Oriental armyworm CYP341B55 gene and application of oriental armyworm CYP341B55 gene in control of oriental armyworm
By silencing the CYP341B55 gene of the Eastern Armyworm using RNAi technology and interfering with its growth and development using dsRNA biological agents, the problems of chemical pesticide pollution and resistance were solved, achieving a green control effect for the Eastern Armyworm.
Patent Information
- Application Number
- CN202510900369.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-30
- Publication Date
- 2025-11-18
AI Technical Summary
Existing chemical pesticides cause environmental pollution and pesticide resistance problems when controlling Eastern armyworm, while biological agents are not very effective, so it is necessary to explore green control methods.
Using the CYP341B55 gene and its expression inhibitor, the CYP341B55 gene, which is highly expressed in the epidermis of the Eastern armyworm, was silenced by RNAi technology to prepare dsRNA biological agents that interfere with its growth, development, and epidermal formation.
This study achieved efficient mortality and growth inhibition of Oriental armyworm larvae, as well as epidermal abnormalities, providing a promising application prospect for green control technology.
Smart Images
Figure CN120966830A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the technical field of agricultural pest control, in particular to a CYP341B55 gene of oriental armyworm and application thereof in oriental armyworm control. BACKGROUND
[0002] Oriental armyworm (Mythimna separata (Walker)) belongs to Lepidoptera Noctuidae and is a migratory agricultural pest, which mainly harms cereal crops such as wheat, corn, rice and sorghum, and its larvae cause serious yield reduction or even absolute loss of crops by feeding on crop leaves. In addition, oriental armyworm has strong environmental adaptability, and its damage range and frequency are continuously aggravated by global climate change and adjustment of crop planting area structure.
[0003] At present, the control of oriental armyworm mainly relies on chemical pesticides such as pyrethroid and organophosphorus ester. However, in recent years, long-term use of such chemical pesticides not only causes serious environmental pollution and ecological imbalance, but also induces the evolution of some armyworm resistance. Although some biological agents such as dipterin and Bacillus thuringiensis preparations have certain control effect on armyworm in specific scenarios, the control effect is still not as good as that of traditional chemical pesticides. Therefore, it is necessary to further explore green control methods to alleviate the increase of armyworm resistance and provide new theoretical basis for regulating the environmental adaptability of armyworm. SUMMARY
[0004] The purpose of the present application is to overcome the above-mentioned deficiencies of the prior art, and to provide a CYP341B55 gene of oriental armyworm and application thereof in oriental armyworm control.
[0005] The first purpose of the present application is to provide the application of CYP341B55 gene and / or its expression inhibitor in preventing oriental armyworm pest and / or preparing products for controlling oriental armyworm pest.
[0006] The second purpose of the present application is to provide the application of CYP341B55 gene and / or its expression inhibitor in inhibiting the growth of oriental armyworm and / or preparing products for inhibiting the growth of oriental armyworm.
[0007] The third purpose of the present application is to provide the application of CYP341B55 gene and / or its expression inhibitor in promoting the death of oriental armyworm and / or preparing products for promoting the death of oriental armyworm.
[0008] The fourth purpose of the present application is to provide a biological agent for controlling oriental armyworm.
[0009] The fifth purpose of the present application is to provide a method for controlling oriental armyworm.
[0010] In order to achieve the above-mentioned purposes, the present application is realized by the following scheme:
[0011] The function of CYP341B subfamily in cytochrome P450 gene family in Lepidoptera pest epidermis development has not been clear. The present application detects the expression of CYP341B55 in different development stages and larva tissues by RT-qPCR technology, identifies the function of CYP341B55 in larva epidermis by RNAi technology, and provides a potential target for further understanding the function of CYP341B55 gene in Mythimna separata and RNAi-based pest control.
[0012] Therefore, the present application claims the following:
[0013] The present application provides the application of CYP341B55 gene and / or expression inhibitor thereof in preventing Mythimna separata pest and / or preparing product for preventing Mythimna separata pest, wherein the nucleotide sequence of the CYP341B55 gene is shown as SEQ ID NO: 3.
[0014] The present application claims the application of CYP341B55 gene and / or expression inhibitor thereof in inhibiting the growth of Mythimna separata and / or preparing product for inhibiting the growth of Mythimna separata, wherein the nucleotide sequence of the CYP341B55 gene is shown as SEQ ID NO: 3.
[0015] Further, the CYP341B55 gene and / or expression inhibitor thereof reduces the body weight of Mythimna separata.
[0016] Further, the CYP341B55 gene and / or expression inhibitor thereof shortens the body length of Mythimna separata.
[0017] Further, the CYP341B55 gene and / or expression inhibitor thereof destroys the epidermis of Mythimna separata.
[0018] The present application also claims the application of CYP341B55 gene and / or expression inhibitor thereof in promoting the death of Mythimna separata and / or preparing product for promoting the death of Mythimna separata, wherein the nucleotide sequence of the CYP341B55 gene is shown as SEQ ID NO: 3.
[0019] In the specific embodiment of the present application, the expression inhibitor comprises dsRNA, wherein the nucleotide sequence of one strand of the dsRNA is shown as SEQ ID NO: 13.
[0020] The present application provides a biological preparation for preventing and treating Mythimna separata, wherein the biological preparation contains dsRNA, and the nucleotide sequence of one strand of the dsRNA is shown as SEQ ID NO: 13.
[0021] The application also provides a method for preventing and treating P. xylostella, and silencing or inhibiting expression of a CYP341B55 gene of P. xylostella.
[0022] Further, the expression of the CYP341B55 gene of P. xylostella is silenced or inhibited by using a CYP341B55 gene and / or an expression inhibitor thereof, wherein the CYP341B55 gene and / or the expression inhibitor thereof contains a dsRNA, and a nucleotide sequence of one strand of the dsRNA is shown in SEQ ID NO: 13.
[0023] Compared with the prior art, the application has the following beneficial effects:
[0024] The application silences the CYP341B55 gene of P. xylostella by using the RNAi technology, so that the larvae of P. xylostella die eventually due to growth and development being blocked before molting, the larvae of P. xylostella have abnormal epidermis, the epidermis shrinks, and the weight and length of the body are significantly inhibited. The application provides a dsRNA for silencing or inhibiting expression of the CYP341B55 gene of P. xylostella, and the dsRNA can be used to prepare a new nucleic acid pesticide, and has a great application prospect in green prevention and control technology of P. xylostella. BRIEF DESCRIPTION OF DRAWINGS
[0025] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, the drawings needed to be used in the embodiments or the prior art description will be briefly introduced. Obviously, the drawings in the following description are only some embodiments of the present application, and other drawings can be obtained by those skilled in the art without creative effort on the basis of these drawings.
[0026] Figure 1 The expression level of the CYP341B55 gene in different developmental stages of P. xylostella.
[0027] Figure 2 The expression level of the CYP341B55 gene in different tissues of P. xylostella.
[0028] Figure 3 The expression level of the CYP341B55 gene in the epidermis of P. xylostella in different developmental stages.
[0029] Figure 4 The expression level of the CYP341B55 gene of P. xylostella 24 hours after injection of the dsRNA.
[0030] Figure 5 The phenotype of P. xylostella 72 hours after injection of the dsRNA, wherein A is dsGFP, and B is dsCYP341B55.
[0031] Figure 6The change in body weight of surviving *Oriental armyworm* over 6 days after dsRNA injection.
[0032] Figure 7 The changes in body length of Oriental armyworms surviving 6 days after injection of dsRNA.
[0033] Figure 8 The survival rate of *Oriental Armyworm* 6 days after dsRNA injection. Detailed Implementation
[0034] To facilitate understanding of the present invention, it will be described in more detail below. However, it should be understood that the present invention can be implemented in many different forms and is not limited to the embodiments or examples described herein. Rather, these embodiments or examples are provided to make the disclosure of the present invention more thorough and complete.
[0035] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. The terminology used herein in the specification of this invention is for the purpose of describing particular embodiments or examples only and is not intended to limit the invention. The optional scope of the term "and / or" as used herein includes any one of two or more of the related listed items, as well as any and all combinations of the related listed items, including any two related listed items, any more related listed items, or a combination of all related listed items.
[0036] In this invention, numerical ranges are involved. Unless otherwise specified, the numerical ranges are considered continuous and include the minimum and maximum values of the range, as well as every value between the minimum and maximum values. Furthermore, when the range refers to integers, it includes every integer between the minimum and maximum values of the range. Additionally, when multiple ranges are provided to describe features or characteristics, the ranges may be merged. In other words, unless otherwise specified, all ranges disclosed herein should be understood to include any and all subranges to which they are included.
[0037] Example 1
[0038] 1. Insect breeding
[0039] Oriental armyworm (Mythimna separata) was selected from a laboratory-raised population collected from a wild population in Yu'an District, Lu'an City, Anhui Province. This population had been maintained in the laboratory for over 15 generations before being used in experiments. Larvae were fed fresh corn leaves before the third instar, and then fed artificial feed after the third instar. Adults were fed 10% (w / v) honey water and reared in mesh cages. All insects were reared under laboratory conditions: relative humidity 70±10%, temperature 25±1℃, and a photoperiod of 12h light: 12h darkness.
[0040] 2. Sample collection
[0041] Samples of *Armoriae orientalis* at different developmental stages were collected, including eggs, 1st to 6th instar larvae, pupae, female adults, and male adults. Specifically, approximately 200 eggs, 10 1st to 6th instar larvae, 10 pupae, and 10 female and 10 male adults were collected. Different tissues of the 4th instar larvae were dissected and collected in phosphate-buffered saline (PBS), including the head, thorax, abdomen, epidermis, intestine, Malpighian tubules, ventral nerve cord, brain, and mandibles. For each tissue type, 15 4th instar larvae were dissected and collected as one sample. In addition, 20 1st to 2nd instar larvae and 10 3rd to 6th instar larvae were dissected and collected as epidermal samples. All sample collections were performed in triplicate.
[0042] 3. Total RNA extraction and cDNA synthesis
[0043] Total RNA was extracted from each *Armoria spp.* sample using Trizol reagent (TaKaRa, Dalian, China). RNA content was determined by measuring absorbance at 260 nm and absorbance ratio (OD260 / 280, 1.9–2.1) using a Nanodrop ND-1000 spectrophotometer (Nanodrop Technologies, Wilmington, DE, USA). RNA integrity was assessed by detecting RNA on a 1% (w / v) agarose gel electrophoresis. cDNA was synthesized using reverse transcription with a HiScript III RT SuperMix for qPCR (+gDNA wiper) (Vazyme, Nanjing, China) according to the manufacturer's protocol. The synthesized cDNA was stored at -20°C.
[0044] 4. PCR amplification
[0045] The PCR reaction system was configured as shown in Table 1. The nucleotide sequence of the upstream primer was ATGCTGTGGCTCCTAGTG (SEQ ID NO: 1), and the nucleotide sequence of the downstream primer was TTATGTTCTTGGTTCAAGCTGTA (SEQ ID NO: 2).
[0046] Table 1
[0047]
[0048] The PCR reaction conditions were as follows: preheating at 98℃ for 3 min (to fully denature and unwind the template); denaturation at 98℃ for 10 s, annealing at 64℃ for 5 s, extension at 72℃ to synthesize new strands for 5 min, primer extension at 72℃ for 5 min, 35 cycles; storage at 4℃.
[0049] The CYP341B55 gene of *Armoria spp.* was obtained by PCR amplification. Its nucleotide sequence is shown in SEQ ID NO: 3, and the amino acid sequence of the protein it encodes is shown in SEQ ID NO: 4.
[0050] 5. Quantitative reverse transcription polymerase chain reaction (RT-qPCR)
[0051] Based on the alignment results of the open reading frame (ORF) sequence of the CYP341B55 gene of *Armoria spp.*, specific primers for RT-qPCR were designed and synthesized. The nucleotide sequence of the upstream primer was CTAGTGGTTTGGACAGCGGT (SEQ ID NO: 5), and the nucleotide sequence of the downstream primer was TCCAAAGGAGGTCGCCATTC (SEQ ID NO: 6). The reaction system is shown in Table 2. qPCR was performed using a Bio-RadiCycler iQ real-time detection system (Bio-Rad, Hercules, CA, USA) according to the manufacturer's instructions using TB GreenPremix Ex Taq II (Tli RNaseH Plus, Takara). The amplification program consisted of 40 cycles: pre-denaturation at 98℃ for 2 min, denaturation at 98℃ for 15 s, and annealing at 60℃ for 30 s. Finally, melting curve analysis was performed at 60℃ to 95℃ at the end of each reaction. Ribosomal protein 49 (rp49) was used as an internal reference gene for armyworms. The nucleotide sequence of the upstream primer for rp49 is TGACAAACTCAAGCGTAACTGGCG (SEQ ID NO: 7), and the nucleotide sequence of the downstream primer for rp49 is GTGAGCGTCTTCCACACAGA (SEQ ID NO: 8). The relative expression level of the target gene was calculated using the comparison threshold cycle (CT) method.
[0052] Table 2
[0053]
[0054] 6. Data Analysis
[0055] Statistical analysis was performed using SPSS 22.0 software (IBM, Chicago, IL, USA). One-way ANOVA was used, and Tukey's honest significant difference (HSD) test was employed. A p-value < 0.05 was considered statistically significant. The expression differences of the CYP341B55 gene among different developmental stages, larval tissues, and epidermis of larvae of different ages were analyzed.
[0056] 7. Results
[0057] (1) Gene expression profiles of CYP341B55 at different developmental stages
[0058] like Figure 1 As shown, CYP341B55 was dynamically detected at different developmental stages. Among them, CYP341B55 was expressed at a higher level in 6th instar larvae, followed by 4th and 3rd instar larvae.
[0059] (2) CYP341B55 gene expression profiles in various tissues
[0060] like Figure 2 As shown, comparing the expression levels of CYP341B55 in different larval tissues such as head, thorax, abdomen, epidermis, intestine, Malpighian tubules, ventral nerve cord, brain, and mandibles, CYP341B55 is mainly expressed in the larval epidermis.
[0061] (3) Expression profiles of larvae in the epidermis at different larval stages
[0062] like Figure 3 As shown, comparing the expression profiles of the CYP341B55 gene in the epidermis of larvae at different instars, CYP341B55 can be dynamically detected at different developmental stages. Among them, CYP341B55 is expressed at higher levels in the 5th and 6th instars.
[0063] Example 2: Synthesis of dsRNA
[0064] 1. Based on a specific fragment of the CYP341B55 gene sequence from *Armoria spp.*, specific primers carrying the T7 RNA polymerase promoter were designed using Primer Premier 5. The upstream primer targeting the dsRNA sequence of the CYP341B55 gene has the nucleotide sequence taatacgactcactatagggAACCCGAACTGCCTTTTCTT (dsCYP341B55-F, SEQ ID NO: 9), and the downstream primer targeting the dsRNA sequence of the CYP341B55 gene has the nucleotide sequence taatacgactcactatagggGAAACGAGGCAGGTCTTCAG (dsCYP341B55-R, SEQ ID NO: 10). Primers dsCYP341B55-F and dsCYP341B55-R were used to amplify the CYP341B55 fragment.
[0065] Primers specific to the green fluorescent protein (GFP) gene dsRNA sequence were designed using the same method as a negative control. The nucleotide sequence of the upstream primer targeting the GFP gene dsRNA is taatacgactcactatagggAGTGCTTCAGCCGCTACCC (dsGFP-F, SEQ ID NO: 11), and the nucleotide sequence of the downstream primer targeting the GFP gene dsRNA is taatacgactcactatagggGCGCTTCTCGTTGGGGTC (dsGFP-R, SEQ ID NO: 12). Primers dsGFP-F and dsGFP-R were used to amplify the GFP fragment.
[0066] Using the specific primers designed in Example 2, PCR amplification was performed on the cDNA synthesized in Example 1 and the GFP-containing plasmid, respectively. The reaction system is shown in Table 1. The amplification products were used to synthesize dsRNA.
[0067] The components of the reaction system were mixed thoroughly. The PCR amplification program was as follows: preheating at 98℃ for 3 min (to fully denature and unwind the template); denaturation at 98℃ for 10 s, annealing at 64℃ for 5 s, extension at 72℃ for 5 min to synthesize new strands, and primer extension at 72℃ for 5 min, for 35 cycles; storage at 4℃. Two PCR products were obtained, purified, and recovered, yielding two PCR recovered products.
[0068] Two PCR-recovered products (linear DNA templates) were obtained in vitro using the T7 RiboMAX Express Large Scale RNA Production System Kit (Promega, Beijing, China) according to the manufacturer's protocol. These templates were used to synthesize CYP341B55 dsRNA (dsCYP341B55) and GFP dsRNA (dsGFP), respectively, yielding dsCYP341B55 and dsGFP. The reaction system for dsRNA synthesis is shown in Table 3. After mixing, the system was incubated at 37°C for 30 min.
[0069] Table 3
[0070]
[0071] CYP341B55 dsRNA (dsCYP341B55) is a double-stranded RNA, with the nucleotide sequence of one RNA strand as shown in SEQ ID NO: 13, and the other strand being its complementary strand.
[0072] 2. dsRNA purification:
[0073] (1) Add 1 μL of RQ RNase-FreeDNase (RQ1 RNase-free DNA enzyme) and incubate at 37°C for 15 min.
[0074] (2) Aspirate the dsRNA sample from the 200 μL PCR tube and transfer it to a clean 1.5 mL centrifuge tube. Add an appropriate amount of ddH2O to make the total volume of dsRNA sample and ddH2O reach 100 or 200 μL (to facilitate the collection of supernatant).
[0075] (3) Add an equal volume of phenol, chloroform and isoamyl alcohol mixture (phenol: chloroform: isoamyl alcohol volume ratio = 125: 24: 1) to the total system of dsRNA sample and ddH2O in step (2), vortex for 1 min, centrifuge at 12000 rpm for 2 min, and obtain supernatant 1.
[0076] (4) Add a chloroform-isoamyl alcohol mixture (chloroform:isoamyl alcohol volume ratio = 24:1) to the supernatant of step (3) and vortex for 1 min, then centrifuge at 12000 rpm for 2 min to obtain supernatant 2.
[0077] (5) Take the supernatant 2 from step (4) and add 0.1 of the system (0.1 of the total system of dsRNA sample and ddH2O in step (2)) of 3M sodium acetate (pH=5.2) to obtain the supernatant 2 sodium acetate mixture. Add an equal volume of isoamyl alcohol or 2.5 volumes (2.5 times the volume of the supernatant 2 sodium acetate mixture) of 95% v / v ethanol, mix well, stand on ice for 2 min to 5 min, centrifuge at 12000 r for 10 min, remove the supernatant and retain the precipitate.
[0078] (6) Add 1 mL of 70% (v / v) ethanol to the precipitate in step (5), centrifuge at 1200 r for 2 min, retain the precipitate, wash, remove the ethanol and centrifuge for 1 min, air dry, add 25 μL of RNAase water, blow and dissolve the precipitate to obtain purified dsRNA, and store at -80℃.
[0079] Example 3: Effects of the CYP341B55 gene on the epidermal development of oriental armyworm larvae
[0080] 1. RNAi via microinjection
[0081] Purified dsRNA was dissolved and diluted with RNAase to a concentration of 2000 ng / μL to obtain a dsRNA solution. This solution was then slowly injected into the abdomens of early third instar larvae of similar size, using a Nanoliter 2010 microinjection system (World Precision Instruments, Sarasota, FL, USA). Larvae injected with green fluorescent protein dsRNA (dsGFP) served as a control. Each larva was injected with 1 μL of dsRNA, with 30 larvae injected for each gene. After dsRNA injection, the larvae from each group were individually reared under the same suitable environment and provided with artificial feed. 24 hours after injection, three larvae from each group were randomly selected, and the expression level of the CYP341B55 gene was detected using RT-qPCR as described in Example 1. Three biological replicates were performed to determine the silencing efficiency and evaluate the efficiency of RNAi-induced gene silencing.
[0082] 2. Observation of larval phenotype
[0083] The changes in the larval epidermis of the dsCYP341B55 injection group and the dsGFP injection group were observed and compared. The phenotype of the larval epidermis was photographed using a QImaging Micropublisher 3.3 digital camera (Tokyo, Japan) mounted on an Olympus BS41 stereomicroscope, and the larval weight and body length were recorded.
[0084] 3. Data Analysis
[0085] Statistical analysis was performed using SPSS 22.0 software (IBM, Chicago, IL, USA). Independent samples t-tests were used to detect differences in RNAi silencing efficiency and larval weight and body length; P < 0.05 was considered statistically significant. GraphPadPrism 9 software was used for plotting.
[0086] 4. Results
[0087] Functional analysis of the epidermal hyperexpression gene CYP341B55 was performed using RNAi technology. When equal amounts of dsCYP341B55 and dsGFP were injected into larvae using a microinjection system, the expression level of CYP341B55 decreased by 78.3% (F = 3.122; df = 4; P = 0.0047). Figure 4 After silencing CYP341B55 via RNA interference, abnormalities such as epidermal wrinkling were observed in the larvae of *Armoria spp.* Figure 5 In the 6 days following injection, compared to the control group, the interference with the CYP341B55 gene significantly suppressed both larval weight and body length. Figure 6 , Figure 7 ), and approximately 76.7% of the larvae died within 5 days of injection of dsCYP341B55. Figure 8 This indicates that interfering with the CYP341B55 gene has an inhibitory effect on the growth and development of oriental armyworm larvae.
[0088] The technical features of the above embodiments can be combined in any way. For the sake of brevity, not all possible combinations of the technical features in the above embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.
[0089] The embodiments described above are merely illustrative of several implementations of the present invention, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the invention patent. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these all fall within the protection scope of the present invention. Therefore, the protection scope of this invention patent should be determined by the appended claims.
Claims
1. The application of the CYP341B55 gene and / or its expression inhibitors in the prevention of armyworm infestation and / or the preparation of products for controlling armyworm infestation, characterized in that, The nucleotide sequence of the CYP341B55 gene is shown in SEQ ID NO:
3.
2. The application of the CYP341B55 gene and / or its expression inhibitors in inhibiting the growth of *Armoria spp.* and / or in the preparation of products that inhibit the growth of *Armoria spp.*, characterized in that, The nucleotide sequence of the CYP341B55 gene is shown in SEQ ID NO:
3.
3. The application according to claim 2, characterized in that, The CYP341B55 gene and / or its expression inhibitors reduce the body weight of *Armoria spp.* 4. The application according to claim 2, characterized in that, The CYP341B55 gene and / or its expression inhibitors shorten the body length of the Oriental armyworm.
5. The application according to claim 2, characterized in that, The CYP341B55 gene and / or its expression inhibitors disrupt the epidermis of the Eastern armyworm.
6. The use of the CYP341B55 gene and / or its expression inhibitors in promoting the death of *Armoria spp.* and / or in the preparation of products that promote the death of *Armoria spp.*, characterized in that, The nucleotide sequence of the CYP341B55 gene is shown in SEQ ID NO:
3.
7. The application according to any one of claims 1 to 6, characterized in that, The expression inhibitor includes dsRNA, the nucleotide sequence of one strand of which is shown in SEQ ID NO:
13.
8. A biological agent for controlling the Eastern armyworm, characterized in that, The biological agent contains dsRNA, and the nucleotide sequence of one strand of the dsRNA is shown in SEQ ID NO:
13.
9. A method for controlling the Eastern armyworm, characterized in that, Silencing or suppressing the expression of the CYP341B55 gene in *Oriental armyworm*.
10. The method according to claim 9, characterized in that, The expression of the CYP341B55 gene of *Armoria serratifolia* is silenced or inhibited by the CYP341B55 gene and / or its expression inhibitor, wherein the CYP341B55 gene and / or its expression inhibitor contains dsRNA, and the nucleotide sequence of one strand of the dsRNA is shown in SEQ ID NO: 13.