Antibody for resisting CD20 on porcine B cell surface or antigen binding fragment thereof as well as composition and application thereof
By developing a specific sequence-specific antibody against CD20 on the surface of porcine B cells, the problem of the lack of monoclonal antibodies that recognize CD20 on the surface of porcine cells in the existing technology has been solved, enabling the application of antibodies with high affinity and bioactivity, and supporting disease diagnosis and treatment in porcine biomedical models.
Patent Information
- Application Number
- CN202511176106.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-08-21
- Publication Date
- 2025-11-18
- Estimated Expiration
- 2045-08-21
AI Technical Summary
The lack of monoclonal antibodies that recognize CD20 on the surface of pig cells in existing technologies limits their application in pig biomedical models and disease diagnosis. Furthermore, the types of existing antibodies are limited and expensive.
Monoclonal antibodies or antigen-binding fragments of antibodies against CD20 on the surface of porcine B cells have been developed, possessing specific HCDR and LCDR sequences, including Fab fragments, Fab'-SH, Fv fragments, scFv fragments, and F(ab')2 fragments. These are suitable for porcine, chimeric, or humanized antibodies, with well-defined amino acid sequences in the heavy and light chain variable regions. The constant region of the heavy chain is IgG1, IgG2a, IgG2b, or IgM. These antibodies are used to prepare pharmaceutical compositions and to detect CD20 protein in samples.
It provides a high-affinity and bioactive anti-CD20 antibody against porcine B cell surface, for specific binding and sorting of porcine B cells, supporting disease diagnosis and treatment, and suitable for a variety of detection and treatment methods.
Smart Images

Figure BDA0005559502930000091 
Figure BDA0005559502930000101 
Figure BDA0005559502930000161
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biotechnology, specifically relating to an antibody against CD20 on the surface of porcine B cells or its antigen-binding fragment, as well as combinations thereof and their applications. Background Technology
[0002] CD20 is a differentiation-related phosphorylated cell surface protein encoded by the MS4A1 gene. Porcine CD20 is a non-glycosylated membrane protein with a molecular weight of 33-37 kDa. CD20 is a four-transmembrane protein, composed of four hydrophobic transmembrane domains, one intracellular domain, and two extracellular domains (macrocycle and microcycle). Both its N-terminus and C-terminus are located within the cytosol. CD20 is a universal B cell surface marker, widely expressed on the cell surface of pre-B cells and B cells at all stages of development and differentiation, except for plasma cells (immunoglobulin-secreting B cells), playing an important regulatory role in B cell proliferation and differentiation. CD20 is expressed in over 95% of B-cell lymphomas, but not in hematopoietic stem cells, plasma cells, and other normal tissues. Based on protein sequence alignment using UniProt and NCBI, human and porcine CD20 share approximately 73% homology.
[0003] Pigs are an ideal large animal biomedical model, as they are more similar to humans in anatomy, physiology, genetics, and immune responses. The pig immune system is similar to humans in over 80% of analytical parameters, compared to only about 10% in mice. Pig models can better simulate human diseases and can validate drug safety or vaccine efficacy before clinical trials. Research on monoclonal antibodies targeting porcine CD20 is crucial for a deeper understanding of key regulators of porcine B cell development, porcine immune mechanisms, and the development of novel vaccines and treatments. However, there is currently a lack of monoclonal antibodies that recognize porcine cell surface markers, and the types of antibodies targeting porcine CD20 available on the market are extremely limited and expensive, posing significant challenges to pig model research and application.
[0004] Therefore, research on monoclonal antibodies targeting porcine CD20 can provide new tools for the diagnosis of porcine biomedical models and diseases, and is also of great significance for the development of new veterinary drugs and treatment methods. Summary of the Invention
[0005] The purpose of this invention is to provide an antibody against CD20 on the surface of porcine B cells or an antigen-binding fragment thereof, as well as combinations thereof and applications.
[0006] In a first aspect, the present invention provides an anti-CD20 antibody against porcine B cell surface or an antigen-binding fragment thereof, said antibody or antigen-binding fragment having three complementary determinant regions (HCDRs) in the heavy chain variable region and three complementary determinant regions (LCDRs) in the light chain variable region:
[0007] HCDR1, as shown in SEQ ID NO:1,
[0008] HCDR2, as shown in SEQ ID NO:2,
[0009] HCDR3, as shown in SEQ ID NO:3,
[0010] LCDR1, as shown in SEQ ID NO:4,
[0011] LCDR2, as shown in SEQ ID NO:5, and
[0012] LCDR3, as shown in SEQ ID NO:6.
[0013] In another preferred embodiment, the antibody is a porcine antibody, a chimeric antibody, or a humanized antibody.
[0014] In another preferred embodiment, the antigen-binding fragment includes: Fab fragment, Fab′-SH, Fv fragment, scFv fragment, and F(ab')2 fragment.
[0015] In another preferred embodiment, the heavy chain variable region and light chain variable region of the anti-porcine B cell surface CD20 antibody or its antigen-binding fragment are the heavy chain variable region with an amino acid sequence as shown in SEQ ID NO:7 and the light chain variable region with an amino acid sequence as shown in SEQ ID NO:8.
[0016] In another preferred embodiment, the heavy chain of the antibody or its antigen-binding fragment further includes a heavy chain constant region; the light chain of the antibody or its antigen-binding fragment further includes a light chain constant region.
[0017] In another preferred embodiment, the antibody is a single-chain antibody, a double-chain antibody, or an antigen-binding fragment.
[0018] In another preferred embodiment, the antibody is a humanized antibody, a porcine antibody, a murine antibody, or a chimeric antibody.
[0019] In another preferred embodiment, the heavy chain constant region is IgG1, IgG2a, IgG2b or IgM.
[0020] In another preferred embodiment, the constant regions of the heavy and light chains of the anti-porcine B cell surface CD20 antibody are the heavy chain constant region and light chain constant region sequences of human IgG1, respectively.
[0021] In another preferred embodiment, the constant regions of the heavy and light chains of the anti-porcine B cell surface CD20 antibody are respectively the heavy chain constant region and light chain constant region sequences of mouse IgG1.
[0022] In another preferred embodiment, the heavy chain constant region is of human, swine, or rodent origin.
[0023] In another preferred embodiment, the light chain constant region is of human, swine, or mouse origin.
[0024] In another preferred embodiment, the antibody is a full-length antibody protein or an antigen-binding fragment.
[0025] In another preferred embodiment, the antibody is a monoclonal antibody.
[0026] In another preferred embodiment, the antibody is a partially or fully humanized monoclonal antibody.
[0027] In another preferred embodiment, the antibody further comprises a linker peptide located between the heavy chain variable region and the light chain variable region.
[0028] A second aspect of the present invention provides a recombinant protein having:
[0029] (1) The anti-porcic B cell surface CD20 antibody or its antigen-binding fragment as described in the first aspect of the present invention; and
[0030] (2) Optional tag sequence for expression and / or purification.
[0031] In another preferred embodiment, the tag includes: an Fc tag, a FLAG tag, a 6His tag, a Strep tag, a protein labeling or purification tag commonly used in the art, or a combination thereof.
[0032] In another preferred embodiment, the recombinant protein (or polypeptide) includes a fusion protein.
[0033] In another preferred embodiment, the recombinant protein is a monomer, a dimer, or a polymer.
[0034] In a third aspect, the present invention provides a polynucleotide expressing the anti-porcine B cell surface CD20 antibody or its antigen-binding fragment as described in the first aspect of the present invention.
[0035] In another preferred embodiment, the polynucleotide is DNA, RNA, or cDNA.
[0036] In a fourth aspect, the present invention provides a carrier containing the polynucleotide described in the third aspect of the present invention.
[0037] In another preferred embodiment, the vector includes: bacterial plasmids, bacteriophages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors.
[0038] In another preferred embodiment, the vector is a eukaryotic expression vector.
[0039] In a fifth aspect, the present invention provides a host cell expressing the anti-porcine B cell surface CD20 antibody or its antigen-binding fragment as described in the first aspect of the present invention, having its genome integrated with the polynucleotides as described in the third aspect of the present invention, or containing the vector as described in the fourth aspect of the present invention.
[0040] In another preferred embodiment, the host cell is a eukaryotic cell or a prokaryotic cell.
[0041] In another preferred embodiment, the host cell is selected from the group consisting of Escherichia coli, yeast cells, and mammalian cells.
[0042] In another preferred embodiment, the prokaryotic cell is Escherichia coli.
[0043] In another preferred embodiment, the mammalian cell is a human cell or a mouse cell.
[0044] A sixth aspect of the present invention provides an antibody-drug conjugate comprising:
[0045] (I) An antibody portion, said antibody portion comprising the anti-porcine B cell surface CD20 antibody or an antigen-binding fragment thereof as described in the first aspect of the present invention; and
[0046] (II) A conjugation portion coupled to the antibody or its antigen-binding fragment, the conjugation portion being selected from the group consisting of: detectable markers, drugs, or combinations thereof.
[0047] In another preferred embodiment, the expression for the antibody-drug conjugate is:
[0048] mAb-(XY)n,
[0049] in,
[0050] mAb is an anti-CD20 antibody against porcine B cell surface or its antigen-binding fragment;
[0051] X is a connector;
[0052] Y represents the coupling portion, which is a detectable marker or drug;
[0053] N is a positive integer ≤ 8;
[0054] The conjugation portion is conjugated to the anti-porcine B cell surface CD20 antibody or its antigen-binding fragment via a linker.
[0055] In another preferred embodiment, the detectable markers include: radioactive isotopes, fluorescent markers, and biological substrate markers.
[0056] In another preferred embodiment, the fluorescent marker includes AF647.
[0057] In another preferred embodiment, the biological substrate marker is biotin.
[0058] A seventh aspect of the present invention provides a pharmaceutical composition comprising:
[0059] (a) The anti-porcine B cell surface CD20 antibody or its antigen-binding fragment as described in the first aspect of the present invention, the recombinant protein as described in the second aspect of the present invention, the polynucleotide as described in the third aspect of the present invention, the vector as described in the fourth aspect of the present invention, the host cell as described in the fifth aspect of the present invention, or the antibody-drug conjugate as described in the sixth aspect of the present invention; and
[0060] (b) Pharmaceutically acceptable carriers, diluents or excipients.
[0061] In another preferred embodiment, the pharmaceutical composition is an injectable dosage form.
[0062] In another preferred embodiment, the pharmaceutical composition is used to prepare a medicament for treating diseases caused by overexpression or overtransportation of CD20 on the surface of porcine B cells.
[0063] The eighth aspect of the present invention provides the use of the anti-porcine B cell surface CD20 antibody or its antigen-binding fragment as described in the first aspect of the present invention, the recombinant protein as described in the second aspect of the present invention, the polynucleotide as described in the third aspect of the present invention, the vector as described in the fourth aspect of the present invention, the host cell as described in the fifth aspect of the present invention, or the antibody-drug conjugate as described in the sixth aspect of the present invention, for the preparation of pharmaceuticals, reagents, detection plates or kits.
[0064] A ninth aspect of the present invention provides a method for preparing the anti-porcine B cell surface CD20 antibody or its antigen-binding fragment as described in the first aspect of the present invention, the method comprising the steps of:
[0065] (s1) Under suitable expression conditions, the host cells described in the fifth aspect of the present invention are cultured to express the anti-porcine B cell surface CD20 antibody or its antigen-binding fragment.
[0066] In another preferred embodiment, the method further includes the step of:
[0067] (s2) Isolate and purify the anti-porcine B cell surface CD20 antibody or its antigen-binding fragment obtained in step (s1).
[0068] A tenth aspect of the present invention provides a method for detecting CD20 protein in a sample, the method comprising the steps of:
[0069] (y1) Contact the sample with the antibody or its antigen-binding fragment as described in the first aspect of the present invention;
[0070] (y2) Detect whether an antigen-antibody complex is formed, wherein if an antigen-antibody complex is formed, it indicates that the CD20 protein is present in the sample.
[0071] In another preferred embodiment, the sample includes: animal tissue sample and exfoliated cell sample.
[0072] In another preferred embodiment, the sample comprises: a blood sample from a pig.
[0073] In another preferred embodiment, the method is non-diagnostic and non-therapeutic.
[0074] In another preferred embodiment, the method is an in vitro method.
[0075] In another preferred embodiment, the method further includes step (y3) analyzing the affinity between the antibody and the antigen.
[0076] In another preferred embodiment, the CD20 protein is the CD20 protein on the surface of porcine cells.
[0077] In an eleventh aspect, the present invention provides a method for B-cell typing, the method comprising the steps of:
[0078] (x1) Provide a B cell or a mixture containing a B cell;
[0079] (x2) Contact the B cells or the mixture with the anti-porcic B cell surface CD20 antibody or its antigen-binding fragment as described in the first aspect of the present invention;
[0080] (x3) Detect whether the B cells or the B cells in the mixture bind to the anti-pig B cell surface CD20 antibody or its antigen-binding fragment. If binding is present, it indicates that the B cells are CD20 positive B cells or the mixture contains CD20 positive B cells. If binding is absent, it indicates that the B cells are CD20 negative B cells or the mixture does not contain CD20 positive B cells.
[0081] In a twelfth aspect of the present invention, a detection plate is provided, the detection plate comprising a substrate (support plate) and a test strip, the test strip containing the anti-porcine B cell surface CD20 antibody or its antigen-binding fragment as described in the first aspect of the present invention, the recombinant protein as described in the second aspect of the present invention, or the antibody-drug conjugate as described in the sixth aspect of the present invention.
[0082] In another preferred embodiment, the test strip also contains an antigen spotting area.
[0083] In another preferred embodiment, the test strip is composed of filter paper, chromatography material, nitrocellulose membrane and absorbent paper stacked in sequence.
[0084] According to a thirteenth aspect of the present invention, a kit is provided, the kit comprising:
[0085] (1) A first container containing the anti-porcine B cell surface CD20 antibody or its antigen-binding fragment as described in the first aspect of the present invention; and / or
[0086] (2) A second container containing a second antibody against the anti-porcine B cell surface CD20 antibody or its antigen-binding fragment as described in the first aspect of the present invention; and / or
[0087] (3) A third container containing a cell lysis reagent;
[0088] or,
[0089] The kit contains the detection plate described in the twelfth aspect of the present invention.
[0090] In another preferred embodiment, the antibody or antigen-binding fragment in the first container is labeled with a detectable tag.
[0091] In another preferred embodiment, the second antibody in the second container is labeled with a detectable marker.
[0092] The fourteenth aspect of the present invention provides a method for treating an autoimmune disease, the method comprising the steps of: administering to a subject requiring treatment a therapeutically effective amount of the anti-porcine B cell surface CD20 antibody or its antigen-binding fragment as described in the first aspect of the present invention, the recombinant protein as described in the second aspect of the present invention, the polynucleotide as described in the third aspect of the present invention, the expression vector as described in the fourth aspect of the present invention, the antibody-drug conjugate as described in the sixth aspect of the present invention, or the pharmaceutical composition as described in the seventh aspect of the present invention.
[0093] It should be understood that, within the scope of this invention, the above-described technical features of this invention and the technical features specifically described below (such as in the embodiments) can be combined with each other to form new or preferred technical solutions. Due to space limitations, they will not be described in detail here. Attached Figure Description
[0094] Figure 1 The full-length CD20 was shown to exhibit bright, specific bands at the stated temperature gradient (the full-length porcine CD20 band was 900 bp).
[0095] Figure 2 The flow sorting diagram is displayed.
[0096] Figure 3 A schematic diagram of the heavy chain vector of human IgG used to construct the antibody is shown.
[0097] Figure 4 A schematic diagram of the light chain vector of human IgG used to construct the antibody is shown.
[0098] Figure 5 The cell surface binding results analysis in Example 5 is shown.
[0099] Figure 6 The results of the flow sorting in Example 6 are shown. Detailed Implementation
[0100] Through extensive and in-depth research, the inventors screened only one antibody with high affinity for CD20 from tens of thousands of cells. Currently, there are no reports on the preparation of CD20 antibodies. Experimental results demonstrate that the anti-CD20 antibody pCD20Ab3 of this invention possesses high affinity and good biological activity. The antibody of this invention can be used for the specific binding and sorting of porcine B cells. Based on this, this invention was completed.
[0101] It should be understood that the specific methods and experimental conditions of the invention described below in varying degrees of detail are intended to provide a substantive understanding of the invention. Definitions of certain terms used in this specification are provided below. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.
[0102] the term
[0103] Where a numerical range is provided, unless the context clearly indicates otherwise, it should be understood that every intermediate integer of the value, every tenth of every intermediate integer of the value, any other intermediate value between the upper and lower limits of the range, and any other intermediate value within the specified range are included within the scope of this invention. The upper and lower limits of these smaller ranges may be independently included within the smaller range and also covered within the scope of this invention, but are subject to any express exclusions within the specified range. For example, "1 to 50" includes "2 to 25", "5 to 20", "25 to 50", "1 to 10", etc.
[0104] As used herein, the terms “containing” or “including (comprise)” can be open-ended, semi-closed, or closed-ended. In other words, the terms also include “consistently made of” or “made of”.
[0105] As used herein, the term “and / or” refers to and covers any and all possible combinations of one or more of the related listed items.
[0106] As used herein, the terms "anti-porcine B cell surface CD20 antibody of the present invention", "anti-porcine B cell surface CD20 antibody of the present invention", and "porcine CD20 antibody of the present invention" have the same meaning and can be used interchangeably, all referring to antibodies against porcine CD20.
[0107] CD20
[0108] CD20 is a differentiation-related phosphorylated cell surface protein encoded by the MS4A1 gene. Porcine CD20 is a non-glycosylated membrane protein with a molecular weight of 33-37 kDa. CD20 is a four-transmembrane protein, composed of four hydrophobic transmembrane domains, one intracellular domain, and two extracellular domains (macrocycle and microcycle). Both its N-terminus and C-terminus are located within the cytosol. CD20 is a universal B cell surface marker, widely expressed on the cell surface of pre-B cells and B cells at all stages of development and differentiation, except for plasma cells (immunoglobulin-secreting B cells). It plays an important regulatory role in B cell proliferation and differentiation. CD20 is expressed in more than 95% of B-cell lymphomas, but not in hematopoietic stem cells, plasma cells, and other normal tissues.
[0109] Antibody
[0110] In this invention, the terms "antibody (Ab)" and "immunoglobulin G (IgG)" refer to heterotetraglycoproteins with the same structural characteristics, consisting of two identical light chains (L) and two identical heavy chains (H). Each light chain is linked to the heavy chain by a covalent disulfide bond, and the number of disulfide bonds between heavy chains of different immunoglobulin isotypes varies. Each heavy and light chain also has regularly spaced intrachain disulfide bonds. Each heavy chain has a variable region (VH) at one end, followed by a constant region, which consists of three domains: CH1, CH2, and CH3. Each light chain has a variable region (VL) at one end and a constant region at the other end, with the light chain constant region including a domain CL; the light chain constant region pairs with the CH1 domain of the heavy chain constant region, and the light chain variable region pairs with the heavy chain variable region. Constant regions do not directly participate in antibody-antigen binding, but they exhibit different effector functions, such as participating in antibody-dependent cell-mediated cytotoxicity (ADCC). Heavy chain constant regions include IgG1, IgG2, IgG3, and IgG4 isotypes; light chain constant regions include κ (Kappa) or λ (Lambda). The heavy and light chains of an antibody are covalently linked by disulfide bonds between the CH1 domain of the heavy chain and the CL domain of the light chain. The two heavy chains of an antibody are covalently linked by interpeptide disulfide bonds formed between their hinge regions.
[0111] In this invention, the terms "Fab" and "Fc" refer to the ability of papain to cleave an antibody into two identical Fab fragments and one Fc fragment. The Fab fragment consists of the VH and CH1 domains of the antibody's heavy chain and the VL and CL domains of its light chain. The Fc fragment, or crystallizable fragment, consists of the antibody's CH2 and CH3 domains. The Fc fragment lacks antigen-binding activity and is the site of interaction between the antibody and effector molecules or cells.
[0112] In this invention, the term "scFv" refers to a single-chain antibody fragment (scFv), which is composed of the variable regions of the antibody heavy chain and the variable regions of the light chain, typically linked by a short peptide (linker) of 15 to 25 amino acids.
[0113] In this invention, the term "variable" refers to the fact that certain portions of the variable region in an antibody differ in sequence, resulting in the binding and specificity of various specific antibodies to their specific antigens. However, variability is not uniformly distributed throughout the entire variable region of the antibody. It is concentrated in three segments within the variable regions of the heavy and light chains, known as complementarity-determining regions (CDRs) or hypervariable regions. The more conserved portions of the variable regions are called frame regions (FRs). The variable regions of the natural heavy and light chains each contain four FR regions, which are generally β-sheet configurations, linked by three CDRs forming a linking loop, and in some cases may form a partial β-sheet structure. The CDRs in each chain are closely packed together through the FR regions and together with the CDRs of the other chain, form the antigen-binding site of the antibody (see Kabat et al., NIH Publ. No. 91-3242, Vol. I, pp. 647-669 (1991)).
[0114] As used herein, the term "frame region" (FR) refers to the amino acid sequence inserted between CDRs, specifically those portions of the variable regions of the light and heavy chains of immunoglobulins that are relatively conserved among different immunoglobulins within a single species. Each immunoglobulin light and heavy chain has four FRs, designated L-FR1, L-FR2, L-FR3, L-FR4 and H-FR1, H-FR2, H-FR3, H-FR4, respectively. Accordingly, the light chain variable domain can be represented as (L-FR1)-(LCDR1)-(L-FR2)-(LCDR2)-(L-FR3)-(LCDR3)-(L-FR4), and the heavy chain variable domain as (H-FR1)-(HCDR1)-(H-FR2)-(HCDR2)-(H-FR3)-(HCDR3)-(H-FR4). Preferably, the FR of the present invention is a human antibody FR or a derivative thereof, wherein the derivative of the human antibody FR is substantially identical to the naturally occurring human antibody FR, that is, the sequence identity reaches 85%, 90%, 95%, 96%, 97%, 98% or 99%.
[0115] Knowing the amino acid sequence of the CDR, those skilled in the art can easily determine the framework regions L-FR1, L-FR2, L-FR3, L-FR4 and / or H-FR1, H-FR2, H-FR3, H-FR4.
[0116] As used herein, the term "human frame region" is a frame region that is substantially identical (approximately 85% or more, specifically 90%, 95%, 97%, 99%, or 100%) to the frame region of a naturally occurring human antibody.
[0117] As used herein, the term "linker" refers to an insertion into an immunoglobulin domain that provides sufficient mobility for the light and heavy chains to fold into one or more amino acid residues of an exchangeable dual variable region immunoglobulin. In this invention, preferred linkers are Linker1 and Linker2, wherein Linker1 links the VH and VL of a single-chain antibody (scFv), while Linker2 is used to link the scFv to the heavy chain of another antibody.
[0118] Suitable examples of linkers include monoglycine (Gly) or serine (Ser) residues, and the identification and sequence of amino acid residues in the linker can vary depending on the type of secondary structural element that needs to be achieved in the linker.
[0119] In this invention, the antibody also includes its conserved variants, which are polypeptides formed by replacing up to 10, preferably up to 8, more preferably up to 5, and most preferably up to 3 amino acids with amino acids of similar or analogous properties compared to the amino acid sequence of the specific antibody of this invention. These conserved variant polypeptides are preferably generated by amino acid substitutions according to Table A.
[0120] Table A
[0121]
[0122]
[0123] In this invention, the terms "antibody," "binding," and "specific binding" refer to a non-random binding reaction between two molecules, such as the reaction between an antibody and its targeted antigen. Typically, antibodies bind at a rate of less than approximately 10... -7 M, for example, less than approximately 10 -8 M, 10 -9 M, 10 -10 M, 10 -11 The antibody binds to the antigen with an equilibrium dissociation constant (KD) of M or smaller. In this invention, the term "KD" refers to the equilibrium dissociation constant of a specific antibody-antigen interaction, which describes the binding affinity between the antibody and the antigen. The smaller the equilibrium dissociation constant, the stronger the antibody-antigen binding and the higher the affinity between the antibody and the antigen. For example, the binding affinity between the antibody and the antigen can be determined using surface plasmon resonance (SPR) in a BIACORE instrument or using ELISA to determine the relative affinity of antibody-antigen binding.
[0124] In this invention, the term "epitope" refers to a polypeptide determinant that specifically binds to an antibody. The epitopes of this invention are regions of an antigen that are bound to antibodies.
[0125] In some embodiments, the anti-porcine CD20 antibody (or anti-porcine B cell surface CD20 antibody) of this invention is immobilized on a solid support or substrate. In some embodiments, the anti-porcine CD20 antibody of this invention is non-diffusionally immobilized on the solid support (e.g., the anti-porcine CD20 antibody does not detach from the solid support). The solid support or substrate can be any physically separable solid on which the anti-porcine CD20 antibody can be directly or indirectly attached, including but not limited to surfaces provided by microarrays and pores, and particles such as beads (e.g., paramagnetic beads, magnetic beads, microbeads, nanobeads), microparticles, and nanoparticles. Solid supports may also include, for example, chips, columns, optical fibers, wipes, filters (e.g., planar filters), one or more capillaries, glass and modified or functionalized glass (e.g., controlled-pore glass (CPG)), quartz, mica, diazotized membranes (paper or nylon), polyoxymethylene, cellulose, cellulose acetate, paper, ceramics, metals, metalloids, semiconductor materials, quantum dots, coated beads or particles, other chromatographic materials, magnetic particles; plastics (including acrylics, polystyrene, copolymers of styrene or other materials, polybutene, polyurethane, TEFLON™, polyethylene, polypropylene, polyamide, polyester, polyvinylidene fluoride (PVDF), etc.), polysaccharides, nylon or nitrocellulose, resins, silica or silica-based materials (including silicon, silica gel and modified silicon), carbon, metals (e.g., steel, gold, silver, aluminum, silicon and copper), inorganic glass, conductive polymers (including polymers such as polypyrrole and polyindole); micro or nanostructured surfaces such as nucleic acid tiling arrays. Arrays, nanotubes, nanowires, or nanoparticles decorating surfaces; or porous surfaces or gels such as methacrylates, acrylamide, sugar polymers, cellulose, silicates, or other fibrous or chain polymers. In some embodiments, the solid support or substrate may be coated with any number of materials, including polymers such as dextran, acrylamide, gelatin, or agarose, using a passive or chemically derived coating. Beads and / or particles may be free or connected to each other (e.g., sintered). In some embodiments, the solid support or substrate may be an aggregate of particles. In some embodiments, the particles may comprise silica, and the silica may comprise silicon dioxide. In some embodiments, the silica may be porous, and in some embodiments, the silica may be non-porous. In some embodiments, the particles also comprise a substance that imparts paramagnetism to the particles. In some embodiments, the substance comprises a metal, and in some embodiments, the substance is a metal oxide (e.g., iron or iron oxide, wherein the iron oxide contains a mixture of Fe2+ and Fe3+). Antibodies against porcine CD20 can be linked to solid supports via covalent bonds or non-covalent interactions, and can be linked to solid supports directly or indirectly (e.g., via intermediates such as spacer molecules or biotin).
[0126] The antibodies of the present invention can be used in any known assay method, such as flow cytometry, immunohistochemistry, immunofluorescence, mass cytometry (e.g., Cytof instruments), competitive binding assays, direct and indirect sandwich assays, and immunoprecipitation assays.
[0127] Flow cytometry and mass flow cytometry assays involve using a single primary antibody to specifically recognize the presence of a target molecule expressed on the surface of a dispersion suspension of individual cells. The dispersed cells are typically obtained from biological fluid samples (e.g., blood) or can be obtained as single-cell dispersions prepared from free solid tissue samples (e.g., spleen, lymph node, or tumor biopsies). The primary antibody can be directly conjugated to a detectable moiety (e.g., a fluorophore such as phycoerythrin for flow cytometry or a heavy metal chelate for mass flow cytometry). Alternatively, the primary antibody can be unlabeled or labeled with an undetectable tag such as biotin, and then detected by a detectable secondary antibody that specifically recognizes the primary antibody itself or the tag on the primary antibody. The labeled cells are then analyzed in an instrument capable of single-cell detection (e.g., flow cytometer, mass flow cytometer, fluorescence microscope, or bright-field optical microscope) to identify target cells expressed in a dispersed population or tissue sample that are recognized by the primary antibody.
[0128] Sandwich assays involve the use of two antibodies, each capable of binding to a different immunogenic moiety or epitope of the protein being tested. In a sandwich assay, the test sample analyte binds to a first antibody immobilized on a solid support, followed by the binding of a second antibody to the analyte, forming an insoluble three-part complex. The second antibody itself can be labeled with the detectable moiety (direct sandwich assay) or can be measured using an anti-immunoglobulin antibody labeled with the detectable moiety (indirect sandwich assay). For example, one type of sandwich assay is an ELISA assay, in which the detectable moiety is an enzyme. In cell ELISA, a target cell population is attached to a solid support using antibodies that first attach to the support and recognize different cell surface proteins. These first antibodies capture the cells onto the support. CD20 on the cell surface can then be detected by adding an anti-porcine CD20 antibody to the captured cells and detecting the amount of CD20 antibody attached to the cells.
[0129] For immunohistochemistry, blood or tissue samples can be fresh or frozen, or embedded in paraffin and fixed with preservatives such as formalin. Antibodies can also be used for in vivo diagnostic assays. Typically, antibodies are labeled with radionuclides (such as 111In, 99Tc, 14C, 131I, 125I, 3H, 32P, or 35S) so that the bound target molecules can be located using immunoscintillation imaging.
[0130] Detection / diagnostic kits containing the anti-CD20 antibody of the present invention may, for convenience, be provided in a kit (e.g., a packaged combination of a predetermined amount of reagents and instructions for use in a diagnostic assay). When the antibody is labeled with a fluorophore, the kit will include an isotype-independent negative control antibody identical to the control that nonspecifically binds to the anti-CD20 antibody. When the antibody is labeled with an enzyme, the kit will include the substrate and cofactor required for the enzyme (e.g., a substrate precursor that can detect chromophores or fluorophores). Additionally, other additives may be included, such as stabilizers, buffers (e.g., blocking buffers or lysis buffers), etc. The relative amounts of various reagents can be widely varied to provide reagent solution concentrations that greatly optimize assay sensitivity. In particular, the reagents may be provided as dry powders (typically lyophilized), which include excipients that, upon dissolution, provide a reagent solution with an appropriate concentration.
[0131] Polynucleotides, vectors and host cells
[0132] The present invention also provides a polynucleotide molecule encoding the above-described antibody or a fragment thereof or a fusion protein thereof. The polynucleotide of the present invention may be in DNA or RNA form. The DNA form includes cDNA, genomic DNA, or artificially synthesized DNA. The DNA may be single-stranded or double-stranded. The DNA may be a coding strand or a non-coding strand.
[0133] The polynucleotide encoding the mature polypeptide of the present invention includes: a coding sequence that encodes only the mature polypeptide; a coding sequence of the mature polypeptide and various additional coding sequences; a coding sequence of the mature polypeptide (and optional additional coding sequences) and a non-coding sequence.
[0134] The term "polynucleotide encoding a polypeptide" can refer to a polynucleotide that includes the polypeptide, or it can also include additional coding and / or non-coding sequences.
[0135] The present invention also relates to polynucleotides that hybridize with the above-described sequences and have at least 50%, preferably at least 70%, and more preferably at least 80% identity between the two sequences. The present invention particularly relates to polynucleotides that hybridize with the polynucleotides described herein under stringent conditions. In the present invention, “stringent conditions” means: (1) hybridization and elution at lower ionic strength and higher temperatures, such as 0.2×SSC, 0.1% SDS, 60°C; or (2) hybridization with a denaturing agent, such as 50% (v / v) formamide, 0.1% fetal bovine serum / 0.1% Ficoll, 42°C, etc.; or (3) hybridization only occurs when the identity between the two sequences is at least 90%, more preferably at least 95%. Furthermore, the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide.
[0136] The full-length nucleotide sequence or fragments of the antibody of the present invention can generally be obtained by PCR amplification, recombinant methods, or artificial synthesis. One feasible method is to synthesize the relevant sequence artificially, especially when the fragment length is short. Typically, long fragments can be obtained by first synthesizing multiple small fragments and then ligating them. Furthermore, the coding sequence of the heavy chain and an expression tag (such as 6His) can be fused together to form a fusion protein.
[0137] Once the relevant sequence is obtained, it can be obtained in large quantities using recombination methods. This typically involves cloning it into a vector, transforming it into cells, and then isolating the sequence from the proliferated host cells using conventional methods. The biomolecules (nucleic acids, proteins, etc.) involved in this invention include biomolecules existing in isolated forms.
[0138] Currently, the DNA sequence encoding the protein of this invention (or a fragment thereof, or a derivative thereof) can be obtained entirely through chemical synthesis. This DNA sequence can then be introduced into various existing DNA molecules (or vectors) and cells known in the art. Furthermore, mutations can be introduced into the protein sequence of this invention through chemical synthesis.
[0139] The present invention also relates to vectors comprising the aforementioned suitable DNA sequences and suitable promoters or control sequences. These vectors can be used to transform suitable host cells to enable them to express proteins.
[0140] The host cell can be a prokaryotic cell, such as a bacterial cell; a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples include: Escherichia coli, Streptomyces; bacterial cells of Salmonella typhimurium; fungal cells such as yeast; insect cells of Drosophila S2 or Sf9; and animal cells of CHO, COS7, and 293 cells.
[0141] Transformation of host cells with recombinant DNA can be performed using conventional techniques well known to those skilled in the art. When the host is a prokaryote such as *E. coli*, competent cells capable of uptake DNA can be harvested after the exponential growth phase and treated with CaCl2, the steps of which are well known in the art. Another method is to use MgCl2. If desired, transformation can also be performed using electroporation. When the host is a eukaryote, the following DNA transfection methods can be used: calcium phosphate coprecipitation, conventional mechanical methods such as microinjection, electroporation, liposome packaging, etc.
[0142] The obtained transformants can be cultured using conventional methods to express the polypeptide encoded by the gene of this invention. Depending on the host cells used, the culture medium can be selected from various conventional media. Culture is carried out under conditions suitable for host cell growth. Once the host cells have grown to an appropriate cell density, the selected promoter is induced using a suitable method (such as temperature adjustment or chemical induction), and the cells are cultured for a further period.
[0143] The recombinant peptides used in the methods described above can be expressed intracellularly, on the cell membrane, or secreted extracellularly. If desired, the recombinant proteins can be separated and purified using various separation methods based on their physical, chemical, and other properties. These methods are well known to those skilled in the art. Examples of these methods include, but are not limited to: conventional refolding treatment, treatment with protein precipitants (salting out), centrifugation, permeation, ultrafiltration, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, high-performance liquid chromatography (HPLC), and various other liquid chromatography techniques, as well as combinations of these methods.
[0144] The antibodies of the present invention can be used alone or in combination or conjugated with detectable markers (for diagnostic purposes), therapeutic agents, PK (protein kinase) modified parts, or any combination of the above substances.
[0145] Detectable markers for diagnostic purposes include, but are not limited to: fluorescent or luminescent markers, radioactive markers, biological substrate markers, MRI (magnetic resonance imaging) or CT (computed tomography) contrast agents, or enzymes capable of producing detectable products. Radioactive markers are radioisotopes such as 35S, 14C, 125I, 3H, and 131I. Antibodies can be labeled with radioisotopes using techniques described, for example, those described in Current Protocols in Immunology, Volumes 1 and 2, edited by Coligen et al., Wiley-Interscience, New York, NY, Pubs. (1991), and the radioactivity can be measured using scintillation counting. Fluorescent markers include rare earth chelates (europium chelates) or fluorescein and its derivatives, rhodamine and its derivatives, dansyl, lissamine, phycoerythrin, Texas red, and BrilliantViolet™. Fluorescent markers can be conjugated to antibodies using techniques disclosed, for example, those disclosed in Current Protocols in Immunology (ibid.). Fluorescence can be quantified using flow cytometry, imaging microscopy, or a fluorometer. Biological substrate markers, utilizing enzyme-substrate labeling systems such as the biotin-avidin system, serve as detection agents. Enzymes typically catalyze chemical changes in their substrates, which can be measured using various techniques. For example, enzymes can catalyze color changes in substrates, which can be measured spectrophotometrically. Alternatively, enzymes can alter the fluorescence or chemiluminescence of a substrate. Techniques for quantifying fluorescence changes are described above. Chemiluminescent substrates become electronically excited through a chemical reaction and then emit light that can be measured (e.g., using a chemiluminescence meter) or supply energy to a fluorescent acceptor. Examples of enzyme-labeled enzymes include luciferases (e.g., firefly luciferase and bacterial luciferase); luciferin, 2,3-dihydrophthalazinedione, malate dehydrogenase, urease, peroxidases (e.g., horseradish peroxidase (HRP)), alkaline phosphatase, β-galactosidase, glucosylamylase, lysozyme, sugar oxidases (e.g., glucose oxidase, galactose oxidase and glucose-6-phosphate dehydrogenase), heterocyclic oxidases (e.g., uricase and xanthine oxidase), lactoperoxidase, microperoxidase, etc.
[0146] Therapeutic agents that can bind to or conjugate with the antibodies of the present invention include, but are not limited to: 1. radionuclides; 2. biotoxicants; 3. cytokines such as IL-2; 4. gold nanoparticles / nanorobars; 5. viral particles; 6. liposomes; 7. magnetic nanoparticles; 8. prodrug-activating enzymes (e.g., DT-cardiac flavinase (DTD) or biphenyl hydrolase-like protein (BPHL)); 10. chemotherapeutic agents (e.g., cisplatin) or any form of nanoparticles, etc.
[0147] Antibody-drug conjugates (ADCs)
[0148] The present invention also provides antibody-drug conjugates (ADCs) based on the antibodies of the present invention.
[0149] Typically, the antibody-drug conjugate comprises an antibody and an effector molecule, wherein the antibody is conjugated to the effector molecule, preferably chemically conjugated. The effector molecule is preferably a drug with therapeutic activity. Furthermore, the effector molecule may be one or more of a toxic protein, a chemotherapeutic agent, a small molecule drug, or a radionuclide.
[0150] The antibody and the effector molecule of this invention can be coupled via a coupling agent. Examples of the coupling agent include any one or more of non-selective coupling agents, carboxyl-based coupling agents, peptide chains, and disulfide bonds. The non-selective coupling agent refers to a compound that covalently links the effector molecule and the antibody, such as glutaraldehyde. The carboxyl-based coupling agent can be any one or more of maleic aconitine-based coupling agents (e.g., maleic aconitine) and acylhydrazone-based coupling agents (with an acylhydrazone as the coupling site).
[0151] Certain residues on antibodies (such as Cys or Lys) are used to link to a variety of functional groups, including imaging reagents (e.g., chromophores and fluorophores), diagnostic reagents (e.g., MRI contrast agents and radioisotopes), stabilizers (e.g., ethylene glycol polymers), and therapeutic agents. Antibodies can be conjugated to functional agents to form antibody-functional agent conjugates. Functional agents (e.g., drugs, detection reagents, stabilizers) are conjugated (covalently linked) to antibodies. Functional agents can be directly attached to antibodies or indirectly through linkers.
[0152] Antibodies can be conjugated to drugs to form antibody-drug conjugates (ADCs). Typically, an ADC contains a linker between the drug and the antibody. The linker can be degradable or non-degradable. Degradable linkers are typically readily degraded in intracellular environments, such as at the target site, thereby releasing the drug from the antibody. Suitable degradable linkers include, for example, enzyme-degradable linkers, including peptide-containing linkers that can be degraded by intracellular proteases (e.g., lysosomal proteases or endosomal proteases), or sugar linkers, such as glucuronidase-containing linkers. Peptide linkers can include, for example, dipeptides, such as valine-citrulline, phenylalanine-lysine, or valine-alanine. Other suitable degradable linkers include, for example, pH-sensitive linkers (e.g., linkers that hydrolyze at pH less than 5.5, such as hydrazone linkers) and linkers that degrade under reducing conditions (e.g., disulfide linkers). Non-degradable linkers typically release the drug under conditions where the antibody is hydrolyzed by proteases.
[0153] Prior to attachment to the antibody, the linker has a reactive group capable of reacting with certain amino acid residues, and the attachment is achieved through the reactive group. Thiol-specific reactive groups are preferred and include, for example, maleimide compounds, haloamides (e.g., iodinated, brominated, or chlorinated); haloesters (e.g., iodinated, brominated, or chlorinated); halomethyl ketones (e.g., iodinated, brominated, or chlorinated); benzyl halides (e.g., iodinated, brominated, or chlorinated); vinyl sulfones; pyridyl disulfides; mercury derivatives such as 3,6-di-(mercurymethyl)dioxane, with the counter ion being acetate, chloride, or nitrate; and polymethylene dimethyl sulfide thiosulfonate. The linker may include, for example, a maleimide attached to the antibody via a thiosuccinimide.
[0154] The drug can be any cytotoxic, cell growth-inhibiting, or immunosuppressive drug. In one embodiment, the linker connects the antibody and the drug, and the drug has a functional group that can bond with the linker. For example, the drug may have an amino, carboxyl, thiol, hydroxyl, or ketone group that can bond with the linker. In the case where the drug is directly linked to the linker, the drug has a reactive group before being linked to the antibody.
[0155] Useful drug classes include, for example, anti-tubulin drugs, DNA minor groove binding agents, DNA replication inhibitors, alkylating agents, antibiotics, folic acid antagonists, antimetabolites, chemosensitizers, topoisomerase inhibitors, vinca alkaloids, etc. In this invention, the drug-linker can be used to form an ADC in a single, simple step. In other embodiments, bifunctional linker compounds can be used to form an ADC in two or more steps. For example, cysteine residues react with the reactive portion of the linker in a first step, and in subsequent steps, functional groups on the linker react with the drug to form an ADC.
[0156] Typically, functional groups on the linker are selected to facilitate specific reaction with suitable reactive groups on the drug moiety. As a non-limiting example, azide-based moieties can be used to specifically react with reactive alkynyl groups on the drug moiety. The drug is covalently bound to the linker via a 1,3-dipolar cycloaddition between the azide and alkynyl groups. Other useful functional groups include, for example, ketones and aldehydes (suitable for reaction with hydrazides and alkoxyamines), phosphine (suitable for reaction with azides); isocyanates and isothiocyanates (suitable for reaction with amines and alcohols); and activated esters, such as N-hydroxysuccinimide esters (suitable for reaction with amines and alcohols). These and other linking strategies, such as those described in Bioconjugation Techniques, Second Edition (Elsevier), are well known to those skilled in the art. Those skilled in the art will understand that for selective reaction between the drug moiety and the linker, when a complementary pair of reactive functional groups is selected, each member of that complementary pair can be used for either the linker or the drug.
[0157] The present invention also provides a method for preparing an ADC, which may further include: binding an antibody to a drug-adaptor compound under conditions sufficient to form an antibody-drug conjugate (ADC).
[0158] In some embodiments, the method of the present invention includes binding an antibody to a bifunctional adapter compound under conditions sufficient to form an antibody-adaptor conjugate. In these embodiments, the method of the present invention further includes binding the antibody-adaptor conjugate to a drug moiety under conditions sufficient to covalently link a drug moiety to the antibody via the adapter.
[0159] In some implementations, the antibody-drug conjugate (ADC) has the following molecular formula:
[0160]
[0161] in:
[0162] Ab is an antibody.
[0163] LU stands for connector;
[0164] D is a drug;
[0165] Furthermore, the subscript p is a value selected from 1 to 8.
[0166] Detection uses and kits
[0167] The antibodies of this invention can be used in detection applications, such as for testing samples, to provide diagnostic information.
[0168] In this invention, the samples used include cells, tissue samples, and biopsy specimens. The term "biopsy" as used in this invention should include all types of biopsies known to those skilled in the art. Therefore, biopsies used in this invention can include tissue samples prepared, for example, by endoscopic methods or by puncture or needle biopsy of organs.
[0169] The samples used in this invention include fixed or preserved cell or tissue samples.
[0170] The present invention also provides a kit containing the antibody (or fragment thereof) of the present invention. In a preferred embodiment of the present invention, the kit further includes a container, instructions for use, a buffer, etc. In a preferred embodiment, the antibody of the present invention can be immobilized on a detection plate.
[0171] Application of the antibody of this invention
[0172] The anti-porcine B cell surface antibody of this invention can be used for B cell development studies and for the specific detection of porcine CD20 protein in in vitro experiments. In porcine disease models, the functional antibody can deplete B cells and is used for screening porcine monoclonal antibodies, among other applications.
[0173] The main advantages of this invention include:
[0174] (1) The anti-CD20 antibody against porcine B cell surface of the present invention can be used to specifically sort porcine B cells.
[0175] (2) The anti-porcine B cell surface CD20 antibody of the present invention can be used to label the porcine B cell surface marker CD20, and can then be used in various detection and analysis methods of porcine CD20 protein in vitro, thereby specifically analyzing the specific binding of porcine CD20 antigen.
[0176] The present invention will be further illustrated below with reference to specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Experimental methods in the following embodiments, unless otherwise specified, are generally performed under conventional conditions, such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or as recommended by the manufacturer. Unless otherwise stated, percentages and parts are weight percentages and parts by weight.
[0177] Example 1: Construction of plasmids
[0178] CD20 (NCBI acc.NM_001243394.1) was synthesized by Suzhou Genewise Technology Co., Ltd. The full-length CD20 gene was amplified using gene-specific primers CD20Fw:ATGACGACGCCCAGAAACTC (SEQ ID NO:11) and CD20Rv:TTAAGGGGCACTGTCGTTTTC (SEQ ID NO:12) and Phusion high-fidelity DNA polymerase (Thermo Scientific) using conventional techniques in the field.
[0179] Figure 1 The CD20 gene was shown to exhibit bright, specific bands across all temperature gradients (55–73 °C). After gel extraction to obtain the target gene, it was ligated to a linearized pCAG vector using homologous recombination, constructing a recombinant plasmid. This plasmid was then transformed into *E. coli* competent cells TOP10 and inoculated onto LB agar plates containing ampicillin, incubated at 37 °C. Single-spot inoculations were collected into LB medium, and the plasmid was extracted and sequenced using Sanger sequencing, confirming the absence of base mutations. The sequencing results were as expected, and the CD20-pCAG plasmid was successfully constructed.
[0180] pCR system and conditions: (1) Use SnapGene to design primers and prepare PCR mixture in reaction tube. The 20μL system contains 1μL cDNA template, 1μL forward primer, 1μL reverse primer, 0.3μL Phusion enzyme, 4μL 5×HF buffer, 0.5μL dNTP and 13.5μL ddH2O.
[0181] (2) The PCR reaction was subjected to 35 thermal cycles, each cycle consisting of three steps: denaturation, annealing and extension. The PCR reaction program was as follows: 98℃, 1 min; 98℃, 10 s; 55-73℃, 30 s; 72℃, 1 min for 35 cycles; 72℃, 5 min, 12℃ for storage.
[0182] Example 2: Antigen preparation and mouse immunization, mouse B cell sorting and culture
[0183] The inventors obtained the full-length transmembrane CD20 protein (Uniprot-A0A4X1VPQ6) by transfecting 293F cells with the CD20-pCAG constructed in Example 1, expressing and purifying it using conventional techniques in the art. After Western blotting and mass spectrometry analysis, the target full-length transmembrane CD20 antigen protein was successfully obtained, and the obtained full-length transmembrane CD20 protein showed glycosylation modification. The purified full-length transmembrane CD20 protein was then used to immunize mice using conventional techniques known in the art. The immunization strategy was as follows: 10-12 week old C57BL / 6 mice were selected and divided into a CD20 antigen immunization group and a control group. Each mouse in the CD20 antigen immunization group was given 30 μg of the prepared full-length transmembrane CD20 protein (antigen), 20 μg of CpGOND 2395 (5'-tcgtcgttttcggcgcgcgccg-3'), and an equal volume of AddaVax. TM (InvivoGen) Intraperitoneal and tarsal joint injections were administered, while the control group received 20 μg of CpG OND 2395 and an equal volume of AddaVax. TM Vaccinate every 3-4 days, for a total of 4 times.
[0184] Sorting of mouse B cells: Mice in the CD20 antigen-immunized group and control group were sacrificed 3-7 days after the last immunization. Spleen and lymph node tissues were obtained. Single-cell suspensions were prepared from the spleen and lymph nodes (popliteal fossa and groin), and then red blood cells were removed by washing with erythrocyte lysis buffer (Sangon Biotech Cat: b541001–0100). After washing twice with 2% FBS in PBS (2% FACS buffer), the cells were prepared for mixed staining with labeled antibodies. IgG1-positive B cells were obtained by sorting using a Cytoflex SRT (Beckman-Coulter) cell sorter. The staining gating strategy for the target cells was: DAPI-CD19+CD38+GL7-IgG1+.
[0185] The following reagents were used:
[0186] DAPI (live / dead; Invitrogen Cat.D1306),
[0187] anti-mouse CD19(APC / Cyanine7; Biolegend Cat.115530),
[0188] anti-mouse CD38(PE / Cyanine7; Biolegend Cat.102718),
[0189] anti-mouse / human GL7 Antigen(T and B cell Activation Marker), Alexa 488;Biolegend Cat.144612);
[0190] anti-mouse IgG1 (APC; Biolegend Cat. 406610).
[0191] The sorting results are as follows: Figure 2 As shown in the figure, the control group yielded very few IgG1+ positive B cells after sorting, while the experimental group obtained a large number of IgG1+ positive B cells after immunization. The antigen-immunized group showed a significant immune response compared to the control group. Based on the above results, this immunization protocol can effectively induce a sufficient number of antigen-specific memory B cells and germinal center B cells, and the sorting strategy can efficiently enrich antigen-specific memory B cells.
[0192] Culture of mouse B cells: The IgG1-positive B cells obtained above were cultured. The culture method can be referred to Hanida and Kitamura, (2019). Induced Germinal Center B Cell Culture System, Bio-protocol 9(4):e3163.DOI:10.21769 / BioProtoc.3163. The feeding medium was: RPMI-1640 (Gibco, Cat.11875-093), 10% Fetal Bovine Serum (FBS, VivaCell, Cat.C04002-500), 55 μM 2-mercaptoethanol (Thermo Fisher, Cat.21985), 100 units / ml Penicillin (Biosharp), 100 μg / ml Streptomycin (Biosharp), 10 mM HEPES (Thermo Fisher, Cat. 15630-080), 1 mM Sodium Pyruvate (Thermo Fisher, Cat. 11360-070), and 0.1 mM MEM nonessential amino acid (Thermo Fisher, Cat. 11140-050). One day before sorting, feeder cells expressing CD40L and BAFF were seeded into 96-well plates at 800-1200 cells per well. Single IgG1-positive B cells were sorted into each well, and 2-10 ng / ml IL-4 was added to the feeder medium and cultured for two days. Then, 4-10 ng / ml IL-21 was added and cultured for another 6-8 days, changing the medium daily. On day 10, the supernatant was collected and stored at 4°C, while the 96-well plates were stored at -80°C for subsequent lysis to obtain RNA from single B cells.
[0193] In the experiment, sorting was performed three times, with 100 plates sorted each time for culture. Flow cytometry data showed that the target memory B cell population accounted for approximately 98.9%, and its IgG1 positivity rate was approximately 0.26%, indicating that the sorting strategy can efficiently sort memory B cells. PBS served as the immunization control group. Subsequently, more than a dozen pairs of monoclonal antibody VDJ / VJ sequences were obtained using molecular cloning methods. However, after further cell surface binding and flow cytometry validation using sorted porcine single B cells, only one highly specific monoclonal antibody was obtained. CD20 is a multi-membrane dilatation protein. Technically, it is difficult to obtain high-affinity specific antibodies for multi-transmembrane proteins. In this experiment, through extensive work and technical expertise, a high-affinity porcine CD20 monoclonal antibody was successfully obtained.
[0194] Example 3: ELISA Experiment, Results and Analysis
[0195] The prepared porcine CD20 antigen protein was coated onto a 96-well ELISA plate and incubated overnight at 4°C under humid conditions. After discarding the coating buffer, 100-120 μL of blocking buffer (4% BSA in 1×PBS) was added to the plate and incubated at room temperature for 2 hours. After removing the blocking buffer, 20-60 μL of single-cell culture supernatant was added to each well and incubated overnight at 4°C under humid conditions. After washing three times, 20-30 μL of secondary antibody (AKP goat anti-mouse IgG1, Southern Biotech, cat. 1030-04) was added and incubated at room temperature for 2 hours. After washing four times, 20-30 μL of chromogenic solution containing disodium 4-nitrophenyl phosphate hexahydrate (CSNpharm, Cat. CSN66207) was added to each well. OD405 was measured using an MD SpectraMax iD3.
[0196] The results are shown in Tables 1 and 2 (only a portion of the detection data is shown).
[0197] Table 1. OD405 results of antigen detection on plate 1
[0198] 1 2 3 4 5 6 7 8 9 10 11 12 A 0.0635 0.0693 0.0718 0.0793 0.0996 0.0862 0.0772 0.0807 0.0895 0.0702 0.068 0.0828 B 0.0818 0.0931 0.1085 0.1381 0.1156 0.1065 0.1122 0.1447 0.1083 0.1038 0.1021 0.1354 C 0.1359 0.105 0.0928 0.0968 0.1117 0.0984 0.1064 0.0937 0.1175 0.1212 0.1128 0.123 D 0.0903 0.1133 0.1048 0.1053 0.1181 0.1061 0.0988 0.1037 0.1057 0.1021 0.1032 0.1376 E 0.082 0.1039 0.1095 0.1102 0.1199 0.0963 0.1183 0.0904 0.0974 0.1509 0.124 0.1113 F 0.0757 0.1029 0.1022 0.1617 0.1221 0.1004 0.1131 0.0949 0.0989 3.1351 0.1172 0.1242 G 0.0814 0.1116 0.1416 0.1087 0.1392 0.0987 0.1209 0.3368 0.1078 0.0962 0.1261 0.0955 H 0.0738 0.0977 0.0943 0.1022 0.1124 0.1174 0.1044 0.3291 0.0954 0.1018 0.0976 0.0917
[0199] Table 2. OD405 results of the IgG1 positive control in plate 1
[0200] 1 2 3 4 5 6 7 8 9 10 11 12 A 0.0674 1.3398 0.9021 0.0591 0.0665 0.0668 1.4927 1.2992 1.4959 0.0656 1.4667 0.0674 B 0.0694 1.0433 0.0673 0.5438 0.1088 1.4987 0.5291 0.071 0.1379 0.062 1.2226 0.0674 C 0.0702 1.4459 1.2609 1.6534 1.7991 0.0666 0.1674 1.8366 1.931 0.0669 0.0655 1.1315 D 1.7474 0.0685 0.1617 0.057 0.0701 0.0666 0.0846 0.0661 0.0538 0.0532 0.0778 0.304 E 0.066 0.0695 1.6436 0.1916 1.3815 0.7546 1.6402 0.0655 0.0501 0.067 1.4951 1.2498 F 0.8431 1.3549 1.5307 1.5232 0.0655 1.4537 0.0651 1.2539 0.8241 1.6736 0.076 0.6609 G 0.0705 1.2479 1.3876 0.0673 0.0803 0.0552 0.0659 1.1274 0.2387 0.0846 1.3184 0.0651 H 0.0719 0.0681 0.0669 0.0663 0.0673 0.0721 0.0669 0.4926 0.1738 0.0644 1.7035 0.0654
[0201] The results show that the supernatant of the cultured IgG1+ positive B cells contains antibodies that specifically bind to the CD20 antigen. The color development varies depending on the binding strength or concentration of the antibodies in the culture supernatant. Antigen-antibody specific binding will show a high value. After multiple batches of ELISA testing, nearly 20 highly specific antigen-antibody binding antibodies were obtained in all batches (300 96-well ELISA test plates; not all data are provided in the document, only some representative test values).
[0202] Example 4: Molecular cloning method and obtaining the monoclonal antibody VDJ / VJ sequence
[0203] Based on the ELISA test results analysis of Example 3, cells from the positive wells (antigen-antibody binding) of a 96-well cell culture plate that were pre-frozen at -80℃ were selected for RNA extraction from the single B cells, and subsequent molecular cloning was performed to obtain the VDJ / VJ sequence.
[0204] Total RNA was extracted from B cells in 96-well cell culture plates that tested positive (antigen-antibody binding) using TRIzol Reagent (Thermo Fisher). Reverse transcription and PCR were performed according to the paper (Cloning and expression of murine Ig genes from single B cells, Thomas Tiller et al., Journal of Immunological Methods, 2009). In short, cDNA synthesis was performed using Maxima H Minus reverse transcriptase (Thermo Fisher) at 42°C for 5 min, 25°C for 10 min, 50°C for 60 min, and 94°C. Two rounds of semi-nested PCR were then performed using HotStar DNA polymerase (Qiagen) to enrich the heavy and light chains. The PCR products were purified and sequenced. Sequencing results were analyzed using IgBlast and the IMGT database. The VDJ / VJ fragment was amplified using gene-specific primers (Table 4), and the VDJ heavy chain and VJ light chain vectors were cloned using homologous recombination or T4 ligase ligation methods, respectively.
[0205] The primers used for the two-round semi-nested PCR are shown in Table 3. The PCR program was as follows: 95℃, 15 minutes; 95℃, 30 seconds; 50-65℃, 30 seconds; 72℃, 5 minutes.
[0206] Reverse transcription to cDNA: Add the following reagents to Mix 1 sequentially: 1.4 μL RNase-free water; 1 μL 10 mM dNTP; 1 μL 100 μM Random Primers; 1 μL template RNA. Incubate at 65°C for 5 min. Add the following reagents to Mix 2 sequentially: 4 μL 5×RT buffer; 0.1 μL RNase inhibitor; 0.25 μL reverse transcriptase; 11.25 μL RNase-free water. Mix 1 and Mix 2 together and run the reverse transcription PCR program: 42°C for 5 min; 25°C for 10 min; 50°C for 60 min; 85°C for 5 min; store at 4°C.
[0207] Table 3. Primers for semi-nested PCR
[0208]
[0209] The specific primers (upstream and downstream primers) used in this embodiment are shown in Table 4.
[0210] Table 4. Upstream and downstream primers for amplifying the VDJ / VJ fragment
[0211]
[0212]
[0213] The PCR reaction systems involved in this embodiment are shown in Table 5-10. Each reaction system can be scaled up or down proportionally according to the required reaction system.
[0214] Table 5. First round PCR reaction system for heavy chains
[0215]
[0216] Table 6. Heavy chain second-round PCR reaction system
[0217]
[0218] Table 7. Kappa light chain first-round PCR reaction system
[0219]
[0220]
[0221] Table 8. Second-round PCR reaction system for Kappa light chain
[0222]
[0223] Table 9. First-round PCR reaction system for lambda light chain
[0224]
[0225] Table 10. Second-round PCR reaction system for lambda light chain
[0226]
[0227]
[0228] The primer mixes mentioned above for the heavy chain, Kappa chain, and lambda light chain refer to the mixtures of the corresponding primers in Table 3 in the first and second rounds of semi-nested PCR for the corresponding heavy chain, Kappa chain, and lambda light chain. For example, in the IgK 1st PCR, 5′L-Vk mixFw is a mixture of 5L-Vκ_3, 5L-Vκ_4, 5L-Vκ_5, 5L-Vκ_6, 5L-Vκ_6-8-9, 5L-Vκ_14, 5L-Vκ_19, and 5L-Vκ_20, with each primer at 10 μM. The mixes in other PCR systems are explained accordingly.
[0229] The VDJ / VJ-specific primers in this embodiment include homologous arms of the heavy / light chain vectors, as well as specific portions of the VDJ / VJ fragments. Generally, the homologous arms of these specific primers will vary depending on the cloning vector used. This invention is not limited to the heavy and light chain vectors and specific primers used in this embodiment.
[0230] After reverse transcription and two rounds of semi-nested PCR, the nucleotide and amino acid sequences of the VDJ / VJ variable region of the antibody were sequenced to obtain antibodies numbered pCD20Ab2, pCD20Ab3, pCD20Ab6, and pCD20Ab7. The sequence of pCD20Ab3 (p20Ab3) is shown in Table 11.
[0231] Table 11. p20Ab3 sequence
[0232]
[0233] In this embodiment, the vector map for preparing CD20 antibody using the heavy chain constant region and light chain constant region vector of human IgG1 is shown below. Figure 3 and Figure 4 As shown.
[0234] In the humanized antibody heavy chain prepared in this embodiment, the CDR and FR regions are mouse-derived, while the constant region is human-derived; in the humanized light chain, the CDR and FR regions are mouse-derived, while the constant region is human-derived. The sequences of the constant regions of the humanized antibody heavy chain and light chain are shown in Table 12.
[0235] Table 12. Humanized Antibody Sequences
[0236]
[0237] Example 5: Detection of antibody binding to cell surface CD20 antigen
[0238] HEK293 T cells were used at a rate of 1×10 7Cells were seeded at a density of 10 cm in 10 cm cell culture dishes and cultured in a CO2 incubator (37°C, 5% CO2) for 12 hours. Cells were then co-transfected with Lipofectamine 3000 and the full-length porcine CD20 plasmid (CD20(NCBI acc.NM_001243394.1, constructed using standard techniques in the art) and pMax GFP plasmid. After 24 hours, the culture medium was replaced with fresh medium and the cells were cultured again. Forty-eight hours after transfection, cells were isolated in PBS with 2 mM EDTA, washed with PBS, and the single-cell suspension was filtered and placed into 96-well plates. The transfected cells were incubated with the expression antibodies paired with the clones in Example 4 at gradient concentrations of 0.0025 μg / ml, 0.01 μg / ml, 0.04 μg / ml, 0.16 μg / ml, 0.64 μg / ml, 2.56 μg / ml, and 10.24 μg / ml (antibody expression, purification, and identification were performed using conventional techniques in the art, and each monoclonal antibody was successfully expressed) for 1 hour. The cells were then washed twice with FACS and then incubated with DAPi and APC. + Anti-HumanIgG1 staining was performed for 15 minutes, and all staining procedures were completed on ice. DAPI-GFP+APC was cytometrically analyzed using a CytoFLEX LX (Beckman Coulter) flow cytometer. + IgG+ cells were analyzed.
[0239] Results of flow cytometry experiments as follows Figure 5 As shown, the horizontal axis represents antibody concentration, and the vertical axis represents the antigen-antibody binding MFI value; specific values are shown in Table 13.
[0240] Table 13. Average fluorescence intensity (MFI) of mAb binding to porcine CD20 detected by flow cytometry
[0241] Concentration (pg / ml) p20Ab2 p20Ab3 p20Ab6 p20Ab7 NC PC 10 1092 69987 557 431 422 1553 2.5 594 48181 425 386 366 860 0.64 548 20175 384 380 359 485 0.16 503 5922 371 370 348 380 0.04 477 2015 369 367 347 358 0.01 375 1174 363 358 351 373 0.0025 363 576 346 352 339 353
[0242] Analysis showed that at a concentration of 10 μg / mL, in the positive (PC) control group, the mean fluorescence intensity (MFI) of the 293T cell line stably expressing the full-length CD20 protein after specific binding with the laboratory-prepared anti-CD20 monoclonal antibody reached 1553; while in the negative (NC) control group, the MFI value of samples treated only with FACS buffer was 422. In the CD20 antibody group, the APC of pCD20Ab3... + The MFI value of positive cells was high, at 1.43 × 10⁻⁶. 4 The values for pCD20Ab2, pCD20Ab6, and pCD20Ab7 are relatively low, approximately 3 × 10⁻⁶. 2 -7×10 2This study confirmed the successful screening of the high-affinity CD20-binding antibody pCD20Ab3. NC served as the negative control group, consisting of 293T cells stably expressing the full-length CD20 membrane protein treated only with FACS buffer, without antibody incubation. PC served as the positive control group, using an antibody proven to specifically bind to 293T cells stably expressing the full-length CD20 membrane protein; this antibody was used as the positive control in the experiment.
[0243] Example 6: Experimental results and analysis of antibody-conjugated fluorescence or other detection markers for sorting porcine PBMC cells. The antibody that specifically binds to CD20 in Example 5 was conjugated with Alexa Fluor 647 (AF647) using conventional conjugation techniques in the art, or conjugated with other markers such as biotin. p20Ab3 was conjugated with AF647. After successful self-made conjugation, porcine PBMC cells were sorted.
[0244] To verify the specific binding ability of the anti-pig CD20 monoclonal antibody, this study used two-color flow cytometry to analyze porcine PBMCs. In the experimental design, dead cells were excluded using DAPI dye, and a self-made murine anti-pig CD20 monoclonal antibody was co-labeled with a commercially available anti-pig CD21-PE antibody.
[0245] The results are as follows Figure 6 As shown, flow cytometry analysis revealed the proportion of CD20+CD21+ double-positive cells within the lymphocyte phylum. With p20Ab3 conjugated to AF647, the proportion of double-positive cells was 2.13%. The surface marker combination of the CD20+CD21+ subset was highly consistent with the classic phenotype of porcine B lymphocytes, confirming that the self-made antibody can specifically recognize porcine CD20 antigen-positive cells.
[0246] All documents mentioned in this invention are incorporated herein by reference as if each document were individually incorporated by reference. Furthermore, it should be understood that after reading the foregoing teachings of this invention, those skilled in the art can make various alterations or modifications to this invention, and these equivalent forms also fall within the scope defined by the appended claims.
Claims
1. An antibody against porcine B cell surface CD20 or its antigen-binding fragment, characterized in that, The antibody or its antigen-binding fragment has the following three complementary determinant regions (HCDR) of the heavy chain variable region and three complementary determinant regions (LCDR) of the light chain variable region: HCDR1, as shown in SEQ ID NO:1, HCDR2, as shown in SEQ ID NO:2, HCDR3, as shown in SEQ ID NO:3, LCDR1, as shown in SEQ ID NO:4, LCDR2, as shown in SEQ ID NO:5, and LCDR3, as shown in SEQ ID NO:
6.
2. The antibody or its antigen-binding fragment as described in claim 1, characterized in that, The heavy chain variable region and light chain variable region of the anti-porcine B cell surface CD20 antibody or its antigen-binding fragment are the heavy chain variable region with an amino acid sequence as shown in SEQ ID NO:7 and the light chain variable region with an amino acid sequence as shown in SEQ ID NO:
8.
3. A recombinant protein, characterized in that, The recombinant protein has the following characteristics: (1) The anti-porcine B cell surface CD20 antibody or its antigen-binding fragment as described in claim 1; and (2) Optional tag sequence for expression and / or purification.
4. A polynucleotide, characterized in that, The polynucleotide expression is the anti-porcine B cell surface CD20 antibody or its antigen-binding fragment as described in claim 1.
5. A carrier, characterized in that, The carrier contains the polynucleotide as described in claim 4.
6. A host cell, characterized in that, The host cell expresses the anti-porcine B cell surface CD20 antibody of claim 1 or its antigen-binding fragment, and its genome is integrated with the polynucleotide of claim 4, or contains the vector of claim 5.
7. An antibody-drug conjugate, characterized in that, The antibody-drug conjugate contains: (I) Antibody portion, wherein the antibody portion comprises the anti-porcine B cell surface CD20 antibody of claim 1 or its antigen-binding fragment; and (II) A conjugation portion coupled to the antibody or its antigen-binding fragment, the conjugation portion being selected from the group consisting of: detectable markers, drugs, or combinations thereof.
8. A pharmaceutical composition, characterized in that, The pharmaceutical composition contains: (a) the anti-porcine B cell surface CD20 antibody of claim 1 or its antigen-binding fragment, the recombinant protein of claim 3, the polynucleotide of claim 4, the vector of claim 5, the host cell of claim 6, or the antibody-drug conjugate of claim 7; and (b) Pharmaceutically acceptable carriers, diluents or excipients.
9. The use of the anti-porcine B cell surface CD20 antibody or its antigen-binding fragment according to claim 1, the recombinant protein according to claim 3, the polynucleotide according to claim 4, the vector according to claim 5, the host cell according to claim 6, or the antibody-drug conjugate according to claim 7, characterized in that, Used for the preparation of pharmaceuticals, reagents, test plates, or kits.
10. A method for detecting CD20 protein in a sample, characterized in that, The method includes the following steps: (y1) Contact the sample with the antibody or its antigen-binding fragment as described in claim 1; (y2) Detect whether an antigen-antibody complex is formed, wherein if an antigen-antibody complex is formed, it indicates that the CD20 protein is present in the sample.
Citation Information
Patent Citations
CD22 antibody and application thereof
CN114106177A
Anti-CD48 antibodies, antibody drug conjugates, and uses thereof
US20220162308A1