Rice available panicle number related protein SEP1 coding gene and related biological material and application thereof

Abstract

The invention relates to the technical field of biology, in particular to a rice available panicle number related protein SEP1 coding gene and a related biological material and application thereof. The SEP1 protein specifically can be the following protein A1), A2) or A3): A1) a protein with an amino acid sequence shown as SEQ ID No.3 in a sequence table; a2) a protein which is obtained by substituting and / or deleting and / or adding one or more amino acid residues to the protein of A1) and has the activity of regulating the effective panicle number of rice, and A3) a fusion protein obtained by connecting a protein label to the N terminal or / and the C terminal of A1) or A2) The SEP1 protein and the related biological material can be used for regulating the effective panicle number of rice.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of biotechnology, in particular to a rice effective panicle number related protein SEP1 coding gene and related biological materials and applications thereof. BACKGROUND

[0002] Rice (Oryza sativa L.) yield trait genetic improvement has always been a major demand for national food security. As the source of staple food for 50% of the world's population, rice production is facing the dual pressure of population growth and rigid constraints on arable land resources. Breaking through the bottleneck of improving the yield components (effective panicle number, panicle number, and thousand-grain weight) through genetic improvement has important scientific value for realizing the strategy of "storing grain in technology". Effective panicle number is an important trait affecting rice plant type and is significantly related to yield. Therefore, continuously exploring new genes that regulate rice effective panicle number and clarifying the genetic mechanism of rice effective panicle number formation will help provide theoretical guidance for rice ideal plant type breeding.

[0003] The formation of rice effective panicles is derived from tillering, and the tillering of rice originates from the axillary buds on the compact nodes of the main stem (aboveground part). The occurrence of tillering has a strict allotropic relationship with the growth of the main stem leaves. Generally, when the nth leaf of the main stem unfolds, the tiller at the (n-3) node will start to grow at the same time. With the growth of the plant, the number of tillers reaches a peak (the highest tillering stage), but not all tillers can survive. A part of the tillers cannot form effective panicles due to late occurrence, weak root system, slow leaf growth, long-term shading after birth, and other reasons. The growth points of strong tillers and the main stem stop differentiating leaf primordia and start to differentiate panicle primordia. After fine steps such as differentiation of panicle axis, differentiation of branch, and differentiation of glume and flower, the effective panicle is finally formed. Exploring new rice effective panicle number control genes has important application value and theoretical significance for further perfecting the molecular mechanism and genetic regulatory network of rice effective panicle formation. SUMMARY

[0004] Therefore, the technical problem to be solved by the present application is to provide a rice effective panicle number related protein SEP1 coding gene and related biological materials and applications thereof.

[0005] To achieve the above-mentioned purpose, the technical solutions provided by the present application are as follows:

[0006] The present application provides a related coding gene for the formation of rice effective panicle number, named SEP1, which is derived from the cDNA sequence of Oryza japonica Nipponbare. The application of the gene SEP1 in regulating rice effective panicle number is also provided.

[0007] Preferably, the regulation of rice effective panicle number refers to the increase of rice effective panicle number.

[0008] The coding gene SEP1 related to the effective panicle number formation of rice is a) or b):

[0009] a) a gene sequence with a DNA sequence as shown in SEQ ID No. 1, consisting of 2379 bases;

[0010] b) a protein derived from a) with the activity of the protein of the coding gene SEP1 related to the effective panicle number formation of rice, obtained by substitution and / or deletion and / or addition of one or several bases of the gene sequence shown in SEQ ID No. 1.

[0011] The biological material related to the coding gene SEP1 related to the effective panicle number formation of rice is used in the transgenic rice for breeding rice with more effective panicles.

[0012] The biological material related to the coding gene SEP1 related to the effective panicle number formation of rice is any one of the following A1) to A20):

[0013] A1) a nucleic acid molecule 1; the nucleic acid molecule 1 is a nucleic acid molecule encoding the coding gene SEP1 related to the effective panicle number formation of rice;

[0014] A2) an expression cassette containing the nucleic acid molecule 1 of A1);

[0015] A3) a recombinant vector containing the nucleic acid molecule 1 of A1);

[0016] A4) a recombinant vector containing the expression cassette of A2);

[0017] A5) a recombinant microorganism containing the nucleic acid molecule 1 of A1);

[0018] A6) a recombinant microorganism containing the expression cassette of A2);

[0019] A7) a recombinant microorganism containing the recombinant vector of A3);

[0020] A8) a recombinant microorganism containing the recombinant vector of A4);

[0021] A9) a transgenic plant cell line containing the nucleic acid molecule 1 of A1);

[0022] A10) a transgenic plant cell line containing the expression cassette of A2);

[0023] A11) a transgenic plant cell line containing the recombinant vector of A3);

[0024] A12) a transgenic plant cell line containing the recombinant vector of A4);

[0025] A13) Transgenic plant tissue containing the nucleic acid molecule 1 of A1);

[0026] A14) Transgenic plant tissue containing the expression cassette of A2);

[0027] A15) Transgenic plant tissue containing the recombinant vector of A3);

[0028] A16) Transgenic plant tissue containing the recombinant vector of A4);

[0029] A17) Transgenic plant organ containing the nucleic acid molecule 1 of A1);

[0030] A18) Transgenic plant organ containing the expression cassette of A2);

[0031] A19) Transgenic plant organ containing the recombinant vector of A3);

[0032] A20) Transgenic plant organ containing the recombinant vector of A4).

[0033] The biological material related to the coding gene SEP1 related to the effective panicle formation of the rice can be applied in the regulation of the effective panicle formation of the rice or in the application of the transgenic rice of the multiple tiller rice, and the nucleic acid molecule can be DNA, such as cDNA, genomic DNA or recombinant DNA; the nucleic acid molecule can also be RNA, such as mRNA or hnRNA, etc.

[0034] In the biological material related to the coding gene SEP1 related to the effective panicle number formation of the rice mentioned above, the expression cassette refers to the DNA capable of expressing the corresponding protein in the host cell, which can include not only the promoter initiating the transcription of the related gene, but also the terminator terminating the transcription of the related gene. For example, the expression cassette containing the nucleic acid molecule coding the coding gene SEP1 related to the effective panicle number formation of the rice mentioned in A2) refers to the DNA capable of expressing the coding gene SEP1 related to the effective panicle number formation of the rice in the host cell. Further, the expression cassette can also include the enhancer sequence. The promoters that can be used in the present application include but are not limited to: the constitutive promoters, the tissue, organ and development specific promoters, and the inducible promoters. Examples of the promoters include but are not limited to: the constitutive promoter 35S of the cauliflower mosaic virus; the wound inducible promoter from tomato, leucine aminopeptidase ("LAP", Chao et al. (1999) Plant Physiology 120:979-992); the chemical inducible promoter from tobacco, pathogenesis-related 1 (PR1) (induced by salicylic acid and BTH (benzothiadiazole-7-thiohydroxy acid S-methyl ester)); the tomato proteinase inhibitor II promoter (PIN2) or the LAP promoter (both of which can be induced by jasmonic acid methyl ester); the heat shock promoter (U.S. Patent 5,187,267); the tetracycline inducible promoter (U.S. Patent 5,057,422); the seed specific promoters, such as the millet seed specific promoter pF128 (CN101063139B (Chinese Patent 200710099169.7)), the seed storage protein specific promoters (for example, the promoters of the phaseolin, napin, oleosin and soybean beta conglycin (Beachy et al. (1985) EMBO J. 4:3047-3053)). They can be used alone or in combination with other plant promoters. All the references cited herein are incorporated in their entirety.Suitable transcription terminators include, but are not limited to, Agrobacterium nopaline synthase terminator (NOS terminator), a cauliflower mosaic virus CaMV 35S terminator, a tml terminator, a pea rbcS E9 terminator, and an opine and octopine synthase terminator (see, e.g., Odell et al. (1985) Nature 313:810; Rosenberg et al. (1987) Gene, 56:125; Guerineau et al. (1991) Mol. Gen. Genet, 262:141; Proudfoot (1991) Cell, 64:671; Sanfacon et al. Genes Dev., 5:141; Mogen et al. (1990) Plant Cell, 2:1261; Munroe et al. (1990) Gene, 91:151; Ballad et al. (1989) Nucleic Acids Res. 17:7891; Joshi et al. (1987) Nucleic Acid Res., 15:9627).

[0035] The recombinant vector containing the expression cassette of SEP1 gene related to the number of effective panicle formation of rice is constructed by using the existing plant expression vector, such as pET-28a, pCAMBIA2301, pSP72, pROKII, pBin438, pCAMBIA1302, pCAMBIA1301, pCAMBIA1300, pBI121, pCAMBIA1391-Xa or pCAMBIA1391-Xb (CAMBIA Company) and the like.

[0036] In the above-mentioned biological materials, the recombinant microorganism in any one of A5) to A8) or the recombinant microorganism in any one of B5) to B8) can be bacteria, yeast, algae or fungi; wherein the bacteria is from one of Escherichia, Erwinia, Agrobacterium, Flavobacterium, Alcaligenes, Pseudomonas or Bacillus; the transgenic cell line in any one of A9) to A12), the transgenic plant tissue in any one of A13) to A16), and the transgenic plant organ in any one of A17) to A20) do not include the propagation material of the plant.

[0037] The application also provides a method for increasing the number of effective panicles of rice, comprising the following steps: inhibiting or reducing the expression of a SEP1 gene in a receptor rice to obtain a target rice with a higher number of effective panicles than the receptor rice; the SEP1 gene is a gene encoding the SEP1 protein.

[0038] In the method, the inhibition or reduction of the expression of the SEP1 gene in the receptor rice is achieved by gene editing on the SEP1 gene in the rice. The gene editing is achieved by means of a CRISPR / Cas9 system.

[0039] In the method, the CRISPR / Cas9 system comprises a plasmid expressing a gRNA containing Cas9, and the target sequence of the gRNA is a fragment with a sequence arrangement rule of 5'-N X -NGG-3' or 5'-CCN-N X -3' in a DNA fragment shown in SEQ ID No. 2, wherein N represents any one of A, G, C and T, 14≤X≤30, X is an integer, and N X represents X continuous deoxyribonucleotides. Specifically, the target sequence of the gRNA can be 2141-2160 of SEQ ID No. 2.

[0040] To solve the above technical problems, the application further provides a plant agent for regulating the number of effective panicles of rice.

[0041] The plant agent provided by the application contains the protein or / and the biological material related to the protein.

[0042] The active ingredient of the plant agent can be the protein or / and the biological material related to the protein, and the active ingredient of the plant agent can also contain other biological components or / and non-biological components. The other active ingredients of the plant agent can be determined by a person skilled in the art according to the effect of the effective panicles of rice.

[0043] The target plant can be a monocotyledon or a dicotyledon. The monocotyledon can be a plant of the family Poaceae, and specifically can be rice.

[0044] The knockout experiment of the SEP1 gene in rice proves that the number of effective panicles of the transgenic rice with the SEP1 gene knocked out is increased. The overexpression experiment of the SEP1 gene coding sequence introduced into rice proves that the number of effective panicles of the transgenic rice with the SEP1 protein overexpressed is reduced compared with the receptor rice. Both the knockout experiment and the overexpression experiment prove that the SEP1 protein is a gene related to the number of effective panicles of rice, and inhibiting the SEP1 protein increases the number of effective panicles of rice. The method of the application is simple in operation, low in cost, greatly accelerates the breeding process, and has a wide application prospect. BRIEF DESCRIPTION OF DRAWINGS

[0045] Figure 1 Manhattan plot of genome-wide association analysis of panicle number in 299 rice germplasm materials in Example 1 of the present application;

[0046] Figure 2 Knockout type of SEP1 gene knockout material in Example 2 of the present application;

[0047] Figure 3 DNA level identification chart of SEP1 gene overexpression material in Example 2 of the present application;

[0048] Figure 4 SEP1 gene knockout material (sep1-1 and sep1-2), SEP1 gene overexpression material (SEP1-OE1 and SEP1-OE2) and wild type Nip (NIP) in Example 2 of the present application, and the phenotypes of effective panicle number and statistical charts thereof; the data shown are mean ± standard deviation, ** represents the significant analysis result P < 0.01, Panicle number is effective panicle number, unit is per plant. DETAILED DESCRIPTION

[0049] The present application provides a rice effective panicle number related protein SEP1 coding gene and its related biological materials and applications, and those skilled in the art can refer to the content herein to appropriately improve the process parameters. It is particularly pointed out that all similar substitutions and changes are obvious to those skilled in the art, and they are considered to be included in the present application. The method and application of the present application have been described by the preferred embodiments, and the relevant personnel can obviously modify or appropriately change and combine the method and application herein without departing from the content, spirit and scope of the present application, to realize and apply the present application technology.

[0050]

[0051]

[0052] SEQ ID No. 3: MAESLGLGALCRGGGWCYAAIWRSDRRDPRLLTIGEFHSEDGTRNVVEKMLNQVHVVGEGIIGRALVSGECQWISDTSFSFAQTSDADNQDLFQGYTWWQHQFLCGIKTIAVIPIADLGVAQFGSMQKISECLEFLDQVKGIFCQREIVPWDLSAEEIQRNVLPYHQQFQLSSLSSADGLTNIKTDPENKKLLENSASVESLRSLASFSSKYSQSSSNGFTSYESCNSMNPHIVAMPVNSKSINTVRAFNSTGKLLQHNIGSENPLQIKFCQHPDSNLASATDVFLSLNNLPRIENEISCPPNKLGYCIQSEKPYSFQSSFSSCFSVGDELKPILFDSATSFVQNDLMQEFNLTGFTSQADSAVHELPKQILGETATGALYSDRKSNNGSSDLLDGTIFDPFVQEWCDNNALLEGNTPHFGATTADSVTEHASSYPLSVEERSLFSESVFEELLGVSGNVNTDAPGDSAVVMAGDPLVGLVSGCQLPTYTLQDSLSVCKPQQEPSLDFPSGSDTSEHVPNGSSKMIPLSLGALSMDDCCSLNTAHSKVSQVKRPEEVKVVKKRARPGESTRPRPKDRQQIQDRVKELREIVPNSAKCSIDALLDRTIKHMLFLQSVTKYAEKIKQADEPKMISNKDSGAVLKENSSGVVLKDNSSAGSNNGGATWAYEVAGRTMVCPIIIEDLSPPGQMLVEMLCEERGFFLEIADTIRGFGLTILKGLMELRDGKIMARFLVEANKNVTRMDIFLSLVQLLQQNSLNRSSDQISKVIRNGVPSFAEHQQSPISVPVGLADR;

[0053] The test materials used in the present application are all ordinary commercially available products, which can be purchased in the market. The present application is further described below in combination with examples:

[0054] Example 1 Obtaining of SEP1 gene

[0055] The application utilizes 299 rice germplasm materials, plants and investigates effective ear number in Beijing, utilizes MLM model to carry out whole genome correlation analysis, combines RiceXPro website gene expression, nonsynonymous variation annotation information and tiller bud expression verification, and locates to obtain the SEP1 gene.

[0056] The SEP1 gene is obtained by PCR amplification with the cDNA of rice variety Nipponbare as a template, and the primers used are as follows:

[0057] SEP1-F: 5'-atggcggagtcgctgggactg-3' (SEQ ID No. 4);

[0058] SEP1-R: 5'-tcatctatctgcaaggccaac-3' (SEQ ID No. 5).

[0059] The coding sequence nucleotide sequence of the SEP1 gene is shown in SEQ ID No. 1 1-2379, which encodes the protein SEP1, and the amino acid sequence of the protein is SEQ ID No. 3.

[0060] Example 2: Function verification of SEP1 protein

[0061] I. Construction of knock-out vector

[0062] (1) To prove the gene function of SEP1, the gene knock-out is carried out. The specific target is designed by using the genome sequence of Nip as a template on the website (http: / / crispor.tefor.net / ). The specific as follows:

[0063] Target sequence: 5'-tcagttcctgtgtggaataa-3' (SEQ ID No. 6, same as SEQ ID No. 2 2141-2160).

[0064] The position of the SEP1 gene knock-out target sequence on the genome is shown in SEQ ID No. 2, which is located in the fourth exon. Figure 2

[0065] (2) Two complementary DNA sequences are designed, which are as follows:

[0066] F: 5'-ggca tcagttcctgtgtggaataa -3' (SEQ ID No. 7);

[0067] R: 5'-aaac ttattccacacaggaactga -3' (SEQ ID No. 8).

[0068] ​The pCBC-MT1T2 plasmid was used as a template, and the target-related primers were used for amplification. After recovering the target fragment, the enzyme digestion and ligation system was configured according to Table 1 below, and the vector enzyme digestion and ligation reaction was performed in a PCR instrument at 37°C for 4 h; 50°C for 5 min; and 80°C for 10 min. After ligation, bacterial transformation and positive clone identification were performed.

[0069] Table 1. Ligation reaction system (15 μL)

[0070]

[0071] II. Construction of overexpression vector

[0072] The overexpression vector used in the experiment is named pCM1307-HF, which is driven by a 35S promoter. Primers were designed according to the coding region sequence of SEP1 annotated on the MSU7.0 website, and the primer homologous arms were added according to the sequence of the pCM1307-HF vector for PCR amplification. The pCM1307-HF vector was linearized by double digestion with Spe I and Kpn I. The CDS sequence of SEP1 was connected between the two enzyme digestion sites using a homologous recombinase. The primers used are as follows:

[0073] SEP1-OE-F: atcgataccgtcgacgagctctctagaactagtatggcggagtcgctgggact (SEQ ID No. 9);

[0074] SEP1-OE-R: agactggtgatttttgcggagtacccgggtacctcatctatctgcaaggccaac (SEQ ID No. 10)

[0075] The above primers are written in the 5' to 3' direction.

[0076] The structure of the SEP1-OE vector is described as follows: the small fragment between the enzyme digestion sites Spe I and Kpn I of the pCM1307-HF vector is replaced by the SEP1 coding region sequence to obtain a positive plasmid, which is the recombinant expression vector of the SEP1 protein. The SEP1 coding sequence is shown in SEQ ID No. 1, nucleotides 1-2379.

[0077] III. Obtaining of transgenic rice

[0078] a. Agrobacterium tumefaciens transformation

[0079] (1) The constructed plasmid was added to the melted EHA105 competent cells on ice, mixed uniformly with a pipette, and then incubated on ice for 30 min;

[0080] (2) The competent cells were frozen in liquid nitrogen for 5 min, then heat shocked in a 37°C water bath for 5 min, and quickly cooled on ice for 2 min;

[0081] (3) 600 μΐ of liquid YEP medium was added in a sterile operation table, and cultured in a 28°C constant temperature shaker at 220 rpm for 4 h;

[0082] (4) After the above culture solution was centrifuged, the bacterial pellet was evenly spread on the corresponding resistant solid YEP medium, and cultured at 28°C in the dark for 2-3 days;

[0083] (5) Single colonies were picked and cultured in the corresponding resistant liquid YEP medium, and after the bacterial turbidity, colony PCR identification and sequencing identification of positive clones were performed.

[0084] b. Inducing callus and Agrobacterium infection

[0085] (1) The shelled rice seeds were sequentially sterilized with 75% alcohol and 20% sodium hypochlorite solution, and then washed with sterile water several times. After the seeds were dried by blowing, they were evenly spread on NB induction medium and cultured at 28°C for 10-14 days until callus grew out. The callus was peeled off and cultured in new NB medium for 2-3 days.

[0086] (2) Agrobacterium stored at -80°C was spread on YEP solid medium containing the corresponding antibiotic and cultured at 28°C in the dark for 2-3 days. After successful activation of Agrobacterium, single colonies were picked and resuspended in AAM containing 60 μΐ of acetosyringone. After mixing, the OD600 was adjusted to 0.3-0.4, and the Agrobacterium was cultured at 28°C in a constant temperature shaker at 220 rpm for 30 min to obtain the infection solution. The subcultured callus in (1) was placed in a sterilized 100 mL conical flask, and the infection solution was poured in. During the 30 min, it was shaken every 15 min. Then the infected callus was transferred to a culture dish covered with sterile filter paper, dried by blowing, and cultured at 26°C in the dark for 3 days.

[0087] c. Screening callus and obtaining transgenic seedlings by differentiation

[0088] (1) The above obtained callus was washed with sterile water, sterile water containing timentin and cefotaxime, and then transferred to a new culture dish covered with sterile filter paper and dried by blowing in the super-clean table. The washed callus was transferred to the delayed screening medium and cultured at 26°C in the dark for 10 days;

[0089] (2) then continue to transfer to the screening medium, 26°C in the dark for 2-4 weeks, until the emergence of new resistance callus; callus peeling after re-transferred to a new screening medium for two screening; the growth of callus transferred to the pre-differentiation medium, 26°C in the dark for 1 week, continue to transfer callus to differentiation medium 26°C until the rice seedlings grow roots;

[0090] (3) the seedlings were transferred to 1 / 2 MS solid medium, 28°C light conditions for 2 weeks, after hardening can be transplanted to the field. The medium used in the above transgenic process is shown in Table 2.

[0091] Table 2. Medium used in the process of transgenic

[0092]

[0093] Note: NB medium basic ingredients include N6 macro elements, B5 trace elements, B5 organic ingredients, 150 mg / L myo-inositol, 300 mg / L hydrolyzed casein, 500 mg / L glutamine, 600 mg / L proline, 30 g / L sucrose, 3 g / L plant gel.

[0094] d. PCR identification of positive transgenic materials

[0095] The T0 generation SEP1-OE transgenic material and the T0 generation SEP1-CR transgenic material obtained by transformation were subjected to DNA level PCR identification and sequencing identification.

[0096] The SEP1-OE transgenic material identification primer is SEP1-OE-check-F and SEP1-OE-check-R:

[0097] SEP1-OE-check-F: 5'-atgggcgactacaaagaccatg-3' (SEQ ID No. 11)

[0098] SEP1-OE-check-R: 5'-tatggcttctcactttgtat-3' (SEQ ID No. 12).

[0099] The size of the target fragment is 944 bp, and the plants containing the target fragment in the amplification product are positive, and the plants not containing the target fragment are negative, and the identification results of part of the positive samples are shown in Figure 3 The positive plants are T0 generation SEP1-OE transgenic materials (i.e. SEP1 gene overexpression materials).

[0100] SEP1-CR transgenic material identification sequencing primers are SEP1-CR-check-F and SEP1-CR-check-R:

[0101] SEP1-CR-check-F: 5'-aatccgcctaactcttgcct-3' (SEQ ID No. 13);

[0102] SEP1-CR-check-R: 5'-aaactgtgcgacaccaagat-3' (SEQ ID No. 14).

[0103] The sequencing peak chart of the SEP1-CR transgenic material (i.e. SEP1 knockout material) T0 generation is shown in Figure 2 , and the homozygous material is named as sep1-1 and sep1-2.

[0104] IV. Identification of effective ear number related traits of transgenic material

[0105] The homozygous positive lines (sep1-1 and sep1-2) of SEP1-CR and the overexpression lines SEP1-OE (SEP1-OE1 and SEP1-OE2) and Nipponbare (NIP) are sowed in Shangzhuang Experimental Station of China Agricultural University, Beijing. After seed soaking and germination, the seedlings are grown in the seedbed for 30 days, and then the seedlings are transplanted in the field, 7 plants per row, plant spacing 20 cm, row spacing 25 cm, and 10 rows are transplanted. The effective ear number at the mature stage is counted and investigated, 15 plants of each material are investigated (single plant in the edge row is not counted), and the results are shown in Figure 4 , which shows that the effective ear number of the knockout materials sep1-1 and sep1-2 is significantly more than that of the wild type Nipponbare, and the overexpression materials SEP1-OE1 and SEP1-OE2 show the phenotype of reduced effective ear number compared with the wild type Nipponbare.

[0106] The above has been described in detail. For those skilled in the art, without departing from the purpose and scope of the present application, and without unnecessary experiments, the present application can be implemented in a wider range under the same parameters, concentrations and conditions. Although the present application gives a special example, it should be understood that the present application can be further improved. In general, according to the principle of the present application, the present application intends to include any change, use or improvement of the present application, including changes made by conventional techniques known in the art, which are out of the scope disclosed in the present application. Some basic features can be applied according to the scope of the following attached claims.

Claims

1. A protein, characterized in that, The protein is a protein that is, as shown in A1), A2), or A3): A1) The amino acid sequence is that of the protein listed as SEQ ID No. 3 in the sequence listing; A2) A protein derived from a) that has the activity of the SEP1 protein encoded by the rice effective panicle number-related gene, obtained by substituting and / or deleting and / or adding one or more amino acid residues of the protein in A1). A3) A fusion protein obtained by attaching a protein tag to the N-terminus and / or C-terminus of A1) or A2).

2. The protein according to claim 1, characterized in that, The protein is derived from rice.

3. A biomaterial relating to the protein of claim 1 or 2, characterized in that, It is any one of B1) to B7) below: B1) A DNA molecule encoding the protein of claim 1; B2) An expression cassette containing the DNA molecule described in B1); B3) A recombinant vector containing the DNA molecule described in B1), or a recombinant vector containing the expression cassette described in B2); B4) Recombinant microorganisms containing the DNA molecule described in B1), or recombinant microorganisms containing the expression cassette described in B2), or recombinant microorganisms containing the recombinant vector described in B3); B5) A transgenic plant cell line, transgenic plant cell line, transgenic plant tissue or transgenic plant organ containing the DNA molecule described in B1), or a transgenic plant cell line, transgenic plant cell line, transgenic plant tissue or transgenic plant organ containing the expression cassette described in B2). B6) Reduce the expression of nucleic acid molecules by the DNA molecules described in B1); B7) Expression cassettes, recombinant vectors, recombinant microorganisms, transgenic plant cell lines, transgenic plant tissues, or transgenic plant organs containing the nucleic acid molecules described in B6).

4. The biomaterial according to claim 3, characterized in that, B1) The DNA molecule described is a gene as shown in b1) or b2) below: b1) The coding sequence of the coding strand is the cDNA molecule or DNA molecule of SEQ ID No. 1; b2) The nucleotides of the coding strand are cDNA or DNA molecules of SEQ ID No.

1.

5. Use of the protein of claim 1 or 2, or the biomaterial of claim 3 or 4, in any of the following C1-C2: C1) Regulate the number of effective panicles; C2) Prepare products with an effective number of ears.

6. The application according to claim 5, characterized in that, The regulation of the effective number of panicles is to increase the effective number of panicles.

7. The application according to claim 5, characterized in that, The regulation of the effective number of spikelets is to reduce the effective number of spikelets; the reduction of the effective number of spikelets is achieved by promoting or increasing the expression of the gene encoding the protein of claim 1.

8. A method for increasing the number of effective panicles in rice, characterized in that, This includes inhibiting or reducing the expression of a gene in the recipient rice to obtain a target rice with a higher effective panicle number than the recipient rice; the gene is the gene encoding the protein of claim 1.

9. The method according to claim 8, characterized in that, The inhibition or reduction of gene expression in the recipient rice is achieved by knocking out the gene in the recipient rice using a CRISPR / Cas9 system; the CRISPR / Cas9 system includes a plasmid expressing Cas9 and gRNA, wherein the target sequence of the gRNA is positions 2141-2160 of SEQ ID No.

2.

10. A plant-based reagent, characterized in that, The reagent contains the protein of claim 1 or 2 and / or the protein-related biomaterial of claim 3 or 4.

Images