect of two non-mutually exclusive events.

[0234] Finally, to demonstrate that the advantages of scPP in gene delivery are not limited to reporter genes, namely GFP or Lucia, but can also be applied to therapeutic genes, the inventors constructed a vector carrying two cytokines, tumor necrosis factor α (TNFα) and interleukin-15 (IL15), which are used in cancer immunotherapy (8). After phage transduction, the protein expression levels of these two cytokines in the cell culture medium were detected by ELISA. Similarly, the data showed that, compared with PAAV, the newly designed scPP particles expressed significantly higher levels of TNFα and IL15 in the cell culture medium (8). Figures 15-17 The inventors also constructed a vector carrying another cytokine—tumor necrosis factor-associated apoptosis-inducing ligand (TRAIL)—and further demonstrated that scPP produced significantly higher levels of TRAIL in the supernatant of human osteosarcoma cells compared to PAAV-treated human osteosarcoma cells. Figure 18 ).

[0235] Example 3 - Comparison of in vivo gene delivery in mouse solid tumors after systemic administration

[0236] To translate these findings into in vivo studies, the inventors compared gene delivery of scPP and PAAV after intravenous administration to tumor-bearing mice. They used a vector for delivering TRAIL and injected it into immunodeficient mice with established human subcutaneous xenografts (osteosarcoma). For this purpose, tumor-bearing mice were administered 5 × 10⁵ doses, the same dosage previously used for phage vectors. 10 TU / animal, and then the expression of TRAIL mRNA transcripts in tumors was identified by reverse transcription real-time quantitative PCR (RT-qPCR). Figure 19 Parallel biodistribution studies of scPP and PAAV were also conducted in tumor-bearing mice to analyze gene delivery in tumors and major internal organs. These biodistribution experiments were conducted to ensure that gene expression following intravenous administration of RGD4C.scPP particles was selective for established tumors in mice, but absent in healthy tissues (expression in healthy tissues may lead to off-target effects). Compared to mice injected with RGD4C.PssAAV, mice injected with RGD4C.scPP showed significantly higher detected TRAIL mRNA transcript expression in tumors. Figure 19Furthermore, TRAIL expression in healthy tissue was negligible, similar to the control group, indicating that RGD4C.scPP can efficiently and systemically target tumors without affecting other major internal organs. Non-targeting particles did not show significant expression in tumors or any of the organs studied.

[0237] Example 4 - Study on transgenic expression mechanism

[0238] To understand the molecular mechanism of scPP-mediated transgene expression and why it is superior to PAAV, the inventors studied the extracellular and intracellular fate of the particles after processing mammalian cells and conducted parallel comparisons between scPP and PAAV at each step of gene delivery.

[0239] diffusion via extracellular matrix (ECM)

[0240] Diffusion efficiency was assessed using FITC-labeled particles and their migration ability in the matrix support. Figure 20 No significant differences were detected between the two constructs, suggesting that they exhibit similar diffusion characteristics via the extracellular matrix (ECM). This is consistent with previous studies reporting that the diffusion of M13 phage vectors is determined by particle size (8). Indeed, ECM analysis of scPP and PAAV showed no difference in particle size between the two types of particles.

[0241] Internalization

[0242] Next, the inventors attempted to investigate the entry of bacteriophages into transduced cells. To this end, B16-F1 cells were transduced, and treated 6 hours post-transduction using two different methods. The first method involved staining the particles with an anti-fd bacteriophage antibody and quantifying them by flow cytometry. Figure 21 A). The second method involves extracting DNA and targeting the ampicillin gene present in the phage particle, then quantifying it using qPCR. Figure 21 B). No difference was detected again between the two types of particles.

[0243] Example 5 - The improved scPP gene delivery efficiency was not due to the presence of two transgene expression cassettes.

[0244] Since the two vectors showed no difference in extracellular matrix diffusion and cell entry, to further understand the mechanism behind the differences between scPP and PAAV, the inventors investigated whether the gene delivery advantage of scPP was due to its carrying of an additional transgene expression cassette. Therefore, the inventors constructed a control vector containing two copies of the transgene expression cassette, but in the same orientation, clockwise (cw), to avoid any sequence complementarity and hybridization. This vector was named clockwise phage particle or cwPP ( Figure 22A). To account for any potential effects from the specific orientation of the two transgenic expression cassettes, a second control vector was constructed in which both transgenic expression cassettes were oriented counterclockwise (aw), named awPP. Figure 22 A). Subsequently, scPP and the control vector were transduced in parallel, and the results showed that the scPP vector was more efficient than the two controls, cwPP and awPP. Figure 22 B). Furthermore, to investigate whether intermolecular hybridization between complementary transgenic sequences provided in different vectors could achieve an efficiency comparable to scPP, the inventors performed simultaneous transduction using cwPP and awPP vectors ( Figure 23 A). Although this synchronous transduction is more efficient than using cwPP and awPP alone, it is still less efficient than scPP. Figure 23 B). Overall, these data suggest that the observed improvement in scPP vector efficiency is related to its ability to achieve successful intramolecular hybridization.

[0245] Example 6 - Particle Size

[0246] The similarity of cPP and PAAV particles in terms of diffusion and internalization suggests that there is no difference in size between the two particles, consistent with recent reports (8). Therefore, the inventors hypothesize that scPP should be able to package compressed genomes, thus forming particles similar in size to PAAV particles. As a preliminary study, the inventors analyzed scPP and PAAV particles by transmission electron microscopy (TEM) and quantified the length of individual phage particles ( ). Figure 24 Helper phages were also analyzed to help identify helper phage populations in scPP and PAAV formulations. Importantly, TEM imaging showed that scPP and PAAV particles were extremely similar in size. Figure 24 To further confirm these findings, the inventors also analyzed the size of the cwPP particles using electron microscopy, discovering that the size of the cwPP carrier was increased compared to scPP. Figure 24 The above results were verified in parallel by agarose gel electrophoresis of intact phage particles. Figure 25 ).

[0247] In summary, these findings suggest that scPP is a more efficient vector than PAAV. Since no differences were detected in diffusion and cell entry, this difference is likely related to their different genome designs. The similar particle size of the two vectors also supports this, likely because self-complementary phage particles (scPP) package a more compact genome, which may result from self-hybridization between the two complementary transgenic expression cassettes. In fact, the fact that control particles encoding two copies of the same transgenic expression cassette failed to achieve the transduction efficiency of scPP suggests that the presence of a dual transgenic expression cassette load (whether alone or in combination) is not the direct cause of the efficiency improvement, but rather supports the self-hybridization of double-stranded DNA transgenic expression cassettes formed during phage production, which is the underlying mechanism behind the advantage of scPP.

[0248] Example 7 - scPP capsid packaging double-stranded transgenic DNA expression cassette

[0249] To demonstrate that the scPP genome can form a double-stranded DNA structure and be packaged as double-stranded DNA by a phage capsid, the inventors extracted the scPP genome from the phage capsid / particle and then digested it with BamHI, a double-stranded DNA digesting enzyme whose target sequence is located within the transgene expression cassette. In other words, successful digestion with BamHI can only occur in the presence of double-stranded DNA. Figure 26 A). As expected, a 1898 bp band was detected in the digested sample, while the band was not detected in the undigested control. Figure 26 B). To further confirm that the band was indeed produced by the self-hybridization of a single-stranded DNA molecule, the inventors hypothesized that under denaturing conditions that cause DNA dishybridization, the molecule would unfold and migrate as a 3796kb band. Figure 26 A).

[0250] Under denaturing conditions, a 5000 bp DNA ladder band produced two distinct bands (due to the separation of their complementary strands). Figure 26 C), indicating that the 4000bp reference band corresponds to the sixth band in the mutation ladder. As assumed, the extracted band in the mutation form is expected to be 3796bp in length, and its migration rate is approximately the same as that of the 4000bp band in the mutation ladder. Figure 26 D).

[0251] These findings provide strong evidence that the phage capsid packages a double-stranded DNA transgenic expression cassette during bacterial production, due to self-hybridization of its two complementary transgenic expression cassettes during scPP preparation in the host bacteria.

[0252] Example 8 - Delivery of double-stranded transgenic expression cassettes by scPP particles during transduction of mammalian cells

[0253] Next, the inventors attempted to investigate whether scPP vectors could deliver double-stranded transgenic expression cassettes that did not require the host cell to synthesize the complementary strand of the cassette during transduction and gene expression. In fact, the inventors hypothesized that if these vectors could deliver double-stranded transgenic expression cassettes upon entering mammalian cells, then the role of host cell DNA synthesis in transduction could be eliminated.

[0254] The inventors compared the performance of the scPP-Lucia vector and PAAV-Lucia in B16-F1 cells pretreated with hydroxyurea (HU) 24 hours prior to transduction to inhibit host cell DNA synthesis. After transduction, treatment with the same concentration of hydroxyurea was continued uninterrupted until Lucia expression was detected. Importantly, unlike conventional single-stranded phage vectors (PAAV), the DNA replication inhibitor hydroxyurea did not affect the transduction of the scPP vector. Figure 27 In contrast, hydroxyurea suppressed PAAV gene expression. Figure 27 These data indicate that scPP transduction is independent of DNA synthesis, and consequently, independent of the conversion of the transgenic expression cassette from single-stranded to double-stranded.

[0255] Example 8 - Comparison of Lucia reporter gene delivery

[0256] refer to Figure 28 This study compares the delivery of the Lucia reporter gene by PAAV and scPP in human metastatic osteosarcoma 143B cells from day 1 to day 3 post-treatment, with gradually increasing vector doses. On days 1 and 2 post-transduction, no Lucia gene expression was observed in the control group (untreated and non-targeted groups). However, on day 1 post-transduction, at doses of 500,000 and 1,000,000 TU / cell, Lucia gene expression was observed in the RGD4C.scPP treatment group, but not in the PAAV treatment group. This confirms the effectiveness of self-complementary scPP vectors in immediate gene expression. On days 2 and 3 post-transduction, at doses ranging from 100,000 to 1,000,000 TU / cell, Lucia expression levels were higher in the RGD4C.scPP treatment group than in the RGD4C.PAAV treatment group.

[0257] method:

[0258] 143B cells were seeded in 96-well plates to achieve 60-70% confluence 48 hours after seeding. On the day of transduction, the average cell count per well or per culture plate was calculated, and based on this, the amount of tumor-targeting RGD4C-PAAV or scPP particles carrying the secretory luciferase (Lucia) gene to be added to the culture system was calculated. Non-targeting (NT) phages carrying the same gene and untreated cells were used as controls. Subsequently, an appropriate amount of particle stock solution was diluted in DMEM medium containing 10% serum and thoroughly mixed to prepare the transduction mixture. The concentration range of the transduction mixture was 100,000 to 1,000,000 transduction units (TU) per cell. The recommended volume of transduction mixture per well was the minimum amount (50 μL) sufficient to completely cover the cell monolayer. 24 hours after transduction, DMEM medium containing 10% serum was added to the culture medium to a final volume of 150 μL. Transduced cells were cultured until analysis was performed (from day 1 to day 3).

[0259] To assess and quantify gene expression, for phage particles (PAAV or scPP) carrying a secretory luciferase reporter gene, 10 μl of culture medium was taken each day after transduction to detect luciferase activity: the sample was mixed with 25 μl of QUANTI-Luc... TM The reagent (InvivoGen, USA) was mixed for 5 minutes, then... The Navigator microplate luminescence detector (Promega, USA) was used for testing, with an integration time of 0.1 seconds.

[0260] Example 9 - Comparison of delivery of the secreted cytokine sTRAIL to human metastatic osteosarcoma 143B cells

[0261] refer to Figure 29 This study illustrates the expression of the sTRAIL gene in the culture medium of human metastatic osteosarcoma 143B cells transfected with PAAV or scPP DNA constructs. Untreated cells and cells treated with the transfection reagent served as controls. sTRAIL protein levels (pg / ml) were detected using a TRAIL ELISA kit. The experiment was performed in triplicate. Statistical analysis was performed using independent t-tests, one-way ANOVA, and Tukey's HSD post-hoc test. All results are expressed as mean ± standard error (SEM). ***P < 0.01, ****P < 0.001. The data show that cells transfected with the scPP-sTRAIL DNA construct expressed higher levels of sTRAIL in the culture medium than cells transfected with the PAAV-sTRAIL DNA construct.

[0262] method:

[0263] 143B cells were seeded into 6-well culture plates to achieve 80% confluence after 24 hours of culture. Before transfection, the culture medium was replaced with low-serum medium (Opti-MEM, Thermofisher, UK) and left for 2 hours. The transfection mixture was prepared by adding 2 μg of PAAV-sTRAIL or scPP-sTRAIL DNA construct to 6 μl of low-serum medium. Mix with HD (Promega, UK). Incubate the mixture at room temperature for 20-25 minutes. Next, add the mixture dropwise to a culture plate containing low-serum medium and cells. Then, return the cells to the incubator and incubate for 48 hours. Finally, collect the medium and quantify TRAIL levels by ELISA. *sTRAIL = secreted TRAIL. The level of secreted sTRAIL in the supernatant was detected using a Human TRAIL / TNFSF10 DuoSet ELISA kit (R&D Systems, UK). The assay was performed according to the manufacturer's specifications.

[0264] Example 10 - In vitro induction of osteosarcoma cell death after treatment with scPP-sTRAIL, which encodes secreted sTRAIL.

[0265] refer to Figure 30 The study showed that the RGD4C.scPP-sTRAIL particle treatment group had lower, dose-dependent cell viability. Data are expressed as a percentage of cell viability relative to untreated cells. The experiment was performed in three biological replicates. Statistical analysis was performed using one-way ANOVA and Tukey's HSD post-hoc test. All results are expressed as mean ± standard error (SEM). **P < 0.05.

[0266] method:

[0267] 143B cells were seeded into 6-well culture plates to achieve 60-70% confluence 48 hours after seeding. On the day of transduction, the average cell count per well was calculated, and based on this, the amount of tumor-targeting RGD4C.scPP particles carrying the secretory TRAIL (sTRAIL) gene to be added to the culture was determined. Non-targeting (NT) phages carrying the same gene and untreated cells were used as controls. Subsequently, an appropriate amount of the particle stock solution was diluted in DMEM medium containing 10% serum and thoroughly mixed to prepare the transduction mixture. The concentration range of the transduction mixture was 500,000 to 1,000,000 transduction units (TU) per cell (shown as 0.5 and 1.0 in the graph, respectively). The recommended volume of transduction mixture per well was the minimum amount (1 ml) sufficient to completely cover the cell monolayer. 24 hours after transduction, DMEM medium containing 10% serum was added to a final volume of 2 mL. Transduced cells were cultured for another 3 days. Cell death was assessed using cell viability assays.

[0268] CellTiter-Glo luminescent cell viability assay: An equal volume of CellTiter-Glo reagent (Promega, UK) was added to the culture medium in the wells containing transduced cells, and the mixture was then stirred on an orbital oscillator for two minutes to induce cell lysis. Next, the mixture was incubated at room temperature for 10 minutes to stabilize the luminescence signal, and then transferred to a microplate luminescence analyzer. The signal was detected using the GloMax Navigator microplate luminescence analyzer (Promega, UK).

[0269] Example 11 - Toxicity Assessment. The toxic biomarker lactate dehydrogenase (LDH) was not elevated in mice.

[0270] refer to Figure 31 The results show that, compared with untreated mice, mice treated with scPP-sTRAIL and PAAV-sTRAIL particles did not exhibit elevated serum LDH levels. This data indicates that both PAAV and scPP are safe for in vivo treatment. LDH data are expressed as relative values ​​to the untreated group. The experiment was performed in three biological replicates. Statistical analysis was performed using one-way ANOVA and Tukey's HSD post-hoc test. No statistically significant differences were found in this study.

[0271] method:

[0272] Athymic mice (BALB / c nu / nu, 8-10 weeks old) were purchased from Charles River Laboratories, UK. 143B cells were administered at a rate of 2 × 10⁶ cells per mouse. 6 Human OS cells (human osteosarcoma cells) were established by subcutaneous inoculation into athymic mice. On days 3, 5, and 9 of the experiment, tumor-bearing mice were intravenously injected with targeted (RGD4C) or non-targeted (NT) phage particles (PAAV or scPP) carrying the sTRAIL gene at a dose of 5 × 10⁶ cells per mouse. 10 TU. At the end of the experiment (day 10), mice were sacrificed via cardiac perfusion. Whole blood was then collected from the heart and centrifuged at 1600g for 15 minutes to prepare serum samples. LDH levels in the serum were measured to assess the toxicity of the phage treatment. CytoTox was used in this experiment. Non-radioactive cytotoxicity assay kit (Promega, UK). The assay procedure was performed according to the manufacturer's specifications.

[0273] Example 12 - Biodistribution of sTRAIL delivery in tumor-bearing mice with established osteosarcoma models

[0274] refer to Figure 32The data show the relative expression levels of the human TRAIL gene in different mouse organs (relative to the untreated group) after treatment with PAAV or scPP particles carrying the sTRAIL gene. RGD4C.scPP-sTRAIL particles most effectively targeted tumors and delivered the gene, followed by RGD4C.PAAV-sTRAIL. Non-targeting particles did not show significant expression in tumors or any other organs. This experiment was performed in three biological replicates. Statistical analysis was performed using two-way ANOVA and multiple comparison t-tests. All results are expressed as mean ± standard error (SEM). ***P < 0.01.

[0275] method:

[0276] Athymic mice (BALB / c nu / nu, 8-10 weeks old) were purchased from Charles River Laboratories, UK. 143B cells were administered at a rate of 2 × 10⁶ cells per mouse. 6 Human OS cells were established by subcutaneously inoculating athymic mice with a certain number of cells. On days 3, 5, and 9 of the experiment, tumor-bearing mice were intravenously injected with targeted (RGD4C) or non-targeted (NT) phage particles (PAAV or scPP) carrying the sTRAIL gene at a dose of 5 × 10⁶ cells per mouse. 10 TU. At the end of the experiment (day 10), mice were sacrificed via cardiac perfusion. Tumor and normal organs were collected, including lung, liver, spleen, heart, kidney, pancreas, and brain. Total RNA was extracted from these organs, and the expression of human TRAIL was detected by reverse transcription-quantitative polymerase chain reaction (RT-qPCR).

[0277] Example 13 - After treatment with RGD4C.PAAV and RGD4C.scPP encoding sTRAIL, the sTRAIL protein expression was displayed. Immunofluorescence staining of the tumor

[0278] refer to Figure 33 Confocal microscopy analysis revealed that TRAIL expression (green) was detected only in tumors treated with RGD4C.PAAV.sTRAIL and RGD4C.scPP.sTRAIL. Higher TRAIL expression was observed in scPP-treated tumors. These findings suggest that RGD4C.scPP.sTRAIL effectively and comprehensively targets tumors. Non-targeted (NT) phage particles did not show significant TRAIL expression in tumors.

[0279] method:

[0280] Athymic mice (BALB / c nu / nu, 8-10 weeks old) were purchased from Charles River Laboratories, UK. 143B cells were administered at a rate of 2 × 10⁶ cells per mouse. 6Human OS cells were established by subcutaneously inoculating athymic mice with a certain number of cells. On days 3, 5, and 9 of the experiment, tumor-bearing mice were intravenously injected with targeted (RGD4C) or non-targeted (NT) phage particles (PAAV or scPP) carrying the sTRAIL gene at a dose of 5 × 10⁶ cells per mouse. 10 TU. At the end of the experiment (day 10), mice were euthanized by cardiac perfusion. Tumors were collected and frozen sectioned. Human TRAIL expression in tumor tissue was detected by immunofluorescence staining. TRAIL expression was assessed using anti-human TRAIL antibody on frozen sections (6 μm) of the optimal cutting temperature compound (OCT). Sections were fixed at room temperature for 15 minutes in 4% paraformaldehyde (Merck, Darmstadt, Germany). Then, sections were incubated for 1 hour in 5% normal goat serum in TBS (Tris-buffered saline) containing 0.3% Triton-X, followed by incubation with primary antibody (rabbit anti-human TRAIL polyclonal antibody, Thermo Fisher Scientific, UK). Subsequently, tissue sections were incubated with Alexa in TBS containing 1% filtered bovine serum albumin and 0.3% Triton-X. 488-conjugated goat anti-rabbit IgG was incubated for 30 minutes. After washing three times with PBS, the slides were mounted with Prolong Gold anti-fluorescence quenching mounting medium (Life Technologies, UK). The cell sections were imaged using a DMi8 advanced confocal fluorescence microscope (Leica Microsystems, Wetzlar, Germany).

[0281] Example 14 - Hematoxylin-eosin staining of tumors showing extensive damage after systemic treatment

[0282] refer to Figure 34 The results of hematoxylin-eosin staining of tumors were shown. Compared with untreated mice or mice treated with non-targeted (NT) vectors, tumors treated with RGD4C.scPP-sTRAIL systemically showed extensive damage.

[0283] method:

[0284] Athymic mice (BALB / c nu / nu, 8-10 weeks old) were purchased from Charles River Laboratories, UK. 143B cells were administered at a rate of 2 × 10⁶ cells per mouse. 6 Human OS cells were established by subcutaneously inoculating athymic mice with a certain number of cells. On days 3, 5, and 9 of the experiment, tumor-bearing mice were intravenously injected with targeted (RGD4C) or non-targeted (NT) phage particles (PAAV or scPP) carrying the sTRAIL gene at a dose of 5 × 10⁶ cells per mouse. 10TU. At the end of the experiment (day 10), mice were euthanized by cardiac perfusion. Tumors were collected and processed for cryosectioning. Optimal cutting temperature complex (OCT) cryosections (6 μm) of the tissue were prepared and stained with hematoxylin and eosin.

[0285] in conclusion

[0286] The inventors have constructed a novel phage vector containing a complementary single-stranded sequence of a transgene expression cassette to induce hybridization during cell transduction or production and manufacturing in bacterial hosts. In vitro experiments using various cell lines and transgenes revealed a remarkably high transduction efficiency (3- to 15-fold) for the self-complementary phage particles (scPP) compared to conventional pure single-stranded DNA phage vectors. Indeed, in all tested cell lines, the self-complementary phage vector exhibited rapid onset of transduction and higher transgene expression levels. More importantly, unlike conventional single-stranded phage vectors, DNA replication inhibitors do not affect the transduction of the self-complementary phage vector. Furthermore, in vivo studies showed significantly enhanced gene delivery to mouse solid tumors after systemic administration compared to single-stranded DNA phage particles. All these biological characteristics demonstrate that the construction and characterization of novel filamentous phage vectors containing self-complementary single-stranded DNA (which delivers the transgene cassette in double-stranded DNA form through hybridization) will make a significant contribution to the continued development of phage-based gene delivery systems.

[0287] The technology described in this article has several unique features, including a hybridizable self-complementary single-stranded DNA (i.e., double-stranded DNA) transgenic expression cassette packaged in an M13 phage capsid. Furthermore, compared to existing technologies, this system can package large genomes by using two inverted terminal repeat (ITR) sequences instead of three ITRs. Moreover, compared to existing phage vectors, this technology enables rapid initiation of gene expression in mammalian cells using M13 phage. This is also the first demonstration of hybridization between a hybridizable self-complementary single-stranded DNA (i.e., double-stranded adeno-associated virus, dsAAV) genome and a phage capsid. In other words, this is the first hybridization vector consisting of a phage capsid and hybridizable complementary single-stranded DNA (i.e., double-stranded recombinant adeno-associated virus, ds-rAAV). Furthermore, this is the first reported capability to package and deliver a hybridizable complementary single-stranded DNA transgenic cassette (i.e., a double-stranded transgenic cassette) ready to initiate gene expression in mammalian cells. Furthermore, this is the first report of using a transgenic cassette modified with adeno-associated virus inverted terminal repeat (AAV ITR) flanking sequences to package double-stranded adeno-associated virus DNA (derived from hybridizable complementary single-stranded DNA) in a phage capsid and deliver it into mammalian cells, since an AAV capsid is not present in such cells, as the inventors used a transgenic cassette modified with adeno-associated virus inverted terminal repeat (AAV ITR) flanking sequences.

[0288] Furthermore, compared to existing phage vectors, the phage vector of the present invention enables phages to initiate gene expression more rapidly in mammalian cells. Moreover, the delivery of double-stranded adeno-associated virus (dsAAV) vectors is costly, while, as described in this invention, using phage capsids to deliver double-stranded AAV DNA is highly cost-effective because this delivery system is produced in bacteria, utilizing the cost-effective production and purification processes of phage vectors in prokaryotic hosts, which are compatible with industrial-scale reactors and separation systems. This also facilitates scaling up production, thereby directly reducing costs.

[0289] The inventors used soluble tumor necrosis factor-associated apoptosis-inducing ligand (sTRAIL) to support their findings, demonstrating that self-complementary phage particles (scPP) exhibit remarkably good performance in gene delivery. For example, when using genes such as TRAIL, the inventors demonstrated cancer cell death, suggesting that scPP vectors can be used for in vivo or in vitro delivery of therapeutic genes.

[0290] The inventors believe this technology will impact the field of phage gene delivery, as well as adeno-associated virus (AAV) gene therapy and systemic delivery. This delivery platform can be applied to systemic gene therapy for cancer and other human diseases because the phage capsid is non-targeting to human tissues; therefore, it can be delivered systemically to the target site in diseased tissue via ligands displayed on the phage capsid, thereby allowing therapeutic DNA to enter and be delivered in place.

[0291] References

[0292] 1-Ivanenkov V., Felici F., Menon AG "Uptake and intracellular fate ofphage display vectors in mammalian cells" Biochim.Biophys.Acta 1999,1448:450-462.

[0293] 2-Di Giovine M., Salone B., Martina Y., Amati V., Zambruno G., Cundari E., Failla CM, Saggio I. "Binding properties, cell delivery, and gene transfer of adenoviral penton base displaying bacteriophage" Virology 2004,282:102-112.

[0294] 3-Piersanti S.,Cherubini G.,Martina Y.,Salone B.,Avitabile D.,GrossoF.,Cundari E.,Di Zenzo G.,Saggio I“Mammalian cell transduction andinternalization properties of lambda phages displaying the full-lengthadenoviral penton base or its central domain”J.Mol.Med.2004,82:467-476.

[0295] 4-Larocca D.,Witte A.,Johnson W.,Pierce G.F.,Baird A.“Targetingbacteriophage tomammalian cell surface receptors for gene delivery”Hum.Gene.Ther.1998,9:2393-2399

[0296] 5-Hart S.L.,Knight A.M.,Harbottle R.P.,Mistry A.,Hunger H.D.,CutlerD.F.,WilliamsonR.,Coutelle C.“Cell binding and internalization by filamentousphage displaying a cyclic Arg-Gly-Asp-containing peptide”J.Biol.Chem.1994,269:12468-12474.

[0297] 6-Hajitou A, Trepel M, Lilley CE, Soghomonyan S, Alauddin MM, Marini FC, 3rd, Restel BH, Ozawa MG, Moya CA, Rangel R, Sun Y, Zaoui K, Schmidt M, von Kalle C, Weitzman MD, Gelovani JG, Pasqualini R.,Arap W.“A hybrid vector for ligand-directed tumor targeting and molecular imaging”Cell2006,125:385-398.

[0298] 7-Yata,T.,Lee,ELQ,Suwan,K.,Syed,N.,Asavarut,P.and Hajitou A.“Modulation ofExtracellular Matrix in Cancer is Associated with EnhancedTumor Cell Targeting by BacteriophageVectors”Mol.Cancer 2015,14:110.

[0299] 8-Asavarut A.,Waramit S.,Suwan K.,Marais GJK,Chongchai A.,Benjathummarak S.,Al-Bahrani M.,Vila-Gomez P.,Williams M.,Kongtawelert P.,Yata T.and Hajitou A.“Systemicallytargeted Cancer Immunotherapy and GeneDelivery using Transmorphic Particles”EMBO Mol.Med.2022,14:e15418.

[0300] 9-Stoneham,C.A.,Hollinshead,M.,and Hajitou A.“Clathrin-MediatedEndocytosis andSubsequent Endo-lysosomal Trafficking of Adeno-associatedVirus / phage”J.Biol.Chem.2012,287:35849-35859.

[0301] 10-Suwan K.,Yata T.,Waramit S.,Przystal J.M.,Stoneham C.A.,BentayebiK.,Asavarut P.,Chongchai A.,Pothachareon P.,Lee K.Y.,Topanurak S.,Smith T.L.,Gelovani J.G.,Sidman R.L.,Pasqualini R.,Arap W.and Hajitou A.“Next-generationof targeted AAVP vectors for systemictransgene delivery against cancer”ProcNatl.Acad.Sci.USA.2019,116:18571-18577.

[0302] 11-Kia,A.,Przystal,J.M.,Nianiaris,N.,Mazarakis,N.D.,Mintz,P.J.,andHajitou A.“DualSystemic Tumor Targeting with Ligand-directed Phage and Grp78Promoter Induces TumorRegression”Mol.Cancer Ther.2012,11:2566-2577.

[0303] 12-Przystal JM, Waramit S, Pranjol MZI, Yan W, Chu G, ChongchaiA, Samarth G, Olaciregui NG, Tabatabai G, Carcaboso AM, Aboagye EO, Suwan K. and Hajitou A.“Efficacyof systemic temozolomide-activated phage-targetedgene therapy in human glioblastoma”EMBO.Mol.Med.2019,11:e8492.

[0304] 13-Tsafa E., Bentayebi K., Topanurak S., Yata T., Przystal J., Fongmoon D., Hajji N., Waramit S., Suwan K. and Hajitou A.“Doxorubicin Improves Cancer CellTargeting by Filamentous PhageGene Delivery Vectors” Int.J.Mol.Sci.2020,21:7867.

[0305] 14-Monaci P.,Urbanelli L.and Fontana L.“Phage as Gene Delivery Vectors”Curr.Opin.Mol.Ther.2001,3:159-169.

[0306] 15-Burg MA,Jensen-Pergakes K,Gonzalez AM,Ravey P,Baird A,Larocca D.“Enhanced phagemide particle gene transfer in camptothecin-treated carcinoma cells”Cancer Res.2002,62:977-981.

[0307] 16-Wurdinger T.,Badr C.,Pike L.,de Kleine R.,Weissleder R.,Breakefield XO,TannousB.A.“A secreted luciferase for ex vivo monitoring ofin vivo processes”Nat Methods 2008,5:171-173.

Claims

1. A phage vector, characterized in that, include: At least two single-stranded self-complementary transgenic expression cassettes separated by a linker hybridize to form a double-stranded transgenic expression cassette.

2. The phage vector according to claim 1, characterized in that: in, The phage vector contains a packaging signal that enables the replication of the at least two single-stranded self-complementary transgenic expression cassettes, which are capable of hybridization in bacteria and subsequently packaged as double-stranded transgenic expression cassettes into the phage vector within a prokaryotic host.

3. The phage vector according to claim 2, characterized in that: in, The packaging signal includes a phage replication origin, optionally an F1 origin.

4. The phage vector according to any one of the preceding claims, characterized in that: in, The phage vector contains a bacterial replication origin, optionally a pUC origin.

5. The phage vector according to any one of the preceding claims, characterized in that: in, The phage vector contains one or more DNA sequences that enable it to target and integrate into the host genome.

6. The phage vector according to any one of the preceding claims, characterized in that: in, The at least two self-complementary transgene expression cassettes comprise viral transgene expression cassettes, preferably mammalian viral transgene expression cassettes.

7. The phage vector according to any one of the preceding claims, characterized in that: in, The at least two self-complementary transgene expression cassettes comprise either a lentiviral transgene expression cassette or an adeno-associated virus (AAV) transgene expression cassette.

8. The phage vector according to any one of the preceding claims, characterized in that: in, The at least two self-complementary transgenic expression cassettes contain any nucleic acid encoding a factor that may have therapeutic or industrial use in target cells or tissues, optionally wherein the nucleic acid is DNA, cDNA, RNA, antisense RNA, or shRNA.

9. The phage vector according to claim 8, characterized in that: in, The factor encoded by the nucleic acid is a polypeptide or a protein.

10. The phage vector according to any one of the preceding claims, characterized in that: in, Each of the at least two transgene expression cassettes contains a promoter, optionally wherein the promoter is a cytomegalovirus promoter, a glucose regulatory protein 78 promoter, a tumor-specific promoter, or a tissue-specific promoter.

11. The phage vector according to any one of the preceding claims, characterized in that: in, Each of the at least two transgenic expression cassettes contains nucleic acids for polyA tails.

12. The phage vector according to any one of the preceding claims, characterized in that: in, The phage vector contains four single-stranded self-complementary transgene expression cassettes separated by linkers, which hybridize to form two double-stranded transgene expression cassettes.

13. The phage vector according to any one of the preceding claims, characterized in that: in, The two single-stranded self-complementary transgenic expression cassettes are positioned in opposite directions within the phage vector. Preferably, the first transgenic expression cassette extends in the 5' to 3' direction, while the corresponding second transgenic expression cassette extends in the 3' to 5' direction.

14. The phage vector according to any one of the preceding claims, Its features are: Wherein, the percentage of sequence identity between the first transgenic expression cassette and the second transgenic expression cassette is at least 65%, 70%, or 75%, or wherein, the percentage of sequence identity between the first transgenic expression cassette and the second transgenic expression cassette is at least 80%, 85%, 90%, or 95%.

15. The phage vector according to any one of the preceding claims, characterized in that: in, The linker separating the at least two self-complementary transgenic expression cassettes is a terminal inverted repeat (ITR).

16. The phage vector according to claim 15, characterized in that: in, The phage vector includes a second ITR, wherein the second ITR is located on the flank of one of the at least two self-complementary transgene expression cassettes.

17. The phage vector according to claim 15 or 16, characterized in that: in, The first ITR and / or the second ITR is an AAV ITR.

18. The phage vector according to any one of claims 15-17, characterized in that: in, The phage vector contains only two ITRs, preferably, the phage vector contains fewer than three ITRs.

19. The phage vector according to any one of claims 1-14, characterized in that: in, The linker separating the at least two self-complementary transgenic expression cassettes is an unrelated DNA fragment, wherein the percentage of sequence identity between the linker and the first and second transgenic expression cassettes is less than 50%, 45%, or 40%, preferably less than 35%, 30%, or 25%. Optionally, the length of the unrelated DNA fragment is between 60 bp and 300 bp, between 80 bp and 280 bp, between 100 bp and 260 bp, between 120 bp and 240 bp, between 140 bp and 220 bp, or between 160 bp and 200 bp.

20. The phage vector according to any one of the preceding claims, characterized in that: in, The phage vector contains a selection marker, optionally wherein the selection marker is an ampicillin resistance gene.

21. The phage vector according to any one of the preceding claims, characterized in that: in, The phage vector comprises one or more capsid minor coat proteins, optionally, wherein the phage vector comprises a pIII capsid minor coat protein configured to display a cell-targeting ligand to enable the vector to be delivered to target cells; and / or The phage vector contains one or more capsid major shell proteins, and optionally, the phage vector contains at least one pVIII capsid major shell protein configured to display a foreign peptide thereon.

22. The phage vector according to any one of the preceding claims, characterized in that: in, The phage vector contains a genome that is substantially missing from the phage genome from which the vector originates. Optionally, the genome of the phage vector is missing at least 60%, more preferably at least 70%, or even more preferably at least 80% of the phage genome from which it originates.

23. The phage vector according to any one of the preceding claims, characterized in that: in, The phage vector lacks in its genome the phage structural genes required for the formation, packaging, or release of particles from a prokaryotic host.

24. A system for generating a bacteriophage vector from a prokaryotic host, characterized in that, include: (i) a first vector, configured to persist within a prokaryotic host, and comprising at least two single-stranded self-complementary transgenic expression cassettes separated by linkers and hybridizing to form a double-stranded transgenic expression cassette, and a packaging signal for enabling the replication of the at least two single-stranded self-complementary transgenic expression cassettes; and (ii) A second vector containing nucleic acid for encoding structural proteins required for packaging the double-stranded transgenic expression cassette, thereby enabling the formation and release of the phage vector within the prokaryotic host.

25. The system according to claim 24, characterized in that: in, The system is used to generate a phage vector according to any one of claims 1-23.

26. The system according to claim 24 or 25, characterized in that: in, The first vector contains the genome of the phage vector.

27. The system according to any one of claims 24-26, characterized in that: in, The packaging signal of the first vector includes a phage replication origin, preferably an F1 origin.

28. The system according to any one of claims 24-27, characterized in that: in, The first carrier includes a second replication origin, preferably a pUC origin.

29. The system according to any one of claims 24-28, characterized in that: in, The connector of the first carrier is an ITR, preferably an AAV ITR.

30. The system according to any one of claims 24-29, characterized in that: in, The second vector is a bacteriophage specifically designed to rescue the genome of the first vector from the prokaryotic host, preferably wherein the second vector is a replication-defective type.

31. The system according to any one of claims 24-29, characterized in that: in, The second vector contains a disrupted packaging signal that significantly inhibits the ability of the second vector to be packaged into phage particles, preferably wherein the second vector contains a disrupted origin of replication.

32. The system according to claim 31, characterized in that: in, The destroyed replication origin is a medium replication origin, optionally p15a, or a low replication origin, optionally pMB1.

33. The system according to any one of claims 24-32, characterized in that: in, The second vector comprises a first nucleic acid sequence and / or a second nucleic acid sequence, the first nucleic acid sequence encoding a pIII capsid minor outer shell protein configured to display a cell-targeting ligand to enable the phage vector to be delivered to a target cell, and the second nucleic acid sequence encoding at least one pVIII capsid major outer shell protein configured to display an exogenous peptide thereon.

34. A method for generating a bacteriophage vector from a prokaryotic host, characterized in that, include: (i) Introducing a first vector into a prokaryotic host cell, the first vector being configured to persist within the prokaryotic host and comprising at least two single-stranded self-complementary transgenic expression cassettes separated by linkers and hybridizing to form a double-stranded transgenic expression cassette, and a packaging signal for enabling the at least two single-stranded self-complementary transgenic expression cassettes to replicate. (ii) Introducing a helper phage into a host, the helper phage containing nucleic acid encoding a phage structural protein; as well as (iii) The host is cultured under conditions that produce a double-stranded transgenic expression cassette, which is packaged with structural proteins to enable the formation and release of a phage vector carrying the double-stranded transgenic expression cassette in the prokaryotic host.

35. A method for generating bacteriophage particles from a prokaryotic host, characterized in that, include: (i) The following are introduced into a prokaryotic host cell: (a) a first vector configured to persist within the prokaryotic host and comprising at least two single-stranded self-complementary transgenic expression cassettes separated by linkers and hybridizing to form a double-stranded transgenic expression cassette, and a packaging signal for enabling the at least two single-stranded self-complementary transgenic expression cassettes to replicate; and (b) a second vector comprising structural proteins encoded by nucleic acids required for packaging the double-stranded transgenic expression cassette; as well as (ii) The host is cultured under conditions that produce a double-stranded transgenic expression cassette packaged with structural proteins, so that the phage vector is formed in and released from the prokaryotic host.

36. The use of an auxiliary bacteriophage, characterized in that: The helper phage contains nucleic acid encoding a viral vector structural protein for generating a phage vector from a prokaryotic host as described in any one of claims 1-23.

37. A host cell, characterized in that, include: The first carrier and / or the second carrier as described in any one of claims 24-33.

38. The phage vector according to any one of claims 1-23, or the system according to any one of claims 24-33, characterized in that, Used as a tool for experimental research, optionally, the tool is used in vitro or ex vivo.

39. The phage vector according to any one of claims 1-23, or the system according to any one of claims 24-33, characterized in that, Used for treatment or diagnosis.

40. The phage vector according to any one of claims 1-23, or the system according to any one of claims 24-33, characterized in that, Used in gene therapy technology.

41. The phage vector or system according to claim 40, characterized in that, in, The gene therapy technology is used to treat, prevent, or manage cancer.

42. A vaccine, characterized in that, include: The phage vector as described in any one of claims 1-23 or the system as described in any one of claims 24-33.

43. The phage vector according to any one of claims 1-23, or the system according to any one of claims 24-33, characterized in that, Used to deliver the vaccine to the subjects.

44. The phage vector according to any one of claims 1-23, or the system according to any one of claims 24-33, characterized in that, Tumors used to target and deliver exogenous antigens to vaccine recipients.

45. Use of a phage vector as described in any one of claims 1-23 or a system as described in any one of claims 24-33, characterized in that, Used in genetic molecular imaging techniques.

46. ​​A pharmaceutical composition, characterized in that, include: The phage vector as described in any one of claims 1-23, or the system as described in any one of claims 24-33, and a pharmaceutically acceptable vector.

47. A method for preparing the pharmaceutical composition as described in claim 46, characterized in that, include: Contact a therapeutically effective amount of the phage vector as described in any one of claims 1-23 or the system as described in any one of claims 24-33 with a pharmaceutically acceptable carrier.

48. Use of a phage vector as described in any one of claims 1-23 or a system as described in any one of claims 24-33, characterized in that, Used to generate recombinant viral vectors, which contain or are derived from the viral genome within the genome of the phage vector.

49. A method for generating a recombinant viral vector, characterized in that, include: The phage vector as described in any one of claims 1-23 or the system as described in any one of claims 24-33 is introduced into a eukaryotic host cell, such that the host cell is able to produce a recombinant viral vector.

50. The use according to claim 48 or the method according to claim 49, characterized in that: in, The recombinant viral vector is a recombinant mammalian virus, rAAV, recombinant self-complementary AAV vector, or recombinant lentiviral vector.

Citation Information

Patent Citations

  • bacteriophage

    WO2014184528A1

  • bacteriophage

    WO2014184529A1

  • Phagemid vector

    WO2017077275A1