Antibacterial peptide and application thereof

By mutating the amino acid sequence of the black soldier fly antimicrobial peptide Cecropin-α to increase the β-sheet, 10 mutants were developed and applied to livestock and poultry feed. This solved the problem of the limited improvement of existing antimicrobial peptides in livestock and poultry farming and the problem of multiple antibiotic use, achieving significant antibacterial effects and improved livestock and poultry growth performance.

CN120965846APending Publication Date: 2025-11-18丽水市畜牧农机发展中心
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202511250920.3
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2024-12-18
Publication Date
2025-11-18

AI Technical Summary

Technical Problem

There is room for improvement in the application of existing antimicrobial peptides in livestock and poultry farming, especially the impact of their folding mechanism on efficacy, and the problem of drug resistance and poor prevention and control effects caused by the use of multiple antibiotics.

Method used

By mutating the amino acid sequence of the black soldier fly antimicrobial peptide Cecropin-α to increase the β-sheet, 10 mutants were developed to inhibit Staphylococcus aureus, significantly improving the antibacterial effect, and were applied to feed.

Benefits of technology

It significantly improved the feeding effect of chickens, enhanced the growth and egg production performance of livestock and poultry, and reduced the risk of drug resistance.

✦ Generated by Eureka AI based on patent content.
Patent Text Reader

Abstract

The invention discloses an antibacterial peptide and application thereof. The antibacterial peptide can inhibit bacteria and can be applied to a feed composition. When the feed is used for feeding the Songyang chickens, the growth performance and the egg laying performance of the Songyang chickens can be remarkably improved, and the feed has a potential application prospect.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and more specifically, to an antimicrobial peptide and its applications. Background Technology

[0002] In animal husbandry, disease control is a crucial aspect, especially with today's intensive feeding practices, which increase the risk of bacterial diseases. Antibiotics are commonly used for prevention and treatment, but they are prone to resistance and reduced effectiveness. To improve efficacy, multiple antibiotics with different resistances are often added. However, antagonism between these antibiotics can lead to poor results, and the use of multiple antibiotics can damage the animal's digestive system, thus affecting feeding outcomes and reducing farming profits.

[0003] Antimicrobial peptides have advantages such as broad-spectrum antimicrobial activity, thermal stability, no residue, and low susceptibility to drug resistance. Many antimicrobial peptides have already been used in the aquaculture field, for example, in aquaculture, they are often used as new antibiotic alternatives. In the livestock and poultry farming field, using antimicrobial peptides as feed additives is a major application direction. For example, adding cephalosporin antimicrobial peptides to the basal feed of pregnant sows can improve the health rate of piglets and reduce the diarrhea rate of piglets (Guo Qiang, He Tao. Effects of adding cephalosporin antimicrobial peptides to the diet of pregnant sows on reproductive performance and postpartum piglet growth performance [J]. Feed and Animal Husbandry, 2012(12): 54-56). After feeding antimicrobial peptides to piglets, the levels of IL-6 and TNF-α in their serum were found to be significantly reduced (HU WY, YANG YY, LI Z, et al. Antibacterial, cytotoxicity and mechanism of the antimicrobial peptide KR-32 in weaning piglets[J]. International Journal of Peptide Research and Therapeutics, 2020,26(2):943-953.), which demonstrates the role of antimicrobial peptides as feed additives.

[0004] Currently, most antimicrobial peptides are short peptides in their natural form. However, there is still room for improvement in the natural form of antimicrobial peptides. For example, researchers have found that the folding pattern of antimicrobial peptides may affect their efficacy, which has become another direction for the development of antimicrobial peptides. Summary of the Invention

[0005] To address the above problems, this invention provides an antimicrobial peptide and its applications.

[0006] In one aspect, the present invention provides a polypeptide comprising an amino acid sequence having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 100% identity with the amino acid sequence shown in SEQ ID NO:1.

[0007] In one aspect, the present invention provides a nucleic acid molecule encoding the polypeptide described herein.

[0008] In one aspect, the present invention provides an expression vector comprising the nucleic acid molecule described herein.

[0009] In one aspect, the present invention provides a host cell comprising the nucleic acid molecules or expression vectors described herein.

[0010] In one aspect, the present invention provides a composition comprising the polypeptide described herein.

[0011] In one aspect, the present invention provides a pharmaceutical composition comprising the polypeptide described herein, or a composition thereof.

[0012] In one aspect, the present invention provides a feed composition comprising the polypeptide or composition described herein.

[0013] In one aspect, the present invention provides the use of the aforementioned polypeptides, nucleic acid molecules, expression vectors, compositions, or feed compositions in the preparation of animal feed.

[0014] In another aspect, the present invention also provides a method for improving animal feeding effects by feeding animals with the feed composition of the present invention.

[0015] Beneficial effects This invention identifies 10 possible mutation modes by mutating known antimicrobial peptides and increasing β-sheet. When used as an antimicrobial agent to inhibit Staphylococcus aureus, the antimicrobial effect is significantly stronger than that of the wild type.

[0016] This invention develops a composition based on antimicrobial peptides, which, when used in feed, can significantly improve the feeding effect of chickens and has potential application value.

[0017] The antimicrobial peptides of this invention are relatively short, the preparation method is simple, and they are suitable for large-scale applications.

[0018] The above description is merely an overview of the technical solution of the present invention. In order to better understand the technical means of the present invention and to implement it in accordance with the contents of the specification, the preferred embodiments of the present invention are described below. Detailed Implementation

[0019] General Technology The techniques and procedures described or cited herein include those generally well understood by those skilled in the art and / or commonly employed using conventional methods, such as the widely used methods described in Sambrook et al., Molecular Cloning: A Laboratory Manual (3rd edition, 2001); Current Protocols in Molecular Biology (Ausubel et al., eds., 2003).

[0020] General terms Unless otherwise described, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. For the purposes of interpreting this specification, the following terminology will be applied, and where appropriate, terms used in the singular will also include the plural form, and vice versa. All patents, applications, published applications, and other publications are incorporated herein by reference in their entirety. If any description of terminology set forth herein conflicts with any document incorporated herein by reference, the terminology set forth herein shall prevail.

[0021] As used herein, the terms “antimicrobial peptide,” “antimicrobial polypeptide,” “antimicrobial protein,” and “antimicrobial protein” are synonymous and are used herein to refer to polymers of amino acid residues having antimicrobial, bacteriostatic, or bactericidal functions. This term applies to amino acid polymers in which one or more amino acid residues are artificial chemical analogs of the corresponding naturally occurring amino acids, as well as to both naturally occurring and non-naturally occurring amino acid polymers. Unless otherwise stated, a particular polypeptide sequence also implicitly encompasses variants of its conserved modifications.

[0022] As used herein, the term "amino acid" refers to twenty common, naturally occurring amino acids. Naturally occurring amino acids include alanine (A), arginine (R), asparagine (N), aspartic acid (D), cysteine ​​(C); glutamic acid (E), glutamine (Q), glycine (G), histidine (H), isoleucine (I), leucine (L), lysine (K), methionine (M), phenylalanine (F), proline (P), serine (S), threonine (T), tryptophan (W), tyrosine (Y), and valine (V).

[0023] The term "administer / administration" refers to the act of injecting or otherwise physically delivering a substance (e.g., a therapeutic agent) that is present outside the body into a patient's body, such as via mucosal, intradermal, intravenous, intramuscular delivery, and / or any other physical delivery method described herein or known in the art. When treating a disease, condition, disorder, or symptom thereof, the substance is typically administered after the onset of said disease, condition, disorder, or symptom. When preventing a disease, condition, disorder, or symptom thereof, the substance is typically administered before the onset of said disease, condition, disorder, or symptom.

[0024] As used herein, an "effective amount" is generally an amount sufficient to reduce the severity and / or frequency of symptoms; eliminate symptoms and / or underlying causes; prevent the occurrence of symptoms and / or their underlying causes; and / or improve or remedy damage caused by or associated with a disease, condition, or disorder, including, for example, infection and lesion formation. In some embodiments, an effective amount is a therapeutically effective amount or a preventatively effective amount.

[0025] As used herein, the term "therapeuticly effective amount" refers to an amount of agent (e.g., a vaccine composition) sufficient to reduce and / or improve the severity and / or duration of a given disease, condition, or ailment, and / or its associated symptoms (e.g., infectious diseases such as those caused by viral infections, or proliferative diseases such as cancer). The "therapeuticly effective amount" of the substances / molecules / agents disclosed herein (e.g., the lipid nanoparticle compositions described herein) can vary depending on numerous factors, such as an individual's disease state, age, sex, and weight, and the ability of the substance / molecule / agent to elicit a desired response in the individual. A therapeutically effective amount comprises the amount in which the therapeutically beneficial effect of the substance / molecule / agent outweighs any of its toxic or harmful effects.

[0026] As used herein, a “preventive effective dose” is an amount of pharmaceutical composition that, when administered to a subject, will have the expected preventive effect, such as preventing a disease, condition, disorder, or related symptoms (e.g., infectious diseases, such as those caused by viral infections, or proliferative disorders, such as cancer), delaying its onset (or recurrence), or reducing the likelihood of its onset (or recurrence). Typically, but not necessarily, because the preventive dose is administered to the subject before or at an early stage of the disease, condition, or disorder, the preventive effective dose may be less than the therapeutic effective dose. A complete therapeutic or preventive effect may not occur with a single dose, but may occur only after a series of doses. Therefore, a therapeutic or preventive effective dose may be administered in one or more doses.

[0027] As used herein and unless otherwise stated, the term “treat / treating / treatment” means the complete or partial relief of a symptom, disease, or illness, or one or more symptoms associated with a symptom, disease, or illness, or the slowing or halting of the further progression or worsening of those symptoms, or the relief or eradication of the cause of the symptom, disease, or illness itself.

[0028] As used herein and unless otherwise stated, the term “prevent / preventing / prevention” means reducing the likelihood of the onset (or recurrence) of a disease, condition, illness, or related symptoms (such as infectious diseases, such as those caused by viral infections, or proliferative diseases, such as cancer).

[0029] As used herein and unless otherwise stated, the term "manage / managing / management" refers to a beneficial effect obtained by a subject from a therapy (e.g., a preventative or therapeutic agent) that does not result in a cure of the disease. In some embodiments, administering one or more therapies (e.g., preventative or therapeutic agents, such as the lipid nanoparticle compositions described herein) to a subject to "manage" an infectious or neoplastic disease, one or more of its symptoms, thereby preventing the progression or worsening of the disease.

[0030] The term "preventive agent" refers to any agent that can completely or partially suppress the development, recurrence, onset, or spread of a subject's disease and / or related symptoms.

[0031] The term "therapeutic agent" means any agent that can be used to treat, prevent or alleviate a disease, condition or ailment, including any agent used to treat, prevent or alleviate one or more symptoms of a disease, condition or ailment and / or its associated symptoms.

[0032] The term "therapy" means any regimen, method, and / or agent that can be used to prevent, manage, treat, and / or improve a disease, condition, or disorder. In some embodiments, the term "therapies" refers to biological therapies, supportive therapies, and / or other therapies known to those skilled in the art, such as medical personnel, for the prevention, management, treatment, and / or improvement of a disease, condition, or disorder.

[0033] The terms "subject" and "patient" are used interchangeably. As used herein, in some embodiments, the subject is a mammal, such as a non-primate (e.g., cow, pig, horse, cat, dog, rat, etc.) or a primate (e.g., monkey and human). In a particular embodiment, the subject is a human. In one embodiment, the subject is a mammal (e.g., a human) suffering from an infectious disease or a neoplastic disease. In another embodiment, the subject is a mammal (e.g., a human) at risk of developing an infectious disease or a neoplastic disease.

[0034] As used in this article, “substantially all” means at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, at least about 99%, or about 100%.

[0035] As used herein and unless otherwise stated, the terms “about” or “approximately” mean an acceptable error in a particular value as determined by a person skilled in the art, depending in part on the method by which the value is measured or determined. In some embodiments, the terms “about” or “approximately” mean within 1, 2, 3, or 4 standard deviations. In some embodiments, the terms “about” and “approximately” mean within 20%, 15%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, 0.5%, 0.05%, or less of a given value or range.

[0036] Unless the context clearly indicates otherwise, the singular terms “a (species)” and “described” as used herein include plural references.

[0037] All publications, patent applications, registration numbers, and other references cited herein are incorporated herein by full reference as if each individual publication or patent application were specifically and individually incorporated by reference. The publications discussed herein provide only those published prior to the filing date of this application. Nothing herein should be construed as an admission that the invention is not entitled to precedence over such publications. Furthermore, the publication dates provided may differ from the actual publication dates, which may require independent verification.

[0038] Several embodiments of the invention have been described. However, it should be understood that various modifications can be made without departing from the spirit and scope of the invention. Therefore, the descriptions in the experimental sections and examples are intended to illustrate, and not limit, the scope of the invention as described in the claims.

[0039] Antimicrobial peptides Wild-type antimicrobial peptides This disclosure provides a novel variant of an antimicrobial peptide, WT, which is selected from the black soldier fly antimicrobial peptide Cecropin-α described in CN202011471892.5. Based on this, its amino acid sequence is as follows: MNFSKLFVFVAVVIALLVAFAGQSEAGWSRSLWFKKIEKPVERAGQRIRDATIQGIAIQQGANVLTVRGGVLAQARGLKG (SEQ ID NO.1) Antimicrobial peptide variants In some implementations, the selected group of amino acids considered to be mutually conserved substitutions includes: acid residues D and E basic residues K, R, and H Hydrophilic uncharged residues S, T, N, and Q Aliphatic uncharged residues G, A, V, L and I Nonpolar, uncharged residues C, M, and P Aromatic residues F, Y and W Group 1 A, S, and T 2 groups D and E 3 groups N and Q 4 groups R and K 5 groups I, L and M 6 groups F, Y and W In some implementations, other selected groups of amino acids considered to be mutually conserved substitutions include: Considering that its activity is related to the folding mode of the peptide, the applicant predicted its structure and believed that increasing its β-sheet could improve its antibacterial properties, and found a mutation mode.

[0040] mutant group Mutation method Mutated codons Mutation 1 A15I ATT Mutation 2 A15F TTC Mutation 3 A15W TGG Mutation 4 A15T ACG Mutation 5 A15Y TAC Mutation 6 G61V GTG Mutation 7 G61F TTC Mutation 8 G61W TGG Mutation 9 G61T ACG Mutation 10 G61I ACC Compositions containing antimicrobial peptides In one embodiment, the pharmaceutical composition described herein represents a composition containing one or more of the antimicrobial peptide JL33 described herein, as well as other components such as physiological / pharmaceutical-grade carriers and excipients. The purpose of the pharmaceutical composition is to facilitate administration to a living organism, to facilitate the absorption of the active ingredient, and thus to exert its biological activity. In this disclosure, "pharmaceutical composition" and "formulation" are not mutually exclusive.

[0041] In some embodiments, when delivering the pharmaceutical composition to animals (e.g., poultry), various delivery systems are known and can be used to administer the pharmaceutical composition. Methods of introduction include, but are not limited to, eye drops, intranasal administration, and oral administration.

[0042] Feed additives containing antimicrobial peptides The feed additives referred to herein contain antimicrobial peptide JL33 and / or its homologs. When used, the additives are mixed into the feed composition. Therefore, antimicrobial peptide JL33 can be used in combination with one or more of the following: nutritionally acceptable carriers, nutritionally acceptable diluents, nutritionally acceptable excipients, nutritionally acceptable adjuvants, and nutritionally active ingredients. For example, at least one component selected from the group consisting of: protein, peptide, sucrose, lactose, sorbitol, glycerol, propylene glycol, sodium chloride, sodium sulfate, sodium acetate, sodium citrate, sodium formate, sodium sorbate, potassium chloride, potassium sulfate, potassium acetate, potassium citrate, potassium formate, potassium acetate, potassium sorbate, magnesium chloride, magnesium sulfate, magnesium acetate, magnesium citrate, magnesium formate, magnesium sorbate, sodium metabisulfite, methylparaben, and propylparaben.

[0043] In some embodiments, the antimicrobial peptides of this disclosure are mixed with feed components to form a feed. As used herein, "feed component" means all or part of the feed. A portion of the feed may mean one ingredient or more (e.g., two, three, four or more) of the feed. In one embodiment, the term "feed component" encompasses a premix or premix component.

[0044] In some embodiments, the feed composition may be a forage or a premix thereof, a compound feed or a premix thereof. The feed additive composition may be mixed with the compound feed, compound feed components, or incorporated into a premix of the compound feed or into the forage, forage components, or forage premix. Any feed described herein may contain one or more feed materials selected from the group consisting of: a) cereals, such as small grains (e.g., wheat, barley, rye, oats, triticale and combinations thereof) and / or large grains such as corn or sorghum; b) by-products from cereals, such as corn gluten meal, wet cake (especially corn-based wet cake), dried distillers grains (DDG) (especially corn-based dried distillers grains (cDDG)), dried distillers grains with solubles (DDGS) (especially corn-based dried distillers grains with solubles (cDDGS)), wheat bran, whole wheat flour, wheat middlings, rice bran, rice husks, oat husks, palm kernels and citrus pomace; c) proteins derived from sources such as soybeans, sunflower seeds, peanuts, lupins, peas, broad beans, cotton, low-erucic acid rapeseed, fish meal, dried plasma protein, meat and bone meal, potato protein, whey, dried coconut meat, sesame; d) oils and fats derived from plant and animal sources; e) minerals and vitamins.

[0045] Example 1: Obtaining Antimicrobial Peptide Variants Based on the black soldier fly antimicrobial peptide Cecropin-α described in CN202011471892.5, its amino acid sequence is as follows: MNFSKLFVFVAVVIALLVAFAGQSEAGWSRSLWFKKIEKPVERAGQRIRDATIQGIAIQQGANVLTVRGGVLAQARGLKG (SEQ ID NO.1) In this application, the antimicrobial peptide is mainly used for the prevention and control of Salmonella. In order to better apply the antimicrobial peptide to the aquaculture field, the inventors considered to increase the duration of the antimicrobial peptide's efficacy. Therefore, they proposed to mutate the sequence of the above-mentioned antimicrobial peptide to increase the β-sheet. Through prediction, the short peptide was mutated, resulting in 10 mutants.

[0046] Table 1 mutant group Mutation method Mutated codons Mutation 1 A15I ATT Mutation 2 A15F TTC Mutation 3 A15W TGG Mutation 4 A15T ACG Mutation 5 A15Y TAC Mutation 6 G61V GTG Mutation 7 G61F TTC Mutation 8 G61W TGG Mutation 9 G61T ACG Mutation 10 G61I ACC Example 2: Validation of the antibacterial effect of the antimicrobial peptide variant Preparation of antimicrobial peptide variants There are two methods for preparing antimicrobial peptides: one is to synthesize short peptides by GenScript Biochemicals; the other is to express them using E. coli. Based on the encoding nucleotide of the wild-type antimicrobial peptide (atgaactttagcaaactgtttgtgtttgtggcggtggtgattgcgctgctggtggcgtttgcgggccagagcgaagcgggctggagccgcagcctgtggtttaaaaaaattgaaaaaccggtggaacgcgcgggccagcgcattcgcgatgcgaccattcagggcattgcgattcagcagggcgcgaacgtgctgaccgtgcgcggcggcgtgctggcgcaggcgcgcggcctgaaaggc (SEQ ID NO. 2)), the encoding nucleotide sequences of various variants were designed (codon adaptation modifications were made according to the amino acids corresponding to the mutations in Table 1), and the wild-type antimicrobial peptide and various variants were constructed into pET-32a(+). The vector (Ubibio, VT1216) was used to transfect the antimicrobial peptide WT and various variant expression plasmids into DH5α competent cells (Beyotime, D1031S). After propagation, the DH5α competent cells were plated on plates containing AMP. Single colonies were then picked and sent to Novizan Biotechnology for sequencing to verify the correct sequence. The colonies were then amplified and expressed in large quantities. The cells were collected by centrifugation, high-pressure lysed to release the target protein, purified by nickel column chromatography, and then freeze-dried and concentrated.

[0047] Comparison of antibacterial effects The indicator bacterium used in this embodiment is Staphylococcus aureus.

[0048] MIC was determined using the micro-dilution method: To prepare the bacterial suspension, dilute Staphylococcus aureus cultured to the logarithmic growth phase to a concentration of 10. 5 CFU / mL, the purified antimicrobial peptide solutions were mixed with an equal volume of bacterial suspension in the first column of a 96-well plate. The initial concentration of the antimicrobial peptide samples was 200 μg / mL, followed by serial dilutions. An equal volume of the diluted bacterial suspension was added to all samples in the 96-well plate, and Staphylococcus aureus was incubated at 37°C for 18 h. The turbidity of each well was observed visually; the minimum concentration at which the solution in the well became clear was defined as the MIC of the antimicrobial peptide. The results are as follows: Table 2 Group MIC (μg / mL) Mutation 1 15.2 Mutation 2 12.3 Mutation 3 9.6 Mutation 4 17.4 Mutation 5 12.8 Mutation 6 13 Mutation 7 18 Mutation 8 10.2 Mutation 9 14.6 Mutation 10 11.2 WT 16.4 The results are shown in Table 2. The antimicrobial activity of each antimicrobial peptide variant was significantly altered compared to WT. Among them, mutations 1-3, 5-6, and 8-10 all showed improved antimicrobial effects compared to WT. In particular, mutations 3, 8, and 10 showed significantly better inhibitory effects than WT and other variants.

[0049] Example 3: Testing the effects of various antimicrobial peptide variants on Songyang chicken. Testing the effects of various antimicrobial peptide variants on the growth performance of Songyang chickens Three hundred and thirty 4-week-old male Songyang chickens with similar weights (average weight 0.29 ± 0.04 kg) were randomly divided into 11 groups, with ten replicates per group. An antimicrobial peptide was added to each of the following feed ingredients: 65 parts corn; 10 parts soybean meal; 6 parts rice bran; 1.5 parts bone meal; 0.1 parts each of vitamin A, vitamin D3, vitamin K, and vitamin E; 0.02 parts each of copper, zinc, and magnesium; and 0.3 parts salt. Supplemental lighting was provided in the morning and evening, with the lighting time increased by 0.5-1 hour each week until a total of 14-16 hours of light per day was achieved. Chickens were fed 3-4 times daily to meet their needs, and provided free access to water. The watering equipment was cleaned and disinfected daily. The weights of the chickens in each group were measured at 21 weeks of age. The results are as follows: Table 3 Group Weight (kg) Mutation 1 0.92 Mutation 2 1.02 Mutation 3 1.24 Mutation 4 0.89 Mutation 5 1.06 Mutation 6 0.9 Mutation 7 0.88 Mutation 8 0.92 Mutation 9 0.98 Mutation 10 1.17 WT 1.01 Control group (no antimicrobial peptides added) 0.97 Analysis of the above results shows that the weight of Songyang chickens fed with feed containing antimicrobial peptide mutants 3 and 10 was significantly higher than that of other groups, as well as the WT and control groups. This indicates that these two antimicrobial peptide variants can improve the growth performance of Songyang chickens.

[0050] Testing the effects of various antimicrobial peptide variants on the egg production performance of Songyang chickens Three hundred and thirty 5-month-old Songyang hens with similar weights (average weight 1.04 ± 0.2 kg) were randomly divided into 11 groups, with ten replicates per group. Antimicrobial peptides (mutant 3 and mutant 10) were added to each of the following feed: 65 parts corn; 10 parts soybean meal; 6 parts rice bran; 1.5 parts bone meal; 0.1 parts each of vitamin A, vitamin D3, vitamin K, and vitamin E; 0.02 parts each of copper, zinc, and magnesium; and 0.3 parts salt. A control group was also included. Supplemental lighting was provided in the morning and evening, with the light duration increased by 0.5 to 1 hour each week until a total of 14 to 16 hours of light per day was achieved. Chickens were fed 3-4 times daily to ensure adequate light. Their needs were met, including free access to drinking water. The drinking water equipment was cleaned and disinfected daily. The egg production rate and egg weight of each group of Songyang chickens were measured daily. The results showed that compared with the control group, the egg production rate and egg weight of the mutation 3 group and the mutation 10 group were improved (the egg production rate of the mutation 3 group increased by an average of 1.2% and the average weight of a single egg increased by an average of 0.8%, while the egg production rate of the mutation 10 group increased by an average of 0.7% and the average weight of a single egg increased by an average of 0.5%). This indicates that mutation 3 and mutation 10 have a promoting effect on the egg production performance of Songyang chickens.

[0051] The embodiments of the present invention have been described in detail above, but the present invention is not limited to the described embodiments. For those skilled in the art, various changes, modifications, substitutions, and variations can be made to these embodiments without departing from the principles and spirit of the present invention, and these variations still fall within the protection scope of the present invention.

Claims

1. A polypeptide having undergone the following mutation relative to the amino acid sequence shown in SEQ ID NO:1: G61I.

2. A nucleic acid molecule encoding the polypeptide as described in claim 1.

3. An expression vector comprising the nucleic acid molecule as described in claim 2.

4. A host cell comprising the nucleic acid molecule as described in claim 2, or the expression vector as described in claim 3.

5. A composition comprising the polypeptide as described in claim 1.

6. A pharmaceutical composition comprising the polypeptide of claim 1, or the composition of claim 5.

7. A feed composition comprising the polypeptide of claim 1, or the composition of claim 5.

8. Use of the polypeptide of claim 1, the nucleic acid molecule of claim 2, the expression vector of claim 3, the composition of claim 5, or the feed composition of claim 7 in the preparation of animal feed.

9. A non-therapeutic, non-diagnostic method for improving animal feeding outcomes, wherein the animal is fed the feed composition as described in claim 7.

Citation Information

Patent Citations

  • Cecropin-α, an antimicrobial peptide from black soldier fly larvae, and its application.

    CN112321697B