Application of reagent for inhibiting uPAR target spot in preparation of medicine for preventing and / or treating acetaminophen-induced liver injury

Abstract

The invention relates to the technical field of biological medicines, in particular to application of a reagent for inhibiting uPAR targets in preparation of drugs for preventing and / or treating acetaminophen-induced liver injury. The invention finds that uPAR regulates and controls a transcription factor IRF7 through a JAK2-STAT3 signal channel, further influences the expression of a downstream interburial receptor AXL, and further influences the interburial function of macrophages; through overexpression of IRF7 and activation of AXL, macrophage interment can be significantly enhanced, and liver injury is improved. Based on the invention, the uPAR and the downstream IRF7-AXL axis can be found to be used as potential intervention targets for preventing and treating the acetaminophen-induced liver injury.

Description

Technical Field

[0001] This invention relates to the field of biomedical technology, and in particular to the use of reagents that inhibit uPAR targets in the preparation of drugs for the prevention and / or treatment of acetaminophen-induced liver injury. Background Technology

[0002] Drug-induced liver injury (DILI) is one of the most common and serious adverse drug reactions. Acetaminophen (APAP) is one of the main causative drugs of DILI and is also the most widely studied hepatotoxic drug. Abnormal activation of the immune system and cytokine storms are important drivers of DILI progression. During DILI, neutrophils are recruited to the site of injury, producing neutrophilic extracellular traps (NETs), but excessive NET production exacerbates tissue damage. Senescent neutrophils are considered a more pro-inflammatory cell subset, highly expressing inflammatory and chemokine factors, and producing increased NETs. Macrophages can phagocytose and clear apoptotic cells, including neutrophils, through efflorescence, promoting inflammation resolution and damage repair. Increasing evidence suggests that endogenous cell interactions are a key step in maintaining immune homeostasis and spontaneous remission of inflammation during DILI, and represent a promising area of ​​research for spontaneous inflammation resolution.

[0003] Therefore, identifying the key endogenous regulators of macrophage functional homeostasis and elucidating the mechanisms regulating the spontaneous resolution of liver inflammation are crucial for identifying new therapeutic targets. Summary of the Invention

[0004] To address the aforementioned problems, the present invention aims to provide the application of reagents that inhibit uPAR targets in the preparation of drugs for the prevention and / or treatment of acetaminophen-induced liver injury. Urokinase-type plasminogen activator receptor (uPAR) is a highly glycosylated membrane protein encoded by the Plaur gene. It is widely present on the surface of various immune-active cells, with limited expression levels under normal conditions. However, its expression significantly increases during stress responses, injury and infection, wound healing, and tissue remodeling. uPAR not only binds to urokinase and participates in fibrinolysis, regulating cell signaling, adhesion, invasion, migration, and proliferation, but also participates in macrophage burial processes, regulating the immune microenvironment. Studies have shown that inflammatory macrophages derived from monocytes are the main cell type expressing uPAR in the liver. During inflammation activation, they can release soluble uPAR (suPAR), which is widely present in body fluids such as serum, urine, and peritoneal fluid, and is a potential biomarker for various diseases such as acute liver failure, atherosclerosis, and chronic kidney disease. This invention discovers that in the DILI process, inhibiting uPAR plays a key role in enhancing macrophage burial, promoting the clearance of senescent neutrophils, reducing intrahepatic inflammation, and promoting liver damage repair and regeneration. This invention provides a new pathway to prevent and treat acetaminophen-induced liver injury by intervening in uPAR and the downstream IRF7-AXL axis.

[0005] The objective of this invention can be achieved through the following technical solutions:

[0006] The first objective of this invention is to provide the use of an agent that inhibits the uPAR target in the preparation of a drug for the prevention and / or treatment of acetaminophen-induced liver injury.

[0007] Furthermore, the drug is a drug that enhances macrophage cytotoxicity and increases the clearance of senescent neutrophils to prevent and / or treat acetaminophen-induced liver injury.

[0008] Furthermore, the drug is a drug that regulates the overexpression of transcription factor IRF7 through the JAK2-STAT3 signaling pathway, activates AXL expression, and thereby enhances macrophage cytotoxicity to prevent and / or treat acetaminophen-induced liver injury.

[0009] Furthermore, the drug contains a uPAR inhibitor.

[0010] Furthermore, the drug contains other pharmaceutically acceptable carriers.

[0011] Furthermore, the formulation of the drug is selected from one of the following: tablets, injections, capsules, oral solutions, pills, granules, powders, patches, ointments, aerosols, liniments, or suppositories.

[0012] Furthermore, the drug can be administered orally, by injection, intravenously, transdermally, nasally, intraperitoneally, intracranially, pulmonaryly, via mucosa, intratumorally, sublingually, or via the buccal route.

[0013] A second objective of this invention is to provide the use of uPAR as a target in screening agents and / or kits for the prevention and / or treatment of acetaminophen-induced liver injury.

[0014] Furthermore, the reagents and / or kits contain materials for detecting uPAR.

[0015] Furthermore, the material is used to detect the expression level of uPAR.

[0016] Compared with the prior art, the present invention has the following beneficial effects:

[0017] (1) This invention proposes the key regulatory role of uPAR in the DILI process, and clarifies that inhibiting uPAR can regulate the IRF7-AXL axis through the JAK2-STAT3 signaling pathway to enhance the burial function of macrophages, accelerate the clearance of senescent neutrophils, promote the resolution of intrahepatic inflammation and the repair of damage. Furthermore, it elucidates the molecular biological mechanism by which uPAR and the downstream IRF7-AXL axis regulate the burial function and maintain intrahepatic immune homeostasis from multiple research levels, including animal models, in vitro co-culture and clinical samples.

[0018] (2) This invention explores the effects and feasibility of inhibiting uPAR by enhancing macrophage burial, promoting the clearance of senescent neutrophils, reducing intrahepatic inflammation, and promoting liver damage repair and regeneration. It has certain clinical application value.

[0019] (3) This invention focuses on uPAR, which plays an important role in myeloid innate immunity and maintaining hepatic immune homeostasis. In an APAP-induced mouse model of liver injury, it was fully demonstrated that both systemic and myeloid-specific knockout of Plaur significantly reduced liver injury, enhanced macrophage burial activity, accelerated clearance of senescent neutrophils, and promoted liver repair. This process is mechanistically closely related to the IRF7-AXL axis. Plaur knockout inhibits STAT3 phosphorylation, increasing IRF7 expression. IRF7 enhances macrophage burial activity by binding to the promoter region of the burial receptor AXL, thereby clearing senescent neutrophils, preventing excessive intrahepatic inflammation activation, promoting inflammation resolution and damage repair, and maintaining hepatic immune homeostasis. This invention provides an important preliminary experimental foundation for the development of new drugs based on these targets. Attached Figure Description

[0020] Figure 1 A is a UMAP plot of hepatic cell composition in the APAP model at different time points; B is a bar chart of hepatic cell composition in the APAP model at different time points; C is a UMAP plot of the number and distribution of macrophages in the APAP model at different time points; D is a pie chart of the number of macrophages in the APAP model at different time points; E is a violin plot of neutrophil clearance score in the APAP model at different time points; F is a statistical chart of HE staining of liver tissue in the APAP model at 0h, 24h, 48h, and 72h (row 1 is 1×, row 2 is 4×, row 3 is 10×) and percentage of necrotic area, n=6.

[0021] Figure 2 A shows flow cytometry of liver tissue from APAP model mice at 24h, 48h, and 72h, and the percentage of senescent neutrophils, n=6; B shows HE staining of liver tissue from control group and APAP model mice treated with CXCR2 inhibitor (row 1: 1×, row 2: 4×, row 3: 10×), percentage of necrotic area, and serum ALT and AST levels, n=5 in control group and n=4 in CXCR2 inhibitor group.

[0022] Figure 3 A is the UMAP plot of scRNA-seq in the healthy control group and ALF patients; B is the volcano plot of differentially expressed genes in the liver of the healthy control group and ALF patients; C is the violin plot of the expression level of the Plaur gene in the liver of the healthy control group and ALF patients; D is the total UMAP plot of expression and distribution of the Plaur gene in the liver of the healthy control group and ALF patients; E is the violin plot of the expression level of the Plaur gene in different cell types; F is the UMAP plot of scRNA-seq in the control group, WT-APAP-300mg / kg model and WT-APAP-750mg / kg model.

[0023] Figure 4 A is a bar chart of hepatic cell composition in the control group, WT-APAP-300mg / kg model, and WT-APAP-750mg / kg model; B is a bubble chart of marker genes in different cell types; C is a total UMAP chart of Plaur gene expression and distribution in the liver of the control group, WT-APAP-300mg / kg model, and WT-APAP-750mg / kg model; D is a violin plot of Plaur gene expression level in different cell types; E is a violin plot of Plaur gene expression level in the control group, WT-APAP-300mg / kg model, and WT-APAP-750mg / kg model; F is a Venn plot of gene intersection between clinical sample scRNA-seq and mouse model scRNA-seq.

[0024] Figure 5 A: mIHC images of Plaur expression and cellular localization in liver tissues of healthy control groups and ALF patients (1st column is 10×, the rest are 40×); B: mIHC images of Plaur expression and cellular localization in liver tissues of WT and WT-APAP mouse models (1st column is 10×, the rest are 40×); C: Immunohistochemical staining of Plaur and statistical graphs of the percentage of positive cell areas in liver tissues of WT and APAP mouse models, n=4; D: WB graphs and statistical graphs of Plaur protein expression levels in liver tissues of control group, WT-APAP-300mg / kg model and WT-APAP-600mg / kg model, n=3; E: Plaur levels in liver tissues of control group, WT-APAP-300mg / kg model and WT-APAP-600mg / kg model. qPCR statistical plots of mRNA expression levels: control group, WT-APAP-300mg / kg model group n=7, WT-APAP-600mg / kg model group n=6; F is the qPCR statistical plot of Plaur mRNA expression levels in WT-BMDM and LPS-interventional WT-BMDM, n=4.

[0025] Figure 6 A shows HE staining of liver tissue from APAP models of WT and Plaur systemic knockout mice (row 1: 1×, row 2: 4×, row 3: 10×), statistical chart of percentage of necrotic area, and serum ALT and AST levels, n=3; B shows heatmap of KEGG analysis of liver tissue transcriptome sequencing from WT and Plaur systemic knockout mice; C shows bubble chart of GO analysis of liver tissue transcriptome sequencing from WT and Plaur systemic knockout mice.

[0026] Figure 7 A shows the mIHC images of liver tissue from APAP models in WT and Plaur systemic knockout mice (10× in the first column, 40× in the rest), and statistical graphs of the number of senescent neutrophils and the percentage of cell burial, n=16; B shows the HE staining of liver tissue from APAP models in control and myeloid Plaur specific knockout mice (1× in the first row, 4× in the second row, 10× in the third row), statistical graphs of the percentage of necrotic areas, and serum ALT and AST levels, n=7.

[0027] Figure 8A shows flow cytometry and percentage of senescent neutrophils in liver tissue of APAP models from control and myeloid Plaur knockout mice, n=6; B shows mIHC (10× in the first column, 40× in the rest) and the number and percentage of senescent neutrophils in liver tissue of APAP models from WT and myeloid Plaur knockout mice, n=16; C shows mIHC (40×) and statistics of macrophage phagocytic function in WT-BMDM and Plaur systemic knockout mice (BMDM), n=15.

[0028] Figure 9 A: Total UMAP plot of scRNA-seq in control and myeloid Plaur-specific knockout mouse APAP models; B: Heatmap of marker genes in different cell types; C: Bubble plot of marker genes in different cell types; D: UMAP plot of scRNA-seq in control and myeloid Plaur-specific knockout mouse APAP models; E: Bar chart of hepatic cell composition in control and myeloid Plaur-specific knockout mouse APAP models; F: Total UMAP plot of neutrophil subset analysis; G: Heatmap of marker genes in neutrophil subset analysis; H: UMAP plot of neutrophil subset analysis in control and myeloid Plaur-specific knockout mouse APAP models; I: Violin plot of expression levels of aging-related genes in two neutrophil subsets.

[0029] Figure 10 A is a violin plot of apoptosis and necrosis scores for two neutrophil subsets; B is a pseudo-time series analysis plot between the two neutrophil subsets; C is a plot of kinetic changes in neutrophil senescence-related genes; D is a violin plot of AXL expression levels in liver tissue of control and myeloid Plaur-specific knockout mouse APAP models; E is a qPCR statistical plot of AXL mRNA expression levels in WT and Plaur systemic knockout mice BMDM, n=5.

[0030] Figure 11 A is a heatmap of SCENIC analysis in the control group and the myeloid Plaur-specific knockout mouse APAP model; B is a graph of IRF7 and its Top20 target genes PPI analysis; C is a graph of IGV of AXL in the control group and Plaur systemic knockout mice BMDM; D is a bar graph of dual-luciferase reporter gene analysis of IRF7 binding in the AXL promoter region.

[0031] Figure 12A: WB plot of pSTAT3 / IRF7 / AXL pathway protein expression levels in BMDM of WT and Plaur systemic knockout mice, n=3; B: WB plot of pSTAT3 / IRF7 / AXL pathway protein expression levels in RAW264.7 cells of the control group and STAT3 inhibitor intervention group, n=3; C: WB plot of pSTAT3 / IRF7 / AXL pathway protein expression levels in BMDM of the control group and STAT3 inhibitor intervention group, n=3; D: HE staining of liver tissue of APAP model mice of control group and HBAAV-IRF7 intervention mice (row 1 is 1×, row 2 is 4×, row 3 is 10×), statistical graph of necrotic area percentage, and serum ALT and AST levels, n=6; E: mIHC plot of liver tissue of APAP model mice of control group and HBAAV-IRF7 intervention mice (column 1 is 10×, the rest are 40×), statistical graph of number of senescent neutrophils and percentage of cell burial, n=16.

[0032] Figure 13 Image A shows HE staining of liver tissue from APAP models in control and Axl systemic knockout mice (row 1: 1×, row 2: 4×, row 3: 10×), percentage of necrotic area, and serum ALT and AST levels, n=4; Image B shows flow cytometry analysis of liver tissue from APAP models in control and Axl systemic knockout mice, and percentage of senescent neutrophils, n=5.

[0033] Figure 14 A shows HE staining of liver tissue from APAP model mice in the control group and Axl inhibitor-treated mice (row 1: 1×, row 2: 4×, row 3: 10×), statistical graph of percentage of necrotic area, and serum ALT and AST levels, n=5; B shows HE staining of liver tissue from APAP model mice in the control group and Axl agonist-treated mice (row 1: 1×, row 2: 4×, row 3: 10×), statistical graph of percentage of necrotic area, and serum ALT and AST levels, n=4 in the control group and n=5 in the agonist group.

[0034] Figure 15 mIHC images of liver tissue from APAP models in control and Axl agonist-treated mice (the first column is 10×, and the rest are 40×), and statistical graphs of the number of senescent neutrophils and the percentage of cell burial, n=16. Detailed Implementation

[0035] The present invention will now be described in detail with reference to the accompanying drawings and specific embodiments.

[0036] The methods involved in the following embodiments are as follows:

[0037] (1) Construction of APAP mouse model

[0038] To eliminate the influence of sex, hormones, and physiological differences, this study selected 6-8 week old mice (e.g., male C57BL / 6 mice, Plaur mice). - / - Mice, Lyz2 cre Plaur f / f Mice, Axl - / - Mice were used to establish the APAP model. Mice were fasted for 16 hours prior to modeling, but water was not restricted. The APAP model was established by intraperitoneal injection of APAP solution (15 mg / ml). Before and after modeling, relevant experimental interventions were administered, including CXCR2 inhibitors (MedChemExpress#HY-16711, 4 mg / kg, intraperitoneal injection once 1 hour after APAP modeling), AXL inhibitors (MedChemExpress#HY-15150, 125 mg / kg, intraperitoneal injection once 2 hours before APAP modeling), AXL agonists (ABclonal#RP02814, 5 μg / mouse, tail vein injection, once 2 hours before APAP modeling and once 24 hours after modeling), and IRF7 adeno-associated virus (constructed by Hanheng Biotechnology, titer 2.1*10^12 vg / mL, 100 μL / mouse, tail vein injection once 4 weeks before APAP modeling). After modeling, mice were observed to be normal before refeeding.

[0039] (2) Transgenic mouse identification process

[0040] Mice aged 9-14 days were numbered and their tails were cut off. Genomic DNA was extracted from the tails using a kit. Specific primers were designed, and a PCR reaction system was constructed. After cycles of denaturation, annealing, and extension, the desired gel was obtained by agarose gel electrophoresis. The gel was then placed in a gel imaging system, and the original images were analyzed. Based on the results, mouse genotypes that met the design requirements were selected.

[0041] (3) Steps for the isolation and processing of bone marrow-derived macrophages (BMDMs)

[0042] Fresh femurs and tibias were completely removed from 8-week-old male mice. Hair and muscle tissue were removed, and the bone marrow cavity was flushed with pre-cooled DMEM using a sterile syringe until all bone marrow was expelled. The bone marrow cell suspension was passed through a 70 μm cell filter and centrifuged at 1000 rpm for 5 minutes at 4°C. The supernatant was discarded, and the cell pellet was collected. The pellet was lysed with lysin B for 3 minutes, neutralized with PBS, and centrifuged again. The obtained bone marrow cells were resuspended in DMEM medium containing 10% fetal bovine serum, 100 U / mL penicillin G, 0.1 mg / mL streptomycin sulfate, 0.25 μg / mL amphotericin B, and 100 ng / mL recombinant mouse M-CSF. The cells were seeded in culture dishes and incubated at 37°C, 5% CO2 for 7 days to induce macrophage differentiation (the DMEM medium was replaced on the fourth day). On day 7, mature BMDMs were collected for subsequent experiments, and BMDMs were stimulated with 100 ng / mL LPS to induce their conversion to a pro-inflammatory phenotype as needed.

[0043] (4) Macrophage phagocytosis experiment

[0044] Mouse BMDM was extracted and seeded in 96-well plates. On day 7, pHrodo BioParticles (ThermoFisher #P35361) were added, and the cells were incubated for 2 hours. After washing with PBS, cells were fixed for 30 minutes at room temperature with 4% paraformaldehyde. The fixed cells were stained with DAPI (1:1000, ThermoFisher) for 5 minutes, and after adding an anti-fluorescence quencher, images were taken under bright-field and fluorescent conditions using a fluorescence microscope for subsequent calculation of phagocytosis percentage.

[0045] (5) Dual-luciferase reporter gene assay

[0046] Dual-luciferase reporter gene assays were performed using a dual-luciferase reporter gene detection system. When cell confluence reached 70%, the specified plasmid was transfected using GMTrans liposome transfection reagent and cultured for 48 hours.

[0047] Unless otherwise specified, all reagents used are commercially available, and all detection methods and techniques used are conventional in this field.

[0048] Example 1

[0049] This embodiment provides a study on the changes and roles of senescent neutrophils in damage repair, as detailed below:

[0050] Analysis using a public single-cell RNA sequencing (scRNA-seq) database revealed that in APAP-mediated liver injury, the number of macrophages increased progressively with disease progression, peaking at 48 hours and then gradually decreasing, while the neutrophil clearance score gradually increased after 48 hours. Figure 1 AE). A mouse APAP model was constructed at different time points (0h, 24h, 48h, and 72h). Flow cytometry results showed that the proportion of senescent neutrophils peaked at 48h and then declined, suggesting that 48h is a critical time point for liver damage repair after APAP intervention. Figure 1 F, Figure 2 A). Inhibition of neutrophil recruitment using CXCR2 inhibitors significantly exacerbated APAP-mediated liver injury, suggesting that macrophage-mediated clearance of senescent neutrophils plays an important role in APAP-induced liver injury and repair. Figure 2 B).

[0051] Example 2

[0052] This embodiment provides a study on the expression changes and roles of uPAR in APAP-mediated liver injury, as detailed below:

[0053] Analysis of clinical samples (samples from Renji Hospital affiliated with Shanghai Jiao Tong University School of Medicine; the control group consisted of healthy individuals who underwent liver transplantation, and the experimental group consisted of patients with liver failure, n=4) and the mouse public scRNA-seq database revealed significantly increased expression of the Plaur gene in the liver tissues of patients with acute liver injury and APAP model mice, with high expression primarily in myeloid cells such as monocytes / macrophages and neutrophils. Figure 3 AF and Figure 4 AF), and further validated by multiplexed immunohistochemistry (mIHC) of human and mouse liver tissues. Figure 5 AC. Western blot (WB) and qPCR results confirmed increased uPAR expression in the liver tissue of the mouse APAP model. Furthermore, qPCR results (using Plaur-F and Plaur-R as primers) showed increased Plaur expression after pro-inflammatory activation of wild-type (WT) mouse bone marrow-derived macrophages (BMDM). Figure 5 The above results suggest that Plaur may play an important role in APAP-induced liver injury and repair.

[0054] Example 3

[0055] This embodiment provides a study on how Plaur gene knockout enhances macrophage cytotoxicity, clears senescent neutrophils, and accelerates liver damage repair, as detailed below:

[0056] Build Plaur - / - and Lyz2 cre Plaur f / f An APAP model was established in mice, and its analysis (liver tissue HE staining, mIHC, transcriptome sequencing, and flow cytometry) showed that, compared with the corresponding control mice, systemic knockout and myeloid cell-specific knockout of Plaur significantly improved APAP-induced liver injury, reduced intrahepatic inflammation, enhanced macrophage burial, and accelerated the clearance of senescent neutrophils. Figure 6 AC, Figure 7 AB, Figure 8 AB). Macrophage phagocytosis experiments confirmed that the phagocytic function of BMDM was significantly enhanced after Plaur knockout. Figure 8 C). scRNA-seq results showed that Lyz2 cre Plaur f / f The number of senescent neutrophils in mouse liver was significantly reduced, and the expression of the macrophage demise-related gene AXL was significantly increased, which was highly consistent with the results of qPCR (using Axl-F and Axl-R as primers). Figure 9 AI Figure 10 AE).

[0057] Example 4

[0058] This embodiment provides a study on the specific mechanism by which uPAR regulates the IRF7-AXL axis through the JAK2-STAT3 signaling pathway to control cell burial, as detailed below:

[0059] Myeloid cell-specific Plaur gene knockout mice (Lyz2) cre Plaur f / f Single-cell sequencing (SCENIC) analysis of a mouse APAP model showed that transcription factor IRF7 was significantly overexpressed after Plaur gene knockout, and the predicted endocytosis receptor AXL was its target gene, suggesting that uPAR may regulate the expression of endocytosis receptor AXL through transcription factor IRF7. Figure 11 AB). For WT and Plaur - / - Cut & tag sequencing of IRF7 in mouse BMDM revealed that Plaur knockout significantly enhanced the binding of IRF7 to the AXL promoter region, which was further verified by dual-luciferase reporter gene assays. Figure 11 CD). Studies have shown that STAT3 binds to the IRF7 promoter region and regulates its expression, and that uPAR positively regulates the JAK2-STAT3 signaling pathway. For WT and Plaur...- / - Western blot analysis of mouse BMDM showed that Plaur - / - Inhibition of STAT3 phosphorylation in mouse BMDM cells led to enhanced expression of IRF7 and AXL. Treatment of RAW 264.7 cells and BMDM cells with STAT3 phosphorylation inhibitors significantly increased IRF7 and AXL expression, confirming that uPAR may regulate the IRF7-AXL axis through the JAK2-STAT3 signaling pathway. Figure 12 AC). Targeting mouse hepatic macrophages with adeno-associated virus to overexpress IRF7 significantly enhanced macrophage burial activity, cleared senescent neutrophils, reduced liver damage, and promoted tissue repair. Figure 12 DE). Building Axl - / - A mouse model of acute liver injury (APAP) confirmed that systemic Axl knockout significantly aggravated liver damage and inhibited the clearance of senescent neutrophils. The same results were obtained with Axl inhibitors, while administration of Axl agonists enhanced macrophage cytotoxicity and promoted liver repair. Figure 13 AB and Figure 14 AB, Figure 15 ).

[0060] The primers involved in the above embodiments are as follows:

[0061] Plaur-F (SEQ ID NO. 1,5'-3'): CCTCCAGAGCACAGAAAGGAG;

[0062] Plaur-R(SEQ ID NO.2,5'-3'):TGGAAGCCATTCGGTGGAAA;

[0063] Axl-F(SEQ ID NO.3,5'-3'):AGACCCCATCACTCACCCTT;

[0064] Axl-R (SEQ ID NO.4,5'-3'): GTTAACCCCTCCAAGTCCCAG;

[0065] WT(SEQ ID NO.5,5'-3'):GAGAAAATGAAAAC;

[0066] M (SEQ ID NO. 6,5'-3'): TCTCCCCGTCCCCA.

[0067] The above description of the embodiments is provided to enable those skilled in the art to understand and use the invention. It will be apparent to those skilled in the art that various modifications can be made to these embodiments, and the general principles described herein can be applied to other embodiments without inventive effort. Therefore, the present invention is not limited to the above embodiments, and any improvements and modifications made by those skilled in the art based on the interpretation of the present invention, without departing from the scope of the invention, should be within the protection scope of the present invention.

Claims

1. Application of reagents that inhibit uPAR targets in the preparation of drugs for the prevention and / or treatment of acetaminophen-induced liver injury.

2. The application according to claim 1, characterized in that, The drug is a drug that enhances macrophage cytotoxicity and increases the clearance of senescent neutrophils to prevent and / or treat acetaminophen-induced liver injury.

3. The application according to claim 1, characterized in that, The drug is a drug that regulates the overexpression of transcription factor IRF7 through the JAK2-STAT3 signaling pathway, activates AXL expression, and thereby enhances macrophage cytotoxicity to prevent and / or treat acetaminophen-induced liver injury.

4. The application according to claim 1, characterized in that, The drug contains a uPAR inhibitor.

5. The application according to claim 1, characterized in that, The drug contains other pharmaceutically acceptable carriers.

6. The application according to claim 1, characterized in that, The formulation of the drug is selected from one of the following: tablets, injections, capsules, oral solutions, pills, granules, powders, patches, ointments, aerosols, liniments, or suppositories.

7. The application according to claim 1, characterized in that, The drug can be administered orally, by injection, intravenously, transdermally, nasally, intraperitoneally, intracranially, pulmonaryly, through mucosa, intratumorally, sublingually, or buccally.

8. The use of uPAR as a target in screening reagents and / or kits for the prevention and / or treatment of acetaminophen-induced liver injury.

9. The application according to claim 8, characterized in that, The reagents and / or kits contain materials for detecting uPAR.

10. The application according to claim 9, characterized in that, The material is used to detect uPAR expression levels.

Images